The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	125821	132346	2966603	tail	Listeria_phage(33.33%)	9	NA	NA
WP_014601579.1|125821_126274_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	5.2e-31
WP_003721740.1|126279_126615_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|126831_127260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732220.1|127271_127688_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003721744.1|128367_128880_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_014601580.1|128927_129230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014601581.1|129271_129676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014601582.1|129662_131531_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_014601583.1|131527_132346_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	9.4e-39
>prophage 2
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	1126420	1135378	2966603		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1126420_1126804_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_014601903.1|1126825_1127809_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	2.4e-12
WP_023552323.1|1127823_1128837_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	1.3e-10
WP_003721509.1|1129045_1130536_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_014601905.1|1130547_1131372_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	1.3e-67
WP_003721511.1|1131384_1131693_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003721512.1|1131752_1132157_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014601906.1|1132285_1133842_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.9e-17
WP_014601907.1|1133974_1135378_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	25.7	1.2e-17
>prophage 3
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	1246898	1327988	2966603	tail,terminase,portal,tRNA,capsid,holin,integrase,protease	Listeria_phage(80.0%)	104	1246782:1246803	1291696:1291717
1246782:1246803	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_046811282.1|1246898_1248053_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	94.3	4.4e-207
WP_014930257.1|1248181_1249045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068995307.1|1249096_1249549_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_003747248.1|1249565_1249889_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	69.2	2.1e-34
WP_003730994.1|1250517_1250721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|1250787_1250979_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|1251000_1251243_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1251245_1251431_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_009929542.1|1251665_1251818_+	hypothetical protein	NA	A8ATD4	Listeria_phage	100.0	1.5e-19
WP_012951522.1|1252183_1252426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085398090.1|1252711_1253365_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	79.8	4.0e-40
WP_070783629.1|1253354_1253930_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	41.5	1.9e-25
WP_003731819.1|1253926_1254193_+	hypothetical protein	NA	R4IBL5	Listeria_phage	84.9	1.9e-33
WP_003747322.1|1254189_1254450_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	65.3	3.1e-20
WP_003747324.1|1254440_1254608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003747326.1|1254604_1255066_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	30.6	1.7e-13
WP_003722554.1|1255062_1255230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085398091.1|1255333_1255549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070785055.1|1255545_1255755_+	hypothetical protein	NA	A0A059T6C7	Listeria_phage	42.4	3.8e-05
WP_011702021.1|1255954_1256152_+	hypothetical protein	NA	A8ASP4	Listeria_phage	74.6	2.0e-19
WP_070783688.1|1256155_1256443_+	hypothetical protein	NA	R4IBL5	Listeria_phage	59.3	2.1e-22
WP_070783687.1|1256439_1256859_+	hypothetical protein	NA	R4IBV9	Listeria_phage	50.6	5.2e-17
WP_014929533.1|1256879_1257140_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	49.4	7.9e-16
WP_009933642.1|1257143_1257317_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	100.0	5.2e-24
WP_031647169.1|1257313_1257697_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	100.0	1.9e-66
WP_014929535.1|1257698_1258178_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	100.0	5.4e-79
WP_069001801.1|1258190_1258880_+	AAA family ATPase	NA	A0A059T7T3	Listeria_phage	99.6	5.7e-130
WP_069008476.1|1258943_1260200_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	90.4	1.7e-220
WP_015987323.1|1260222_1260705_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	100.0	4.9e-88
WP_085398092.1|1260727_1263001_+	DNA primase	NA	A8ATF3	Listeria_phage	98.4	0.0e+00
WP_014601407.1|1263289_1263607_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	95.1	9.2e-51
WP_003731659.1|1263608_1263821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069008471.1|1264268_1264808_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1264804_1265074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172426588.1|1265102_1265258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060586935.1|1265318_1265546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1265558_1265984_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_009917711.1|1266081_1266825_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_009917710.1|1267288_1267603_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	100.0	1.7e-57
WP_014929542.1|1267652_1268009_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_070785043.1|1268005_1269649_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.4	0.0e+00
WP_070785041.1|1269660_1270791_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	8.0e-214
WP_014601416.1|1270787_1271504_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.5	7.9e-66
WP_085398093.1|1271530_1272682_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	92.7	1.0e-200
WP_023548922.1|1272688_1272859_+	hypothetical protein	NA	A8AT99	Listeria_phage	94.6	6.9e-21
