The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	10273	65769	4195298	capsid,terminase,tRNA,plate,head,tail,portal	Pseudomonas_phage(25.0%)	63	NA	NA
WP_004193488.1|10273_10678_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004526515.1|11106_12318_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_009965224.1|12353_12623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534949.1|13360_14293_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004191983.1|14552_14777_-	lipoprotein	NA	NA	NA	NA	NA
WP_004193128.1|15028_15241_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_004521865.1|15464_17396_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_004526521.1|18053_18359_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_004195184.1|18519_19344_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_085504262.1|19385_20483_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_004526525.1|20498_21290_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076802140.1|21517_21727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192284.1|21743_22679_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004193486.1|23030_24227_-	MFS transporter	NA	NA	NA	NA	NA
WP_004201361.1|24234_24387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200135.1|24505_25294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009965267.1|25461_25872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009970370.1|25843_26134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004542968.1|26227_27055_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_004538444.1|27277_28306_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.5e-21
WP_020850830.1|28481_29387_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_009965292.1|30019_30532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191802.1|30595_31420_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004193494.1|31528_32590_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_009965295.1|32646_33672_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_085503757.1|34133_34742_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_085503758.1|35001_35205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503759.1|35208_35748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130421.1|35799_36450_-	glycoside hydrolase family 19 protein	NA	B5M9U5	Pseudomonas_phage	43.3	1.2e-31
WP_085503761.1|36494_37139_-	HNH endonuclease	NA	A0A096XUV0	Cronobacter_phage	45.1	8.5e-19
WP_085503762.1|37231_37561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130281.1|37849_40153_-	hypothetical protein	NA	Q8HAL3	Burkholderia_phage	33.0	5.6e-12
WP_085503763.1|40136_40934_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_085504263.1|41131_41842_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	64.9	3.1e-70
WP_085503765.1|42123_42771_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_085503766.1|42779_43901_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	27.8	4.5e-15
WP_085503767.1|43900_44347_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	38.1	2.8e-21
WP_085503768.1|44343_44943_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	37.3	2.7e-19
WP_085503769.1|44939_46031_-	Mu P family protein	NA	M1PVV2	Vibrio_phage	30.4	1.2e-33
WP_085503770.1|46054_46450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503771.1|46452_47910_-	DNA circulation family protein	NA	U5P4I0	Shigella_phage	22.9	5.1e-19
WP_085503772.1|47906_49757_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_085503773.1|49875_50160_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_085504264.1|50161_50530_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_085503774.1|50581_52063_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.3	1.6e-100
WP_085503775.1|52059_52236_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_085503776.1|52246_52891_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_085503777.1|52887_53217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130282.1|53223_53505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503778.1|53504_54566_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.3	2.9e-48
WP_157130284.1|54650_55661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503781.1|56386_57268_-	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	39.9	9.8e-50
WP_085504265.1|57264_58830_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	34.8	5.5e-88
WP_085504266.1|58898_59126_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_085503782.1|59170_61261_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.8	1.0e-97
WP_157130286.1|61232_61850_-	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	26.7	3.6e-06
WP_157130288.1|61902_62688_-	hypothetical protein	NA	A0A0H5BBW8	Pseudomonas_phage	40.3	1.4e-15
WP_085503785.1|62791_63106_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	44.8	9.9e-13
WP_085503786.1|63098_63293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503787.1|63303_64002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503788.1|64095_64314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130290.1|64279_64552_-	hypothetical protein	NA	A0A2R2YAX9	Pseudomonas_phage	62.0	8.8e-10
WP_157130292.1|64548_65769_-	hypothetical protein	NA	A0A291LA70	Bordetella_phage	63.9	8.2e-156
>prophage 2
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	69261	75372	4195298		Burkholderia_virus(25.0%)	16	NA	NA
WP_085503793.1|69261_69699_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	52.1	2.8e-29
WP_157130308.1|69695_70043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130310.1|70032_70527_-	hypothetical protein	NA	I6NMK4	Burkholderia_virus	32.7	1.2e-15
WP_085504267.1|70523_70847_-	hypothetical protein	NA	A0A0P0IYD2	Acinetobacter_phage	53.0	3.6e-18
WP_085503796.1|70846_71029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130312.1|71025_71208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130314.1|71204_71489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503797.1|71485_71698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130315.1|71700_72183_-	hypothetical protein	NA	A0A2D2W3E4	Mycobacterium_phage	57.4	2.2e-35
WP_085503799.1|72179_72491_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	45.0	1.1e-19
WP_157130317.1|72487_73081_-	hypothetical protein	NA	Q3HR01	Burkholderia_phage	32.4	9.3e-12
WP_085503800.1|73080_73572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503801.1|73582_73867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503802.1|73863_74553_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_085503803.1|74554_75043_-	HNH endonuclease	NA	A9J705	Pseudomonas_phage	38.0	1.9e-18
WP_085503804.1|75021_75372_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	66.7	7.8e-35
>prophage 3
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	82385	101348	4195298	integrase	Burkholderia_virus(27.78%)	36	95847:95861	102491:102505
WP_085503810.1|82385_82526_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	60.9	7.5e-05
WP_157130328.1|82566_82800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503812.1|82827_83022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503813.1|84535_84796_+	hypothetical protein	NA	I6NVM7	Burkholderia_virus	56.5	2.2e-18
WP_085503814.1|84844_85135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130330.1|85138_85453_+	hypothetical protein	NA	R9TNI1	Aeromonas_phage	41.1	1.8e-06
WP_085503815.1|85792_86047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503816.1|86532_86757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503817.1|86766_87036_+	hypothetical protein	NA	F8WPQ1	Bacillus_phage	53.4	1.8e-18
WP_085503818.1|87035_87239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130331.1|87235_87553_+	DUF2528 family protein	NA	Q6QIE6	Burkholderia_phage	30.9	3.7e-07
