The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015349	Sporosarcina sp. P37 chromosome, complete genome	3271521	28941	78672	3271521	terminase,plate,integrase,portal,capsid,holin,tail	Bacillus_phage(18.42%)	77	25849:25863	53887:53901
25849:25863	attL	CGGGAAGCGTGTGCT	NA	NA	NA	NA
WP_085429876.1|28941_30096_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.5	7.3e-37
WP_085429877.1|30171_30825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085429878.1|30846_31788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085429879.1|31852_32500_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2JY13	Aeribacillus_phage	65.8	1.1e-66
WP_085429880.1|32444_33140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085429881.1|33239_33623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431592.1|33639_34287_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	65.7	2.5e-18
WP_085429882.1|34456_34702_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085429883.1|34714_34924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429884.1|34924_35158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085429885.1|35230_35428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429886.1|35393_35636_-	hypothetical protein	NA	Q4ZC34	Staphylococcus_virus	63.2	1.0e-25
WP_085429887.1|35703_35994_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085429888.1|35965_36268_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085429889.1|36476_37244_+	phage antirepressor Ant	NA	A0A0C5ABV5	Paenibacillus_phage	54.0	5.3e-68
WP_157118598.1|37384_37678_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085429891.1|37687_37966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429892.1|38273_38453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429893.1|38702_39002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429894.1|39001_40999_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	43.7	4.1e-144
WP_085429895.1|40958_41573_+	hypothetical protein	NA	Q2NPD3	Xanthomonas_virus	42.7	1.1e-15
WP_085429896.1|41589_42330_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	58.1	3.4e-72
WP_085429897.1|42329_43031_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	68.2	1.1e-93
WP_085429898.1|43049_44030_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	65.2	2.5e-46
WP_085429899.1|43872_44826_+	hypothetical protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	35.2	1.4e-41
WP_085429900.1|44837_45101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429901.1|45093_45246_+	pilus assembly protein PilO	NA	NA	NA	NA	NA
WP_085429902.1|45242_45719_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	54.0	8.4e-40
WP_085429903.1|45748_45994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429904.1|45977_46703_+	hypothetical protein	NA	A0A1B1P7C2	Bacillus_phage	45.5	7.8e-53
WP_085429906.1|46881_47214_+	hypothetical protein	NA	A0A142F1R8	Bacillus_phage	59.0	8.0e-29
WP_157118599.1|47247_47529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429907.1|47581_48097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143565446.1|48519_48759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157118600.1|48794_48959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429910.1|49178_49463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429911.1|49459_49741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429912.1|49727_49961_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.6	1.7e-06
WP_085429913.1|50029_50227_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	55.8	1.7e-07
WP_085429914.1|50223_50808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429915.1|50951_51158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429916.1|51172_51610_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	44.3	2.1e-29
WP_085429917.1|51812_52076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429918.1|52095_52326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429919.1|52385_53177_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	49.8	1.8e-50
WP_085429920.1|53176_54487_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	62.9	1.1e-158
53887:53901	attR	CGGGAAGCGTGTGCT	NA	NA	NA	NA
WP_085429921.1|54490_56020_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	49.5	2.1e-132
WP_085429922.1|56016_56931_+	hypothetical protein	NA	A0A249XXB6	Clostridium_phage	35.0	6.2e-39
WP_157118601.1|56944_57118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429923.1|57134_58274_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	54.6	2.0e-87
WP_085431594.1|58300_59248_+|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	34.0	1.1e-41
WP_085429924.1|59263_59458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429925.1|59462_59840_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	34.4	1.7e-11
WP_085429926.1|59836_60190_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_085429927.1|60186_60687_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.0	2.7e-44
WP_085429928.1|60699_61140_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_085429929.1|61136_61391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429930.1|61387_62782_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	38.3	5.3e-74
WP_085431596.1|62835_63276_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	38.5	3.6e-21
WP_085431598.1|63389_63839_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_085429931.1|64041_67965_+	hypothetical protein	NA	A0A1L2JY60	Aeribacillus_phage	59.5	3.4e-17
WP_085429932.1|67957_68629_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	36.4	1.5e-18
WP_085429933.1|68625_69603_+|portal	phage portal protein	portal	A0A0A7RTZ4	Clostridium_phage	31.1	3.0e-23
WP_085429934.1|69602_69986_+	DUF2577 domain-containing protein	NA	A0A2H4IZR8	uncultured_Caudovirales_phage	39.1	2.8e-09
WP_085429935.1|70000_70423_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.6	1.7e-12
WP_085429936.1|70422_71469_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	39.4	1.2e-54