WP_003731645.1|1272868_1273168_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_003731644.1|1273151_1273517_+	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731643.1|1273513_1273915_+	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_012581456.1|1273911_1274295_+	hypothetical protein	NA	A8ATA3	Listeria_phage	100.0	3.8e-67
WP_023548920.1|1274316_1274904_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	99.5	1.5e-107
WP_023548918.1|1274975_1275308_+	hypothetical protein	NA	A8ATA5	Listeria_phage	97.3	4.3e-51
WP_003731639.1|1275358_1275508_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	98.0	6.7e-20
WP_085398094.1|1275522_1280454_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.6	0.0e+00
WP_031640926.1|1280441_1282091_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_085398095.1|1282106_1284401_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.6	0.0e+00
WP_085398096.1|1284390_1285482_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	91.2	8.6e-189
WP_003722523.1|1285520_1285886_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|1285898_1286180_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_085398097.1|1286179_1286887_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	92.3	6.9e-123
WP_039390104.1|1287158_1287389_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_061106462.1|1287516_1289457_+	N-6 DNA methylase	NA	A0A1W6JNK1	Staphylococcus_phage	54.2	9.9e-188
WP_061106461.1|1289588_1290491_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085398098.1|1290549_1290756_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	84.5	3.3e-17
WP_012951563.1|1291196_1291430_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_014601943.1|1292077_1293436_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1291696:1291717	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_014601944.1|1293476_1294070_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_009914084.1|1294223_1294631_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1294795_1295395_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1295426_1295687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1295810_1297223_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1297247_1297511_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003723546.1|1297678_1298155_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_014601946.1|1298192_1298438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723548.1|1298434_1299640_-	MFS transporter	NA	NA	NA	NA	NA
WP_003732785.1|1299844_1300504_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1300545_1300740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1300806_1301655_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1301986_1302124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732787.1|1302274_1302988_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014601947.1|1303007_1304666_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_023552381.1|1304684_1306169_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014601949.1|1306285_1306747_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1306785_1307250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601950.1|1307438_1308353_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014601951.1|1308377_1309625_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	4.2e-107
WP_014601952.1|1309608_1310439_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.1e-45
WP_014601953.1|1310586_1311726_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1311806_1312202_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1312352_1312568_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014931391.1|1312686_1313220_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1313237_1313903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1314164_1315103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1315217_1316501_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1316684_1317944_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_014601954.1|1318062_1318629_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1318663_1319233_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1319334_1319877_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_014601956.1|1319886_1320750_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1320746_1321532_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1321665_1322526_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003732799.1|1322797_1324876_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_010989721.1|1324938_1326243_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1326525_1327428_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1327448_1327988_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 4
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	1862926	1871212	2966603		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1862926_1863493_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_014602075.1|1863489_1864539_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	3.0e-61
WP_003722245.1|1864557_1865985_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_014602076.1|1865969_1868189_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.3e-159
WP_003733240.1|1868181_1868865_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1868868_1869114_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003733239.1|1869125_1869839_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
WP_014602077.1|1869919_1871212_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	2386313	2426698	2966603	tail,holin,terminase	Listeria_phage(94.12%)	63	NA	NA
WP_023552378.1|2386313_2386745_+	hypothetical protein	NA	A8ATJ2	Listeria_phage	81.7	1.8e-25
WP_003731798.1|2386741_2387242_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	72.4	2.1e-65
WP_039382824.1|2387296_2387722_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_039382826.1|2387724_2387973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039382828.1|2388007_2388544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061108246.1|2388877_2389720_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	81.6	5.5e-127