WP_157130333.1|87549_87708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157129860.1|87704_88031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130335.1|88027_88213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503820.1|88222_89422_+	hypothetical protein	NA	A0A2D0W9Q9	Bordetella_phage	43.3	1.5e-85
WP_085503821.1|89554_90481_+	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	56.7	3.9e-57
WP_085503822.1|90488_91268_+	hypothetical protein	NA	X2CYL5	Brucella_phage	34.0	5.5e-28
WP_085503823.1|91307_91715_+	hypothetical protein	NA	A0A2K9V403	Faecalibacterium_phage	44.6	1.5e-24
WP_085503812.1|92086_92281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503825.1|92331_93501_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	39.5	6.3e-12
WP_085504270.1|93524_93770_+	hypothetical protein	NA	Q6V7Q4	Burkholderia_virus	76.7	7.4e-16
WP_085503826.1|94191_94824_+	hypothetical protein	NA	D5LH17	Escherichia_phage	49.1	1.2e-46
WP_085503827.1|94835_95771_+	hypothetical protein	NA	A1YZU8	Burkholderia_virus	58.5	2.3e-17
WP_085503828.1|95772_96717_+	hypothetical protein	NA	NA	NA	NA	NA
95847:95861	attL	TGCCGACGCAATCCG	NA	NA	NA	NA
WP_085504272.1|96808_97315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503829.1|97307_97694_+	hypothetical protein	NA	A9YWU7	Burkholderia_phage	38.0	3.4e-07
WP_085503830.1|97686_97956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130337.1|98165_98303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130339.1|98295_98580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503831.1|98576_99047_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	76.9	1.8e-63
WP_157130341.1|99043_99406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157129623.1|99402_99558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130344.1|99554_99749_+	hypothetical protein	NA	A9YWV0	Burkholderia_phage	84.0	2.3e-20
WP_085503832.1|99745_100081_+	hypothetical protein	NA	A9YWU9	Burkholderia_phage	80.0	1.4e-25
WP_085503833.1|100077_100326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503834.1|100310_101348_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	42.7	1.1e-65
102491:102505	attR	TGCCGACGCAATCCG	NA	NA	NA	NA
>prophage 4
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	201193	227265	4195298	capsid,integrase,plate,transposase	Stx2-converting_phage(21.43%)	26	215145:215160	232945:232960
WP_085503849.1|201193_202099_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_085503850.1|202151_202379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503851.1|202404_203400_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.8	1.1e-54
WP_085503852.1|203475_203676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503853.1|203672_204641_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.9	7.4e-59
WP_085503854.1|204762_204984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503855.1|205770_208302_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.6	1.1e-32
WP_085503856.1|208306_209326_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_157130351.1|209389_212209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504275.1|212211_212949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071810515.1|213799_214075_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_085503858.1|214142_215954_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
215145:215160	attL	ATGCGCGAGCGCGGCG	NA	NA	NA	NA
WP_085962187.1|216178_217412_+|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
WP_157130352.1|217510_217756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130353.1|218329_218932_+	hypothetical protein	NA	A0A1V0SKX7	Klosneuvirus	33.9	7.0e-15
WP_048984163.1|219612_220020_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	2.1e-15
WP_049006466.1|220016_220364_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	4.3e-41
WP_048992636.1|220393_221956_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.3	1.7e-150
WP_080003473.1|221963_222593_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
WP_071810706.1|224064_224493_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_009941993.1|224443_224650_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_004521809.1|224670_225384_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.3	1.5e-32
WP_011204999.1|225392_225899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531127.1|225870_226344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552921.1|226336_226846_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_004534827.1|226842_227265_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	4.9e-15
232945:232960	attR	ATGCGCGAGCGCGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	1115436	1119917	4195298		Burkholderia_virus(57.14%)	9	NA	NA
WP_004527234.1|1115436_1115670_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004531416.1|1115705_1115933_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004557051.1|1116186_1116582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028200808.1|1116862_1117285_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	9.2e-14
WP_028200809.1|1117281_1117788_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.0e-19
WP_071810609.1|1118129_1118732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076804729.1|1119152_1119464_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_076833215.1|1119484_1119670_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_004196630.1|1119653_1119917_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
>prophage 6
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	1341279	1352551	4195298	transposase	Burkholderia_virus(44.44%)	12	NA	NA
WP_085503997.1|1341279_1341705_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_085503998.1|1341701_1342211_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_085503999.1|1342203_1342677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504000.1|1342633_1343152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504295.1|1343583_1343892_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	62.1	5.0e-25
WP_085504001.1|1343927_1344716_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	98.9	1.0e-154
WP_085504002.1|1344859_1345405_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	88.4	1.6e-74
WP_085504003.1|1345404_1345902_-	lysozyme	NA	A4JX20	Burkholderia_virus	80.0	2.2e-67
WP_004533694.1|1345894_1346089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504004.1|1346902_1347142_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	58.1	1.7e-17
WP_004525642.1|1347774_1348995_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.8	2.7e-239
WP_101633367.1|1349878_1352551_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
>prophage 7
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	1673123	1681937	4195298		Tanapox_virus(16.67%)	8	NA	NA
WP_004535490.1|1673123_1673966_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.6	1.4e-16
WP_004522362.1|1674304_1675228_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_151273282.1|1675355_1676678_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004550116.1|1676904_1677807_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_004189725.1|1678141_1678459_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004537712.1|1678530_1679523_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009921652.1|1679581_1680505_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_085504045.1|1680536_1681937_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
>prophage 8
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	2018785	2028043	4195298		unidentified_phage(16.67%)	7	NA	NA
WP_028201128.1|2018785_2020333_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|2020369_2020897_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|2020893_2021577_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|2021641_2022457_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_028201129.1|2022641_2024660_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.2	7.0e-51