WP_085429937.1|71461_72217_+	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	29.2	3.6e-08
WP_085429938.1|72216_72543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429939.1|72532_73567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429940.1|73566_73779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429941.1|73795_74401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429942.1|74403_76224_+	hypothetical protein	NA	G3MAG6	Bacillus_virus	38.8	1.3e-48
WP_085429943.1|76220_76466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429945.1|76831_77050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085429946.1|77123_77660_+|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	34.1	6.0e-10
WP_085429947.1|77660_77945_+	hypothetical protein	NA	A0A142F1N6	Bacillus_phage	50.0	5.8e-20
WP_085429948.1|77946_78672_+	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	64.7	1.1e-51
>prophage 2
NZ_CP015349	Sporosarcina sp. P37 chromosome, complete genome	3271521	306531	383266	3271521	tRNA,terminase,protease,holin,capsid,portal,tail	Bacillus_phage(37.21%)	96	NA	NA
WP_085430050.1|306531_307299_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_085430051.1|307693_309463_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	29.0	7.0e-23
WP_085430052.1|309584_310847_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	22.0	6.6e-15
WP_085430053.1|311262_311709_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_081242059.1|311727_313926_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.8	1.3e-10
WP_081242060.1|314073_314586_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.3	5.0e-30
WP_085430054.1|314576_316922_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1G5SBU4	Enterococcus_phage	21.4	4.3e-12
WP_085430055.1|317346_317652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085430056.1|317747_317969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085430057.1|318316_318676_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_085430058.1|318748_321016_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.0	2.6e-30
WP_081242068.1|321146_321458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242069.1|321587_323105_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_085430059.1|323091_323736_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_081244712.1|323845_324106_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.7	9.7e-06
WP_085430060.1|324156_325296_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	4.9e-86
WP_085430061.1|325296_326349_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_081242073.1|326367_327366_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.6	2.0e-06
WP_081242074.1|327385_327991_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_081242075.1|328111_328678_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143565459.1|328830_329457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085430063.1|329501_330224_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_081242078.1|330236_331106_-	phosphotransferase	NA	NA	NA	NA	NA
WP_085430065.1|332570_333455_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_081242081.1|333490_333946_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_085430066.1|333978_335268_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_085430067.1|335271_335805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143565458.1|335925_336108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430068.1|336117_336408_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_085430069.1|336420_336747_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_081242086.1|336753_337062_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_085430070.1|337220_337838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081242088.1|337834_338377_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_081242089.1|338477_339278_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_081242090.1|339279_339951_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_085430071.1|339970_340492_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_081242092.1|340488_341382_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_081242093.1|341403_342417_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_085430072.1|342585_342912_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_085430074.1|344050_344731_-	hypothetical protein	NA	D6QWL7	uncultured_phage	69.9	2.6e-66
WP_099662735.1|344732_345194_-|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	61.5	6.9e-31
WP_085430076.1|345244_345463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430077.1|345564_346689_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	22.6	1.3e-06
WP_085430078.1|346694_347096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430079.1|347101_347347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430080.1|347347_348526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430081.1|348526_350080_-	hypothetical protein	NA	A0A218KCH2	Bacillus_phage	33.1	1.5e-08
WP_085430082.1|350094_350466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430083.1|350466_350856_-	hypothetical protein	NA	A0A1B1P7F2	Bacillus_phage	34.6	2.0e-07
WP_085430084.1|350855_355817_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	46.4	3.2e-81
WP_085430085.1|356002_356479_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	42.7	5.9e-25
WP_085430086.1|356551_357136_-|tail	phage tail protein	tail	R4IBJ8	Listeria_phage	53.8	2.0e-51
WP_099662738.1|357136_357466_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	47.4	5.5e-22
WP_085430087.1|357542_357935_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	42.5	9.8e-18
WP_085430088.1|357931_358267_-	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	48.2	3.9e-23
WP_085430089.1|358238_358547_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	59.1	9.0e-19
WP_085430090.1|358543_358732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430091.1|358747_359926_-|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	44.9	2.4e-83
