The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	259850	267798	5597907		uncultured_virus(33.33%)	6	NA	NA
WP_002009985.1|259850_260135_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	4.4e-20
WP_002029451.1|260172_261807_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	2.2e-156
WP_164081472.1|262210_263752_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.0e-21
WP_002091603.1|264136_265462_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.2	2.4e-44
WP_085308686.1|265607_266309_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_085308688.1|266292_267798_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	2.1e-31
>prophage 2
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	339011	402712	5597907	transposase,terminase,capsid,tail,head,integrase,portal,protease,tRNA	Bacillus_phage(88.68%)	77	338939:338960	383845:383866
338939:338960	attL	ATGGACTTCATTTGTTTGTGCG	NA	NA	NA	NA
WP_085308735.1|339011_340073_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	78.8	2.0e-158
WP_085312926.1|340672_341923_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	80.1	4.1e-187
WP_085308737.1|342301_342649_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	95.6	8.8e-55
WP_085308739.1|342794_343031_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	93.6	4.0e-35
WP_085308741.1|343063_343252_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	91.9	2.5e-24
WP_172805393.1|343273_343429_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	96.0	7.5e-22
WP_085308743.1|343466_344261_+	ORF6C domain-containing protein	NA	A0A0S2GLP8	Bacillus_phage	94.3	1.2e-134
WP_085308745.1|344420_344729_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	86.1	6.9e-43
WP_085308747.1|344906_345803_+	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	61.9	4.7e-76
WP_085308750.1|345738_346611_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	72.1	1.7e-102
WP_085308752.1|346644_347004_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	51.7	9.2e-31
WP_085308754.1|346981_347188_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	67.9	2.2e-13
WP_085308756.1|347218_347791_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	86.3	5.1e-92
WP_085308758.1|347970_348378_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_085308762.1|348944_350174_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	1.7e-84
WP_085308763.1|350542_351238_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	79.3	8.7e-110
WP_085308765.1|351282_351633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308767.1|351669_352038_+	spore protein H	NA	NA	NA	NA	NA
WP_085308769.1|352082_352382_+	hypothetical protein	NA	D2XR51	Bacillus_phage	90.9	9.9e-47
WP_085308771.1|352417_352645_+	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	100.0	1.6e-36
WP_085308773.1|352678_352990_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	90.3	1.1e-43
WP_085308775.1|353025_353271_+	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	64.2	1.8e-25
WP_085308777.1|353436_353634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308779.1|354051_354408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404927.1|354515_354677_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_172805394.1|354790_354961_+	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	82.1	2.2e-06
WP_085308781.1|354988_355471_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.8	5.0e-72
WP_085308782.1|355470_356013_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	3.3e-88
WP_085308785.1|356227_356452_+	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	7.5e-31
WP_085308787.1|356837_357053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308789.1|357105_357327_+	hypothetical protein	NA	H0USV7	Bacillus_phage	75.3	2.6e-20
WP_085308790.1|357319_357574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805395.1|357613_357787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308794.1|357833_358046_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	87.1	2.4e-26
WP_085308798.1|358398_358650_+	hydrolase	NA	NA	NA	NA	NA
WP_085308800.1|358662_358917_+	hypothetical protein	NA	H0USW0	Bacillus_phage	93.8	3.8e-39
WP_085308802.1|358932_359118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308804.1|359107_359506_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	1.3e-65
WP_063607610.1|359614_360118_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	95.8	2.4e-85
WP_085308806.1|360119_361814_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	93.3	0.0e+00
WP_085308808.1|362002_363250_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	93.3	2.2e-225
WP_050000543.1|363236_363947_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.3	1.1e-123
WP_085308810.1|363984_365163_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	90.7	1.2e-196
WP_085308811.1|365183_365462_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	84.8	3.3e-36
WP_085308813.1|365458_365782_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	88.8	8.5e-52
WP_078206878.1|365774_366209_+	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	89.0	5.1e-68
WP_085308816.1|366205_366565_+	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	91.6	5.2e-58
WP_085308818.1|366565_367174_+|tail	phage tail protein	tail	A0A288WG55	Bacillus_phage	90.6	1.2e-94
WP_085308820.1|367221_367539_+	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	86.7	1.8e-46