WP_004522147.1|2024693_2025824_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_004533561.1|2026090_2028043_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 9
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	2310124	2366847	4195298	integrase,tRNA,protease,plate	Pseudomonas_phage(28.57%)	51	2314345:2314362	2368854:2368871
WP_004521984.1|2310124_2311423_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|2311489_2312572_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|2312615_2313473_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|2313552_2313861_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|2313875_2314472_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
2314345:2314362	attL	CCGCGTTCTACGCGATGC	NA	NA	NA	NA
WP_004521980.1|2314755_2315544_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|2316005_2317607_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|2318039_2318243_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_009980969.1|2318429_2319692_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|2320400_2321006_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|2320967_2321543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|2321502_2322786_-	MFS transporter	NA	NA	NA	NA	NA
WP_038725086.1|2322944_2323589_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204168.1|2323579_2323930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504084.1|2323926_2324550_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004521971.1|2324641_2325538_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|2325665_2326802_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075018965.1|2326798_2327014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004545603.1|2327158_2328277_-	acyltransferase	NA	NA	NA	NA	NA
WP_004545599.1|2328275_2328755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205258.1|2328714_2329161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009932025.1|2329687_2329783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204896.1|2329821_2331987_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_009945507.1|2332568_2332967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|2333009_2333279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|2333381_2333612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967185.1|2333845_2334202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|2334227_2335496_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004521963.1|2335510_2337772_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_011852269.1|2337768_2339217_+	TolC family protein	NA	NA	NA	NA	NA
WP_004521960.1|2339426_2340395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|2340406_2341372_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_085504085.1|2341657_2345551_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|2345547_2346537_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_085504086.1|2346541_2347474_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004521957.1|2347672_2348794_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_009967199.1|2348883_2351553_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	2.9e-89
WP_004200010.1|2351586_2352687_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011205262.1|2352650_2354477_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085504087.1|2354568_2355081_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|2355108_2355612_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|2355684_2357175_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009967200.1|2357191_2357710_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|2357746_2358418_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|2358792_2359407_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009980978.1|2359515_2360862_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|2360858_2361644_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_080003363.1|2361730_2362588_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	58.9	2.0e-84
WP_123850113.1|2362981_2363455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130397.1|2365405_2365897_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004535032.1|2366319_2366847_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
2368854:2368871	attR	GCATCGCGTAGAACGCGG	NA	NA	NA	NA
>prophage 10
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	2469921	2476368	4195298	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_004198356.1|2469921_2471112_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.9	1.5e-13
WP_094188789.1|2471966_2473087_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	6.2e-49
WP_080003473.1|2473387_2474017_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.4e-27
WP_048992636.1|2474024_2475587_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.3	1.7e-150
WP_049006466.1|2475616_2475964_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	4.3e-41
WP_048984163.1|2475960_2476368_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	2.1e-15
>prophage 11
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	2593863	2605100	4195298	integrase	Burkholderia_phage(22.22%)	11	2591068:2591085	2607669:2607686
2591068:2591085	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_011857935.1|2593863_2594565_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	4.8e-07
WP_020850756.1|2595021_2595198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525721.1|2595408_2595657_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004530408.1|2595813_2596893_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_009932249.1|2596892_2597345_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_009932250.1|2597602_2598145_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_004530410.1|2598398_2599316_-	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922658.1|2599315_2599633_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004525725.1|2600012_2600756_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	47.3	9.4e-54
WP_004202928.1|2601790_2602690_+	cytochrome c	NA	NA	NA	NA	NA
WP_004524472.1|2603012_2605100_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
2607669:2607686	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 12
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	2828748	2937012	4195298	capsid,terminase,tRNA,plate,head,tail,holin,portal,transposase,protease	Burkholderia_phage(44.07%)	108	NA	NA
WP_045597403.1|2828748_2829810_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	99.1	6.8e-199
WP_004523107.1|2829883_2830168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|2830164_2830647_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_009962344.1|2832597_2833728_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_038718170.1|2833724_2836367_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024430097.1|2836576_2839039_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_009979570.1|2839042_2840500_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	31.6	1.5e-26
WP_009962363.1|2840496_2842227_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_009962364.1|2842398_2843613_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	67.4	3.9e-142
WP_009962366.1|2843623_2844373_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	58.0	3.6e-61
WP_085504122.1|2846311_2847406_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129111995.1|2847911_2848370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009962369.1|2848366_2848936_-	SocA family protein	NA	NA	NA	NA	NA
WP_004200732.1|2849562_2849967_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004189208.1|2850004_2850874_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004525849.1|2850994_2852011_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189230.1|2852449_2853505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009962376.1|2853728_2856338_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.4	7.7e-18