WP_085430092.1|359967_360681_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	44.5	7.4e-48
WP_085431628.1|360677_361778_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	57.1	7.8e-121
WP_085430093.1|361864_363505_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	48.1	1.0e-148
WP_085430094.1|363491_363806_-	hypothetical protein	NA	A0A1S7FYW6	Listeria_phage	31.4	7.8e-10
WP_157118604.1|363939_364089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431630.1|364261_364525_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	66.3	2.4e-28
WP_157118605.1|364660_364828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430095.1|364824_365085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430096.1|365292_366111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430097.1|366216_366885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085430098.1|367075_367471_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	62.6	1.3e-38
WP_085431631.1|367487_368027_-	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	48.6	2.3e-41
WP_085430099.1|368137_368566_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	50.0	1.1e-35
WP_085430100.1|368504_368780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430101.1|369090_371412_-	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	77.9	0.0e+00
WP_085430102.1|371754_371943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430103.1|371939_372206_-	DUF3310 domain-containing protein	NA	A0A1W6JSF8	Bacillus_phage	63.4	1.1e-20
WP_085430104.1|372205_372988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430105.1|373141_373423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430106.1|373419_373944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430107.1|374103_374562_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	52.6	1.2e-38
WP_085431633.1|374564_375281_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	74.8	1.9e-96
WP_085430108.1|375302_375635_-	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	50.9	1.4e-17
WP_085430109.1|375650_376130_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	44.6	1.1e-31
WP_085430110.1|376113_376371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157118606.1|376446_376596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431635.1|376611_376845_-	hypothetical protein	NA	Q77PS1	Streptococcus_phage	54.0	4.3e-05
WP_085430111.1|376952_377162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430112.1|377162_377975_-	site-specific DNA-methyltransferase	NA	Q9XJE8	Lactococcus_phage	65.4	4.4e-97
WP_085430113.1|377974_378181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430114.1|378177_378402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430115.1|378413_379193_-	hypothetical protein	NA	A0A0E3T7K0	Bacillus_phage	52.6	5.3e-15
WP_085430116.1|379432_380167_-	hypothetical protein	NA	A0A0A8WIJ5	Clostridium_phage	32.7	1.1e-30
WP_085430117.1|380227_380440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085430118.1|380440_380674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085430119.1|380752_380980_-	helix-turn-helix transcriptional regulator	NA	Q9G0C3	Lactococcus_phage	41.0	7.1e-05
WP_099662734.1|381127_381760_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	48.1	4.2e-55
WP_085430121.1|381835_383266_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	48.7	1.7e-128
>prophage 3
NZ_CP015349	Sporosarcina sp. P37 chromosome, complete genome	3271521	2683934	2743747	3271521	tRNA,integrase,transposase	Streptococcus_phage(23.08%)	53	2716358:2716379	2747808:2747829
WP_099662801.1|2683934_2685100_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	6.2e-36
WP_081244173.1|2685223_2685406_-	DUF2929 family protein	NA	NA	NA	NA	NA
WP_085431228.1|2685584_2686517_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_081244175.1|2686561_2687797_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_081244176.1|2688232_2689219_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009765721.1|2689939_2690338_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_085431230.1|2690576_2691227_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_157118652.1|2692210_2692375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157118653.1|2692846_2693011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431231.1|2694051_2695218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431232.1|2695269_2697087_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_081244180.1|2697352_2698186_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
WP_081244181.1|2698182_2698575_-	globin	NA	NA	NA	NA	NA
WP_085431233.1|2698864_2699503_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	66.4	3.4e-36
WP_157118654.1|2699626_2700067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244871.1|2700109_2700940_+	NAD kinase	NA	NA	NA	NA	NA
WP_099662789.1|2700926_2701910_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_085431236.1|2701955_2703332_+	magnesium transporter	NA	NA	NA	NA	NA
WP_085431237.1|2703409_2703817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244186.1|2703949_2704522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431238.1|2704650_2705043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244188.1|2705042_2705498_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_085431239.1|2705491_2706511_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_081244190.1|2706507_2706870_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_081244191.1|2706940_2707081_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_085431240.1|2707096_2707351_+	sporulation protein	NA	NA	NA	NA	NA
WP_085431241.1|2707431_2707740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244194.1|2707790_2708297_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081244195.1|2708247_2708763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431242.1|2708851_2709574_-	esterase family protein	NA	NA	NA	NA	NA
WP_081244197.1|2709680_2710232_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	46.1	6.8e-33