WP_170972767.1|367568_367745_+	hypothetical protein	NA	Q3HL07	Bacillus_phage	67.2	1.4e-13
WP_085308822.1|367760_371609_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	82.5	0.0e+00
WP_085308824.1|371623_373114_+|tail	phage tail family protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	87.7	2.2e-267
WP_085308826.1|373110_377187_+|tail	phage tail protein	tail	H0USX5	Bacillus_phage	62.7	0.0e+00
WP_085308828.1|377287_378247_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	94.0	6.4e-172
WP_085308830.1|378260_378542_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	83.9	1.4e-34
WP_085308832.1|378544_378757_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	89.7	4.6e-30
WP_085308834.1|378756_379542_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7T9	Bacillus_phage	83.1	4.6e-35
WP_085308836.1|379849_380080_-	helix-turn-helix domain-containing protein	NA	S5MBY6	Brevibacillus_phage	45.7	2.3e-11
WP_085308838.1|380524_380845_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	93.4	5.6e-48
WP_085308840.1|380855_382022_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	89.7	3.3e-202
WP_085308842.1|382011_382620_+	replication-relaxation family protein	NA	A0A0S2GLL8	Bacillus_phage	92.5	6.6e-106
WP_085308845.1|382622_383504_-	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	84.9	1.5e-127
WP_000086999.1|384184_384475_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
383845:383866	attR	ATGGACTTCATTTGTTTGTGCG	NA	NA	NA	NA
WP_002010048.1|384489_385947_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002010050.1|385961_387389_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002010051.1|387948_388854_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.1	5.4e-27
WP_085308847.1|389048_389795_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_172805396.1|389950_391315_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_002029493.1|391622_392990_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002124905.1|392982_394434_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263259.1|394481_394805_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_085308851.1|394845_396075_-	aminopeptidase	NA	NA	NA	NA	NA
WP_085308853.1|396191_397274_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_085308855.1|397777_398482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016093450.1|398528_399725_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_085308857.1|400144_401521_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.4	1.9e-116
WP_085308859.1|401722_402712_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	815304	855553	5597907	transposase,terminase,capsid,tail,head,integrase,portal,protease,holin	Bacillus_phage(93.02%)	52	809745:809761	838950:838966
809745:809761	attL	AACAATCGAAGAAAGAT	NA	NA	NA	NA
WP_085309205.1|815304_816396_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	77.7	7.9e-158
WP_085309207.1|817010_818273_+	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	58.1	8.9e-137
WP_085309209.1|818601_818949_-	helix-turn-helix transcriptional regulator	NA	A0A288WGH2	Bacillus_phage	64.3	7.3e-33
WP_085309211.1|819098_819314_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	64.7	1.8e-18
WP_085309213.1|819398_819587_+	helix-turn-helix domain-containing protein	NA	A0A0S2GLE9	Bacillus_phage	80.6	6.5e-20
WP_170924938.1|819611_819767_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	92.0	8.2e-21
WP_085309215.1|819804_820620_+	ORF6C domain-containing protein	NA	Q3HL19	Bacillus_phage	78.2	4.1e-119
WP_085309217.1|820779_821094_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	87.5	1.2e-45
WP_085309219.1|821367_822015_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	80.5	1.1e-93
WP_085312931.1|822260_823163_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	65.3	2.9e-105
WP_172805449.1|823131_823938_+	ATP-binding protein	NA	D2XQ17	Bacillus_virus	80.9	6.1e-123
WP_085309223.1|824022_824289_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	87.5	2.4e-36
WP_085309225.1|824361_824529_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	75.9	6.6e-16
WP_085309227.1|824561_824831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404885.1|824925_825093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309231.1|825692_826232_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085309233.1|826511_826877_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	61.2	4.1e-34
WP_085308769.1|827197_827497_+	hypothetical protein	NA	D2XR51	Bacillus_phage	90.9	9.9e-47
WP_172805399.1|828580_828745_+	hypothetical protein	NA	W8CYP0	Bacillus_phage	84.9	7.6e-17
WP_085309242.1|828930_829215_+	hypothetical protein	NA	A0A1B1P8C3	Bacillus_phage	61.7	2.0e-25
WP_085312932.1|829451_829730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805400.1|829726_829888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309244.1|829924_830296_+	hypothetical protein	NA	A0A140HLN4	Bacillus_phage	41.5	2.5e-15
WP_157404886.1|830314_830449_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_172805401.1|830551_830722_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	69.6	3.9e-08
WP_050000419.1|830742_831213_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.8	4.9e-48
WP_085309246.1|831209_831752_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	90.6	1.1e-88