WP_004190199.1|2856548_2856920_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004553745.1|2856979_2858170_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004525852.1|2858398_2858902_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_004535363.1|2858933_2859917_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525854.1|2860037_2860673_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004189409.1|2860782_2861640_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004523097.1|2862119_2863529_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004188929.1|2863525_2864116_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523096.1|2864117_2866526_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004189647.1|2866526_2867210_+	response regulator	NA	NA	NA	NA	NA
WP_071810932.1|2868237_2868588_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085504123.1|2869279_2872072_-	hypothetical protein	NA	K4NXL6	Burkholderia_phage	94.1	0.0e+00
WP_071810930.1|2872083_2872338_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	92.9	3.0e-36
WP_085504124.1|2872334_2872703_-	hypothetical protein	NA	A4JWR0	Burkholderia_virus	94.3	5.3e-58
WP_010100757.1|2872696_2872903_-	hypothetical protein	NA	K4NZT3	Burkholderia_phage	67.6	4.2e-20
WP_085504125.1|2873071_2873311_-	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	98.7	1.8e-35
WP_080495621.1|2873314_2873524_-	hypothetical protein	NA	K4NXL1	Burkholderia_phage	98.6	4.5e-30
WP_085504126.1|2873552_2873750_-	hypothetical protein	NA	K4NZY3	Burkholderia_phage	87.7	5.9e-24
WP_010100769.1|2873755_2873974_-	hypothetical protein	NA	A4JWR5	Burkholderia_virus	88.9	2.1e-30
WP_038800161.1|2874059_2874308_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	96.3	8.3e-39
WP_010100773.1|2874295_2874499_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	85.1	2.1e-24
WP_010100775.1|2874538_2874736_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	87.7	4.1e-25
WP_010100777.1|2874750_2874966_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	84.6	1.8e-21
WP_107974106.1|2875055_2875553_+	helix-turn-helix domain-containing protein	NA	E5E3U2	Burkholderia_phage	57.6	4.2e-42
WP_085504127.1|2875579_2876293_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	50.9	8.7e-65
WP_038800163.1|2876392_2876728_+	hypothetical protein	NA	R4JGF4	Burkholderia_phage	53.8	1.2e-24
WP_010100780.1|2876874_2877120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504128.1|2877197_2878298_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	94.0	1.7e-192
WP_085504129.1|2878297_2878723_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	98.6	2.8e-71
WP_085504315.1|2878740_2881635_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	62.1	1.5e-280
WP_028201171.1|2881841_2881955_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	94.6	4.6e-13
WP_028201170.1|2881963_2882308_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	95.5	7.7e-51
WP_028201169.1|2882365_2882875_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	95.9	1.0e-91
WP_071810916.1|2882890_2884063_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	96.7	1.6e-217
WP_085504130.1|2884120_2884792_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	93.2	2.6e-103
WP_080495619.1|2884808_2887181_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	87.5	0.0e+00
WP_085504131.1|2887182_2887737_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	95.1	6.3e-95
WP_085504132.1|2887729_2888635_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	6.1e-156
WP_085504133.1|2888631_2888994_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	95.8	8.1e-59
WP_085504134.1|2888990_2889671_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	92.5	6.7e-115
WP_085504316.1|2889745_2890594_+	site-specific DNA-methyltransferase	NA	A4JWY5	Burkholderia_virus	90.0	1.6e-145
WP_085504135.1|2891098_2891569_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	2.9e-69
WP_085504136.1|2891565_2891982_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	89.9	1.7e-65
WP_085504137.1|2892086_2892527_-	protein LYSB	NA	K4NXJ2	Burkholderia_phage	96.6	8.0e-69
WP_085504138.1|2892523_2893336_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	96.7	6.7e-146
WP_085504139.1|2893332_2893605_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	98.9	2.0e-41
WP_015985026.1|2893606_2893951_-	gp45, putative bacteriophage membrane protein	NA	A4JWU2	Burkholderia_virus	100.0	2.9e-50
WP_010112635.1|2893965_2894172_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_085504140.1|2894168_2894420_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	90.2	1.4e-33
WP_085504141.1|2894419_2894899_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	96.2	7.9e-78
WP_085504142.1|2894998_2895688_-|terminase	terminase endonuclease subunit	terminase	A4JWP8	Burkholderia_virus	96.9	2.6e-114
WP_085504143.1|2895684_2896698_-|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	97.3	2.0e-184
WP_085504144.1|2896731_2897541_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	91.8	3.7e-136
WP_085504145.1|2897684_2899454_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	97.3	0.0e+00
WP_085504146.1|2899450_2900557_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	98.0	1.1e-202
WP_085504147.1|2900591_2901077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010100815.1|2901788_2902460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010100816.1|2902440_2903355_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	41.9	4.4e-37
WP_009918037.1|2904093_2904384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190026.1|2904380_2905115_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_038729300.1|2905208_2905841_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.2	8.1e-06
WP_004189793.1|2905860_2906313_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_076847668.1|2906409_2906742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523095.1|2906734_2907520_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004545693.1|2907516_2908293_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_085504148.1|2908934_2910083_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004525858.1|2910094_2912506_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004523092.1|2912689_2913202_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189331.1|2913198_2914272_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|2914391_2915435_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189769.1|2915800_2916100_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_009962426.1|2916212_2917703_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004523090.1|2917705_2919178_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189747.1|2919304_2920144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190029.1|2920176_2920947_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_011205251.1|2921103_2922567_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	4.0e-80
WP_004534096.1|2922834_2923899_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004531039.1|2924110_2925055_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038800902.1|2925428_2926385_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004523086.1|2926470_2927784_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004545692.1|2927795_2928410_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004545672.1|2928406_2929552_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004525865.1|2929900_2930593_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198307.1|2930559_2931363_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004200214.1|2931359_2932259_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198312.1|2932583_2932835_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_085503378.1|2932852_2934133_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198315.1|2934153_2934696_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198316.1|2935122_2936466_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004203414.1|2936475_2937012_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 13