WP_155961374.1|2710341_2710518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244198.1|2711779_2712781_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_085431244.1|2712927_2713452_+	DUF1850 domain-containing protein	NA	NA	NA	NA	NA
WP_099662790.1|2713495_2715478_+	TRAP transporter permease	NA	NA	NA	NA	NA
2716358:2716379	attL	TGGTGTTAAATTGGTGTTAAAA	NA	NA	NA	NA
WP_085431245.1|2716941_2717694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143565483.1|2718208_2719216_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_085431247.1|2719266_2720442_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	43.8	1.9e-80
WP_085431248.1|2720685_2720892_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085431249.1|2720951_2721842_+	hypothetical protein	NA	A0A0K1LKD4	Vibrio_phage	36.7	4.9e-33
WP_085431250.1|2721838_2723368_+	DUF3987 domain-containing protein	NA	A0A1B1W291	Salmonella_phage	23.8	1.0e-06
WP_085431251.1|2723559_2726148_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_085431252.1|2726144_2728016_-	site-specific DNA-methyltransferase	NA	A0A2R3ZYF2	Campylobacter_phage	36.5	8.4e-51
WP_085431253.1|2728049_2728952_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_085430032.1|2729371_2730826_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_085430033.1|2730822_2731548_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	39.2	1.9e-35
WP_085431812.1|2732390_2734154_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	4.9e-24
WP_085431254.1|2735635_2737282_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.2	1.0e-52
WP_085431255.1|2737322_2737721_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_085431256.1|2738163_2738532_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	75.4	1.1e-47
WP_085431257.1|2738524_2740657_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	86.8	0.0e+00
WP_085431258.1|2740808_2742167_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	51.5	2.1e-120
WP_157118655.1|2742403_2743747_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2747808:2747829	attR	TGGTGTTAAATTGGTGTTAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP015349	Sporosarcina sp. P37 chromosome, complete genome	3271521	3116386	3204057	3271521	tRNA,terminase,plate,integrase,protease,portal,capsid,holin,tail,transposase	Vibrio_phage(16.67%)	108	3118753:3118771	3210005:3210023
WP_085431397.1|3116386_3117574_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.5	4.9e-44
WP_081244554.1|3117551_3118535_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
3118753:3118771	attL	TGAAATCAGACGTAAAGGA	NA	NA	NA	NA
WP_081244555.1|3118782_3119622_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.0	1.9e-42
WP_085431838.1|3119636_3120500_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_081244557.1|3120492_3120876_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_085431398.1|3121157_3123932_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	21.5	7.9e-37
WP_081244560.1|3124001_3124481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431399.1|3124518_3125712_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_081244563.1|3125756_3126464_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	45.5	5.5e-19
WP_081244565.1|3126472_3127120_+	endonuclease III	NA	NA	NA	NA	NA
WP_081244566.1|3127116_3127452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244567.1|3127504_3130210_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_081244569.1|3130234_3130846_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	33.5	2.4e-23
WP_081244570.1|3131047_3131425_+	YppE family protein	NA	NA	NA	NA	NA
WP_085431400.1|3131417_3133685_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_085431401.1|3133703_3135530_-	recombinase family protein	NA	A0A060QNA4	Streptococcus_phage	25.8	3.5e-25
WP_085431677.1|3135664_3137233_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.9	3.2e-51
WP_085430032.1|3137410_3138865_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_085430033.1|3138861_3139587_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	39.2	1.9e-35
WP_085430172.1|3139701_3140055_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157118611.1|3140073_3140271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431402.1|3140389_3141793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157118657.1|3141811_3142945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431404.1|3142972_3143551_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1L2JY13	Aeribacillus_phage	67.0	1.2e-69
WP_085431405.1|3143647_3144376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431406.1|3144406_3144829_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	52.5	1.5e-35
WP_085431407.1|3144986_3145196_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	56.2	3.8e-13
WP_085431408.1|3145227_3145407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431409.1|3145395_3145632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085431410.1|3145706_3145904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431411.1|3146146_3146479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431412.1|3146716_3146905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431413.1|3146921_3147104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431414.1|3147222_3147513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157118658.1|3147527_3147686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431415.1|3147988_3148285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431416.1|3148350_3149031_+	hypothetical protein	NA	A0A0K2CNP0	Brevibacillus_phage	38.9	2.0e-34
WP_085431417.1|3149027_3149822_+	DnaD domain protein	NA	A9CR67	Staphylococcus_phage	51.2	1.3e-29
WP_085431419.1|3149751_3150594_+	AAA family ATPase	NA	U5PVD6	Bacillus_phage	43.1	1.1e-45
WP_085431420.1|3150605_3150794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431422.1|3150817_3151042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157118659.1|3151209_3151419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157118660.1|3151418_3151559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431426.1|3151579_3151981_+	replication terminator protein	NA	A0A1L2JY32	Aeribacillus_phage	65.0	5.3e-35