WP_012951558.1|2389719_2389977_-|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_014930187.1|2389976_2390279_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	92.0	2.2e-38
WP_069001806.1|2390329_2392495_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.3	0.0e+00
WP_023552439.1|2392507_2394076_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	1.5e-303
WP_069001807.1|2394072_2398872_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	88.1	0.0e+00
WP_072217631.1|2398876_2399188_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	93.4	2.5e-40
WP_014601497.1|2399184_2399616_-	hypothetical protein	NA	A0A0B5D0B8	Listeria_phage	99.3	1.1e-73
WP_014601498.1|2399671_2400361_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	86.0	3.3e-101
WP_003725064.1|2400365_2400737_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_014601499.1|2400733_2401051_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	1.4e-51
WP_003725065.1|2401040_2401406_-	hypothetical protein	NA	A0A0B5D114	Listeria_phage	95.0	4.2e-63
WP_003725066.1|2401405_2401759_-	hypothetical protein	NA	A8ATV2	Listeria_phage	97.4	1.2e-59
WP_003725067.1|2401759_2401915_-	hypothetical protein	NA	A0A0B5CYK6	Listeria_phage	98.0	1.0e-18
WP_003725068.1|2401928_2402801_-	hypothetical protein	NA	A0A0B5CTX8	Listeria_phage	99.7	4.5e-164
WP_003744996.1|2402823_2403378_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_023552448.1|2403473_2404517_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	97.7	5.3e-196
WP_023552450.1|2404521_2406081_-	hypothetical protein	NA	A0A0B5D0A6	Listeria_phage	97.3	3.1e-293
WP_051148099.1|2406095_2407442_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	95.4	1.5e-254
WP_068996232.1|2407407_2408133_-	TerS	NA	A0A0B5CTX0	Listeria_phage	72.0	8.5e-84
WP_068996231.1|2408176_2408404_-	hypothetical protein	NA	A8AU06	Listeria_phage	96.0	1.1e-32
WP_031643386.1|2408483_2409116_-	hypothetical protein	NA	A8AU05	Listeria_phage	93.3	2.1e-107
WP_039388663.1|2409273_2409846_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5D145	Listeria_phage	87.9	9.1e-89
WP_003744979.1|2409933_2410089_-	hypothetical protein	NA	A0A0B5D186	Listeria_phage	100.0	6.7e-23
WP_003744975.1|2410229_2410613_-	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	99.2	5.2e-64
WP_023552460.1|2410616_2411021_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	84.3	4.5e-58
WP_039388666.1|2410965_2411148_-	hypothetical protein	NA	A8ASP6	Listeria_phage	82.5	1.3e-17
WP_023552462.1|2411166_2411649_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	66.9	1.1e-52
WP_023552463.1|2411645_2411927_-	hypothetical protein	NA	R4IBL7	Listeria_phage	92.7	7.5e-20
WP_003747326.1|2412105_2412567_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	30.6	1.7e-13
WP_003747324.1|2412563_2412731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003747322.1|2412721_2412982_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	65.3	3.1e-20
WP_039388669.1|2412978_2413245_-	hypothetical protein	NA	R4IBL5	Listeria_phage	84.9	1.1e-33
WP_096813853.1|2413241_2413889_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	35.9	3.1e-21
WP_003731843.1|2413885_2414101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731842.1|2414112_2414280_-	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_023553782.1|2414292_2414823_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	86.4	3.5e-87
WP_003747316.1|2414819_2415794_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	71.0	3.1e-121
WP_014601516.1|2415810_2416449_-	ERF family protein	NA	A8ASN3	Listeria_phage	76.7	7.8e-81
WP_003747311.1|2416453_2416930_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	93.0	7.1e-71
WP_003747308.1|2416926_2417121_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	96.9	6.0e-29
WP_003747307.1|2417423_2417612_-	hypothetical protein	NA	Q9T175	Listeria_phage	77.4	1.7e-20
WP_014601517.1|2417719_2417935_-	hypothetical protein	NA	Q9T176	Listeria_phage	69.0	6.7e-21
WP_003747303.1|2417931_2418465_-	hypothetical protein	NA	A8ATY1	Listeria_phage	84.4	1.8e-75
WP_003747301.1|2418585_2419359_-	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	99.6	2.4e-140
WP_003747299.1|2419421_2419631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003747297.1|2419733_2419934_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003747295.1|2420106_2420592_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	52.5	2.3e-32
WP_003747292.1|2420748_2420916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003747290.1|2420971_2421190_+	hypothetical protein	NA	A0A059T6E3	Listeria_phage	81.9	2.4e-26
WP_009930456.1|2421205_2421928_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	98.3	2.8e-103
WP_003733641.1|2421950_2422556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749252.1|2422568_2422991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003749254.1|2423045_2423501_+	hypothetical protein	NA	Q6SEA3	Lactobacillus_prophage	39.0	1.9e-17
WP_003749255.1|2423520_2424294_+	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_049891860.1|2424470_2425829_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	90.3	2.5e-238
WP_039388697.1|2425819_2426296_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2426350_2426698_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 6
NZ_CP020827	Listeria monocytogenes strain CFSAN028538 chromosome, complete genome	2966603	2568809	2576653	2966603		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2568809_2569781_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2569788_2570757_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2570758_2571634_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_014602231.1|2571741_2573472_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	1.6e-173
WP_003734087.1|2573513_2574575_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_014601137.1|2574591_2575575_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.2	1.6e-48
WP_003722610.1|2575693_2576653_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