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	3708211	3719158	4195298	protease	Streptococcus_phage(16.67%)	10	NA	NA
WP_004197486.1|3708211_3710326_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_004530837.1|3710623_3711133_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_071810810.1|3711324_3711543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085503329.1|3711804_3712383_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|3712650_3713910_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_009929279.1|3713882_3714065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504213.1|3714077_3715682_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|3715811_3716015_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|3716546_3716861_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|3716857_3719158_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 14
NZ_CP018380	Burkholderia pseudomallei strain 2008724734 chromosome 1, complete sequence	4195298	3882534	3927129	4195298	capsid,terminase,plate,head,tail,portal,integrase,protease	uncultured_Caudovirales_phage(35.48%)	61	3885297:3885315	3919239:3919257
WP_004522511.1|3882534_3883074_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009969854.1|3883171_3884308_-	murein-DD-endopeptidase	NA	NA	NA	NA	NA
WP_004200110.1|3884556_3884781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009969855.1|3884797_3885139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526357.1|3885237_3885714_+	hypothetical protein	NA	NA	NA	NA	NA
3885297:3885315	attL	CGGCATCGCGGGCGCGGCG	NA	NA	NA	NA
WP_157130414.1|3887506_3887908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504237.1|3887896_3888523_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	44.8	8.8e-37
WP_009964475.1|3888977_3890078_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_009964477.1|3890111_3890342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720986.1|3890338_3891118_-	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	6.5e-21
WP_025405240.1|3891126_3891456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|3891569_3892886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964485.1|3892885_3893335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|3893331_3893937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|3893933_3894269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|3894320_3894539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123850154.1|3894667_3895123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|3895070_3895556_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_076853252.1|3895704_3895932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|3896020_3896548_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_025405238.1|3896561_3896894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964493.1|3896901_3897357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975963.1|3897358_3897817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071810769.1|3897880_3898060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964497.1|3898190_3898661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504238.1|3898782_3901275_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
WP_025405237.1|3901492_3902266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405236.1|3902485_3902674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964504.1|3902767_3903337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964506.1|3903299_3905288_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	6.6e-179
WP_009964508.1|3905298_3905505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720977.1|3905501_3906995_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.8	4.1e-133
WP_071810768.1|3906991_3908068_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.1	3.1e-50
WP_038720978.1|3908094_3908439_+|head	head decoration protein	head	NA	NA	NA	NA
WP_009964517.1|3908504_3909500_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.8e-109
WP_009964519.1|3909503_3909794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964520.1|3909795_3910326_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.0	4.1e-11
WP_004533675.1|3910315_3910849_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_038720980.1|3910851_3911532_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.1	9.0e-19
WP_009964525.1|3911596_3911803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547840.1|3911799_3912144_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_009964528.1|3912140_3913034_+|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	40.1	8.4e-49
WP_004539949.1|3913026_3913602_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004539647.1|3913589_3915053_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.8	8.0e-214
WP_009964532.1|3915068_3915521_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	4.8e-45
WP_009964534.1|3915587_3916757_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	3.7e-161
WP_085504239.1|3916767_3917271_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	47.9	4.7e-41
WP_085504240.1|3917340_3917643_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_085504241.1|3917730_3920145_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	32.9	3.3e-63
3919239:3919257	attR	CGGCATCGCGGGCGCGGCG	NA	NA	NA	NA
WP_009964541.1|3920153_3921035_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.1	2.0e-31
WP_009964543.1|3921009_3921216_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	2.4e-15
WP_009964545.1|3921225_3922278_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	5.4e-79
WP_009964547.1|3922353_3922548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720983.1|3922540_3923038_+	lysozyme	NA	A4JX20	Burkholderia_virus	80.0	2.0e-68
WP_009964551.1|3923037_3923583_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.8	7.3e-80
WP_009964553.1|3923725_3924514_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	3.6e-152
WP_076853254.1|3924549_3924888_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	58.0	1.1e-25
WP_099975964.1|3925253_3925688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720984.1|3925731_3926205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504242.1|3926197_3926707_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	2.3e-19
WP_009964559.1|3926706_3927129_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	46.0	1.1e-14
>prophage 1
NZ_CP018381	Burkholderia pseudomallei strain 2008724734 chromosome 2, complete sequence	3287088	998065	1065566	3287088	plate,holin	Aeromonas_phage(25.0%)	52	NA	NA
WP_004530063.1|998065_999016_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|999283_1000228_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530060.1|1000699_1002403_+	thermolysin metallopeptidase	NA	NA	NA	NA	NA
WP_085504434.1|1002520_1003747_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|1003801_1004944_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|1005052_1005175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004535106.1|1005171_1006170_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004186939.1|1006205_1007759_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_076809203.1|1007894_1008794_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|1008937_1009813_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004530057.1|1009899_1011555_-	APC family permease	NA	NA	NA	NA	NA