WP_085431428.1|3152002_3152713_+	hypothetical protein	NA	A0A1L2JZ42	Aeribacillus_phage	49.2	5.1e-57
WP_085431430.1|3152908_3153289_+	hypothetical protein	NA	A0A142F130	Bacillus_phage	32.8	9.2e-13
WP_085431432.1|3153331_3153547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431434.1|3153612_3153948_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	52.7	6.0e-24
WP_099662710.1|3154001_3154214_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	53.8	1.1e-07
WP_085431436.1|3154210_3154783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099662703.1|3154891_3155065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431438.1|3155079_3155514_+	hypothetical protein	NA	Q0H270	Geobacillus_phage	40.1	2.2e-23
WP_085431440.1|3155517_3156072_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	55.2	6.8e-49
WP_085431442.1|3156708_3157287_+	hypothetical protein	NA	A0A2K9V441	Faecalibacterium_phage	26.3	7.7e-11
WP_085431454.1|3157246_3159049_+|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	51.9	6.0e-171
WP_085431842.1|3159091_3159286_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.0	1.1e-11
WP_085431456.1|3159302_3160853_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	57.7	2.7e-159
WP_085431457.1|3160842_3161871_+|protease	Clp protease ClpP	protease	A0A2H4JAJ9	uncultured_Caudovirales_phage	54.3	2.5e-57
WP_085431458.1|3161872_3162241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431459.1|3162244_3163273_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	44.4	1.5e-78
WP_085431460.1|3163498_3163975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431461.1|3163985_3164531_+	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	34.1	2.7e-18
WP_085431463.1|3164534_3165020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431465.1|3165012_3165333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431467.1|3165332_3166775_+	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	45.9	4.6e-113
WP_085431468.1|3166789_3167314_+|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	34.5	1.8e-22
WP_085431470.1|3167329_3167665_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_085431472.1|3167809_3171028_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	57.5	6.2e-94
WP_085431474.1|3171020_3171236_+	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	38.1	1.8e-05
WP_085431476.1|3171232_3172252_+	hypothetical protein	NA	A0A067ZG47	Vibrio_phage	30.5	7.4e-33
WP_085431478.1|3172251_3172680_+|plate	phage baseplate assembly protein V	plate	A0A0E3Y4V1	Fusobacterium_phage	36.5	3.7e-10
WP_085431479.1|3172676_3173345_+	hypothetical protein	NA	A0A067ZI88	Vibrio_phage	32.6	9.5e-13
WP_157118661.1|3173373_3173661_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	40.0	1.3e-08
WP_085431483.1|3173647_3174766_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	40.3	2.6e-71
WP_085431484.1|3174758_3175511_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	34.3	1.6e-24
WP_157118662.1|3175521_3176373_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	41.8	3.1e-24
WP_085431487.1|3176374_3177643_+	hypothetical protein	NA	G3MAG6	Bacillus_virus	33.4	1.2e-43
WP_085431489.1|3177642_3177852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431491.1|3177852_3178005_+	XkdX family protein	NA	NA	NA	NA	NA
WP_143565443.1|3178059_3178653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431495.1|3178756_3179251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431496.1|3179288_3179483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431498.1|3179691_3180687_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.4	1.2e-19
WP_085431500.1|3180777_3181143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085431502.1|3181157_3181427_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	53.0	8.7e-18
WP_085431504.1|3181426_3182251_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A191KBX1	Streptococcus_virus	44.3	1.2e-09
WP_085431506.1|3182268_3183018_+	N-acetylmuramoyl-L-alanine amidase	NA	G3MB93	Bacillus_virus	59.6	1.1e-57
WP_085431844.1|3183111_3183504_+	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_085431508.1|3183600_3183969_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_085431510.1|3184033_3184714_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_085431512.1|3184713_3184917_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085431514.1|3185096_3186392_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085431516.1|3186443_3186890_-	DUF4385 domain-containing protein	NA	A0A0C5AAP9	Cyanophage	52.8	3.3e-38
WP_081244582.1|3187017_3187239_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085431518.1|3187514_3188786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081244585.1|3188866_3189160_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_081244586.1|3189253_3189949_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_085431520.1|3189994_3192259_-	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.8	1.0e-114
WP_085431522.1|3193437_3194565_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_085431524.1|3194627_3196529_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	24.3	6.4e-30
WP_081244592.1|3196589_3197048_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_085431526.1|3197311_3200905_+	GTPase	NA	NA	NA	NA	NA
WP_085431528.1|3200901_3201726_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_081244596.1|3201732_3202323_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_085431846.1|3202431_3202833_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_081244598.1|3202943_3203141_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_081244600.1|3203215_3203428_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	55.6	1.6e-14
WP_085431530.1|3203679_3204057_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
3210005:3210023	attR	TGAAATCAGACGTAAAGGA	NA	NA	NA	NA