WP_004186918.1|1011735_1012599_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530056.1|1012708_1013854_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523139.1|1013874_1015143_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|1015167_1015953_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523138.1|1015949_1017122_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186901.1|1017126_1019052_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004523137.1|1019054_1021118_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|1021178_1021712_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186989.1|1021862_1022834_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004530801.1|1022906_1024181_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_009923708.1|1024192_1024456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|1024614_1025640_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|1025817_1027017_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004523134.1|1027442_1028459_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023358579.1|1028647_1030213_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_009967873.1|1030345_1032010_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
WP_004545880.1|1032539_1033793_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004528656.1|1034309_1035893_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_038724161.1|1035889_1036072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524284.1|1036197_1037193_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085504436.1|1037445_1039032_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038796383.1|1039028_1040348_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_076893658.1|1040355_1040484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|1040558_1041458_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009923697.1|1041733_1041907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|1042004_1042376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530792.1|1042600_1043023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|1043045_1043405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504437.1|1043463_1046973_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004530043.1|1046969_1048685_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004525552.1|1048710_1050072_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004202226.1|1050068_1050662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190606.1|1050667_1051057_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|1051099_1051816_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|1051818_1052889_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004547074.1|1052888_1055105_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|1055108_1057397_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_085504438.1|1057562_1059854_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_085504439.1|1059844_1062715_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004190851.1|1062717_1063707_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|1063703_1065566_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP018381	Burkholderia pseudomallei strain 2008724734 chromosome 2, complete sequence	3287088	1223309	1310286	3287088	tail,portal,integrase,terminase,capsid,transposase,holin,head	Burkholderia_virus(89.06%)	103	1245556:1245585	1305665:1305694
WP_119011596.1|1223309_1223549_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_119011631.1|1223470_1223881_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_009967729.1|1224441_1225374_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_085504453.1|1225530_1226901_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_085504454.1|1226951_1228412_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_124465852.1|1229378_1229747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085504456.1|1230008_1232843_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.7	1.1e-09
WP_085504457.1|1232846_1234130_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_085504458.1|1234173_1235505_+	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_085504459.1|1235512_1235800_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_157130431.1|1236018_1237179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130432.1|1237181_1238117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146978766.1|1238116_1239127_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_085504461.1|1239271_1239967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157130433.1|1240078_1240948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504463.1|1241138_1242176_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_157130434.1|1242201_1242444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504464.1|1242570_1243104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504465.1|1243158_1243992_+	CoiA-like domain protein	NA	A0A2H4J456	uncultured_Caudovirales_phage	47.8	4.9e-35
WP_157130435.1|1244147_1244795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504466.1|1244880_1245291_-	hypothetical protein	NA	NA	NA	NA	NA
1245556:1245585	attL	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_157130436.1|1245803_1246187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130437.1|1246176_1246395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504468.1|1246691_1247381_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	89.5	1.6e-119
WP_085504469.1|1247466_1248108_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	90.1	4.0e-109
WP_085504470.1|1248242_1249334_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	98.1	2.0e-209
WP_085504471.1|1249361_1250096_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	98.4	3.7e-135
WP_085504472.1|1250092_1250653_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	99.5	2.8e-103
WP_085504759.1|1250834_1251569_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	99.1	4.7e-130
WP_085504473.1|1251821_1252610_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	98.1	3.2e-153
WP_085504474.1|1252753_1253299_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	86.7	4.6e-74
WP_085504475.1|1253298_1253790_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	96.3	4.3e-87
WP_085504476.1|1253782_1253995_-|holin	holin	holin	Q8W6S7	Burkholderia_virus	98.6	8.6e-29
WP_085504477.1|1254037_1254772_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	96.3	2.0e-141
WP_085504760.1|1254771_1255038_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	97.7	9.4e-49
WP_085504478.1|1255082_1258388_-	host specificity protein J	NA	Q8W6T0	Burkholderia_virus	93.0	0.0e+00
WP_085504479.1|1258384_1258969_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	94.3	8.6e-95
WP_085504480.1|1258965_1259718_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	93.6	2.3e-140
WP_085504481.1|1259767_1260451_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	95.2	4.5e-127
WP_085504482.1|1260447_1261836_-|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	89.4	1.4e-244
WP_085504483.1|1261844_1262183_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	95.5	1.7e-58
WP_039339132.1|1262179_1266244_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	90.0	0.0e+00
WP_009901135.1|1266257_1266536_-	DUF4035 domain-containing protein	NA	Q8W6T7	Burkholderia_virus	94.7	2.4e-39
WP_085504484.1|1266535_1267000_-|tail	phage tail protein	tail	Q6JIM0	Burkholderia_virus	92.2	1.1e-76
WP_085504485.1|1267026_1267482_-|tail	phage tail protein	tail	Q8W6T9	Burkholderia_virus	84.7	2.3e-63
WP_085504486.1|1267545_1267893_-	hypothetical protein	NA	A4JX06	Burkholderia_virus	87.0	4.1e-52
WP_085504487.1|1267889_1268312_-	HK97 gp10 family phage protein	NA	Q8W6U1	Burkholderia_virus	88.6	1.5e-61
WP_085504488.1|1268304_1268631_-|head	phage head closure protein	head	Q8W6U2	Burkholderia_virus	94.4	2.7e-53
WP_085504489.1|1268630_1269197_-	hypothetical protein	NA	A4JX03	Burkholderia_virus	91.0	7.8e-93
WP_085504490.1|1269203_1269389_-	hypothetical protein	NA	Q8W6U4	Burkholderia_virus	83.6	8.9e-22
WP_085504491.1|1269448_1270756_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	85.5	6.5e-199
WP_085504492.1|1270858_1271827_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	93.5	2.6e-160
WP_085504493.1|1271823_1273083_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	94.5	7.5e-229
WP_085504494.1|1273087_1273273_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	73.8	5.2e-14
WP_085504495.1|1273269_1274982_-|terminase	terminase large subunit	terminase	Q8W6U9	Burkholderia_virus	97.0	0.0e+00
WP_085504496.1|1274991_1275477_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	95.0	2.2e-83
WP_085504497.1|1275625_1275982_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	94.9	7.7e-62
WP_004549735.1|1276042_1276300_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_019254588.1|1276296_1276683_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	98.4	3.0e-64
WP_009901158.1|1276949_1277474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504498.1|1277667_1279242_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.6	4.8e-124
WP_085504499.1|1279305_1279653_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_143751642.1|1279640_1280036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038708291.1|1280116_1280923_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_085504500.1|1281350_1282922_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_019254590.1|1283233_1283881_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	92.6	6.0e-105
WP_085504501.1|1283889_1284150_-	hypothetical protein	NA	A4JX60	Burkholderia_virus	94.9	5.6e-38
WP_085504502.1|1284466_1284883_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	70.0	2.7e-50
WP_019254593.1|1284879_1285254_-	hypothetical protein	NA	Q6JIF8	Burkholderia_virus	95.2	4.0e-61
WP_085504503.1|1285250_1285802_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	96.2	6.9e-94
WP_085504504.1|1285798_1286791_-	helix-turn-helix domain-containing protein	NA	A4JX55	Burkholderia_virus	98.2	4.9e-175
WP_010110014.1|1286944_1287205_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	87.2	1.3e-34
WP_085504505.1|1287201_1288023_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.1	1.0e-141
WP_085504506.1|1288052_1289144_-	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	67.8	2.0e-153
WP_085504507.1|1289140_1290310_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.9	1.6e-116
WP_010110021.1|1290320_1290761_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	89.0	1.0e-68
WP_085504508.1|1290944_1291181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504762.1|1291432_1291672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504509.1|1291678_1291921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504510.1|1292002_1292392_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157130438.1|1292646_1292919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504512.1|1292952_1293858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130439.1|1294327_1294786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504763.1|1295666_1295960_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	86.2	1.2e-36
WP_041190251.1|1295970_1296096_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	82.9	2.4e-07
WP_157130440.1|1296465_1296744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504513.1|1297034_1297184_+	hypothetical protein	NA	Q8W6Q6	Burkholderia_virus	91.8	1.8e-17
WP_085504514.1|1297180_1297993_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	95.9	2.9e-141
WP_085504515.1|1298253_1298961_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	90.6	4.7e-119
WP_085504516.1|1298975_1300421_+	hypothetical protein	NA	Q6V7T8	Burkholderia_virus	43.3	2.4e-37
WP_157130441.1|1300417_1300576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130442.1|1300568_1300808_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	77.0	5.4e-27
WP_085504518.1|1300804_1301065_+	hypothetical protein	NA	A9YWU5	Burkholderia_phage	81.2	3.8e-34
WP_157130443.1|1301914_1302172_-	DUF1488 family protein	NA	NA	NA	NA	NA
WP_085504520.1|1302207_1302870_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	41.4	1.3e-30
WP_085504521.1|1302872_1303202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504522.1|1303250_1303493_-	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	84.6	1.5e-29
WP_085504523.1|1303502_1303712_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	88.4	3.5e-30
WP_085504524.1|1303793_1304030_-	hypothetical protein	NA	Q6JIJ6	Burkholderia_virus	86.5	8.4e-33
WP_085504525.1|1304352_1305552_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.6	8.2e-108
WP_004529901.1|1305816_1307832_-	cation acetate symporter	NA	NA	NA	NA	NA
1305665:1305694	attR	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_004545569.1|1307825_1308206_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_004188376.1|1308303_1310286_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
>prophage 3
NZ_CP018381	Burkholderia pseudomallei strain 2008724734 chromosome 2, complete sequence	3287088	1687275	1750485	3287088	plate,transposase	Ralstonia_phage(28.57%)	47	NA	NA
WP_004523686.1|1687275_1687794_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004523687.1|1687795_1689676_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523688.1|1689672_1690722_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009967433.1|1690740_1691811_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004536657.1|1691865_1692894_+	fimbrial protein	NA	NA	NA	NA	NA
WP_038718765.1|1692926_1694285_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.6	9.0e-111
WP_028200913.1|1694177_1697630_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004523693.1|1697642_1697912_-	PAAR motif protein	NA	NA	NA	NA	NA
WP_080361227.1|1697986_1700668_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.3e-35
WP_004529647.1|1700732_1701302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009981084.1|1701491_1705400_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_085504565.1|1705414_1706713_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004523698.1|1706709_1708059_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_095413485.1|1708064_1708607_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004529642.1|1708734_1709217_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004523699.1|1709416_1710916_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004523700.1|1710949_1711489_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523701.1|1711866_1713543_-	OmpA family protein	NA	NA	NA	NA	NA
WP_076847500.1|1713545_1714202_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025986099.1|1714266_1714839_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076896864.1|1714831_1717465_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004533804.1|1717688_1718426_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004533867.1|1718490_1719036_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_085504566.1|1719621_1720215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523708.1|1720187_1720403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504567.1|1720438_1721926_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_085504568.1|1721992_1724014_-	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	4.7e-07
WP_157129648.1|1724862_1725222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028201534.1|1725566_1727024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533827.1|1727716_1727920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523716.1|1728174_1729770_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_085504771.1|1729850_1730474_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_009967412.1|1731059_1731752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523720.1|1732223_1732550_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523721.1|1732569_1732989_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_045597630.1|1733403_1733667_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_076854649.1|1733676_1735032_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_085962187.1|1735096_1736331_-|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
WP_085504569.1|1736688_1738929_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.1	7.5e-22
WP_004528499.1|1742047_1742353_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004552621.1|1742940_1743972_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004533801.1|1743968_1744823_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004533742.1|1744806_1745727_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_085504772.1|1746210_1746663_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009939053.1|1746682_1747702_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_080002191.1|1747698_1747953_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023358215.1|1749315_1750485_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	30.1	1.9e-32
>prophage 4
NZ_CP018381	Burkholderia pseudomallei strain 2008724734 chromosome 2, complete sequence	3287088	2148778	2214353	3287088	plate,transposase	Acanthocystis_turfacea_Chlorella_virus(14.29%)	41	NA	NA
WP_004190585.1|2148778_2150182_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|2150197_2151514_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_085504612.1|2151516_2155146_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_085504781.1|2155151_2156066_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|2156050_2156278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085504613.1|2156276_2158913_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.1e-09
WP_009982092.1|2158965_2160045_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|2160107_2160686_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_085504614.1|2160678_2162187_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|2162246_2162738_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009935240.1|2162756_2163305_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004524812.1|2163309_2165181_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_122877902.1|2165177_2166623_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_085504615.1|2166635_2169302_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_085504616.1|2169298_2171503_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	4.8e-45
WP_028200695.1|2173416_2174685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504782.1|2174698_2179330_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004533385.1|2179921_2180185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811406.1|2180185_2180383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085504618.1|2180534_2189903_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_129112169.1|2189903_2190209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811408.1|2190176_2190542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025986261.1|2190790_2192545_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004539275.1|2192758_2193487_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_011205721.1|2193581_2194487_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004529289.1|2194559_2194979_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_085504619.1|2194992_2196846_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_004529287.1|2196842_2197868_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004544778.1|2197908_2198949_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_004539278.1|2198945_2199881_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009927010.1|2199893_2200178_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_004524878.1|2200203_2201115_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_025986259.1|2202223_2203885_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.2	3.5e-32
WP_004533395.1|2204247_2205132_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_004537121.1|2205166_2207173_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_085504620.1|2207169_2208012_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004529278.1|2208018_2209170_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004544675.1|2209182_2210799_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_004529276.1|2210800_2211661_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	7.1e-13
WP_009969373.1|2211987_2213160_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_085504122.1|2213258_2214353_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP018381	Burkholderia pseudomallei strain 2008724734 chromosome 2, complete sequence	3287088	2526422	2562909	3287088	tRNA,portal,integrase,transposase,protease	Burkholderia_phage(20.0%)	36	2551742:2551758	2574158:2574174
WP_004544833.1|2526422_2527109_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	83.0	1.4e-96
WP_009969175.1|2527105_2527393_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	93.3	6.4e-43
WP_004529037.1|2527638_2527776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004544614.1|2528025_2528214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540326.1|2528330_2529557_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_009940975.1|2529563_2529737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540321.1|2529735_2529999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940974.1|2529923_2530100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552023.1|2530434_2530926_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_009969172.1|2531585_2531870_-	membrane protein	NA	NA	NA	NA	NA
WP_004190924.1|2532021_2532291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|2532287_2533037_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_085504657.1|2533038_2535810_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.2e-71
WP_004190401.1|2536128_2537511_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009926480.1|2537774_2539568_-	membrane protein	NA	NA	NA	NA	NA
WP_009934941.1|2539741_2539834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009950014.1|2539906_2540128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|2540287_2541163_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|2541221_2542091_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_082248404.1|2542214_2543678_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004190814.1|2543829_2544936_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190549.1|2545205_2545499_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004525142.1|2545495_2546380_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004540286.1|2546463_2548368_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004195713.1|2548518_2549328_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_085504787.1|2549707_2550748_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.3e-93
WP_085504658.1|2550887_2552111_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
2551742:2551758	attL	GCTCGCCGAATGGGTGC	NA	NA	NA	NA
WP_004190342.1|2552190_2552403_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|2552569_2553016_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004529022.1|2553110_2554985_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	6.4e-67
WP_004549232.1|2555031_2555370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|2555428_2557471_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_085504659.1|2557883_2559182_-	TniQ family protein	NA	NA	NA	NA	NA
WP_085504660.1|2559178_2560216_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_085504661.1|2560224_2561634_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_085962187.1|2561674_2562909_-|transposase	IS3-like element ISButh1 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.1e-102
2574158:2574174	attR	GCTCGCCGAATGGGTGC	NA	NA	NA	NA