WP_085309248.1|832372_832822_+	hypothetical protein	NA	A0A288WG64	Bacillus_phage	53.8	5.2e-31
WP_157404887.1|832853_833183_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	54.5	7.7e-16
WP_085309250.1|833169_833382_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	72.9	2.1e-19
WP_085309252.1|833663_833894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309254.1|833883_834240_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	56.0	1.6e-30
WP_085309256.1|834253_834487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309258.1|834636_835017_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	93.7	8.2e-62
WP_085309260.1|834997_836770_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	87.9	1.6e-311
WP_085309262.1|836791_838009_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	62.5	1.0e-150
WP_085309264.1|837986_838745_+|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	64.7	7.3e-86
WP_157404928.1|838768_839953_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	71.2	1.0e-150
838950:838966	attR	AACAATCGAAGAAAGAT	NA	NA	NA	NA
WP_085312934.1|840029_840230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309268.1|840242_840494_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	47.1	4.9e-15
WP_085309270.1|840500_840848_+|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	93.9	1.7e-58
WP_085309272.1|840835_841273_+	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	91.7	5.9e-72
WP_085309274.1|841269_841629_+	structural protein	NA	A0A1B1P7S7	Bacillus_phage	93.3	2.5e-60
WP_085309276.1|841642_842224_+|tail	phage tail protein	tail	A0A1B1P7S4	Bacillus_phage	91.7	7.5e-99
WP_085309278.1|842699_842840_+	LysR family transcriptional regulator	NA	A0A1B1P7R9	Bacillus_phage	89.1	2.5e-16
WP_085309279.1|842854_847864_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	73.5	0.0e+00
WP_085309280.1|847904_849392_+|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	78.8	2.8e-238
WP_085309282.1|849388_853402_+|tail	tail fiber domain-containing protein	tail	A0A1B1P7S3	Bacillus_phage	81.2	0.0e+00
WP_085309284.1|853424_853865_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	95.3	1.5e-75
WP_085309286.1|854125_854350_+	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	95.9	5.4e-29
WP_085309288.1|854426_854852_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	88.7	3.4e-64
WP_085309290.1|854851_855553_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	88.1	7.1e-120
>prophage 4
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	1476907	1505399	5597907	integrase,transposase,tail,holin	Bacillus_phage(75.86%)	34	1495966:1495981	1512463:1512478
WP_085309993.1|1476907_1478794_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	33.7	1.8e-85
WP_085309995.1|1478988_1480098_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.9	5.6e-143
WP_085309997.1|1480440_1481589_+	hypothetical protein	NA	H0UST6	Bacillus_phage	40.1	1.9e-82
WP_153602161.1|1481592_1481748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309999.1|1481951_1482296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006926358.1|1482332_1482995_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	43.3	2.2e-46
WP_157404891.1|1483146_1483299_+	DNA polymerase III subunit delta'	NA	A0A0A7AQZ6	Bacillus_phage	78.0	7.3e-14
WP_085310001.1|1483305_1483653_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	92.2	2.5e-49
WP_033692757.1|1483829_1484048_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	94.4	5.9e-33
WP_085310003.1|1484107_1484902_+	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	55.1	6.3e-72
WP_085310005.1|1484916_1485192_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	84.3	8.0e-35
WP_172805407.1|1485226_1485373_+	hypothetical protein	NA	A0A1B1P8G4	Bacillus_phage	60.4	7.5e-08
WP_172805408.1|1485420_1485597_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	77.6	7.2e-21
WP_078204460.1|1485602_1486466_+	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	43.1	5.3e-40
WP_078204461.1|1486407_1487271_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	72.3	9.8e-103
WP_078204462.1|1487273_1487468_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	90.6	4.3e-27
WP_085310007.1|1487484_1487763_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	4.6e-14
WP_085310009.1|1487755_1488115_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	53.3	3.5e-30
WP_042596972.1|1488134_1488302_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_000109496.1|1488327_1488579_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	6.5e-07
WP_085310011.1|1488598_1489054_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	1.1e-20
WP_085310013.1|1489091_1489361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085310015.1|1489347_1489647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312947.1|1489748_1489943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308762.1|1490246_1491476_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	1.7e-84
WP_085310017.1|1491845_1492163_+	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	86.7	4.0e-46
WP_157404892.1|1492192_1492369_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	70.7	2.0e-15
WP_085310019.1|1492384_1496230_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	83.1	0.0e+00
1495966:1495981	attL	TGTTTTTGATTTTGGA	NA	NA	NA	NA
WP_085310022.1|1496244_1497735_+|tail	phage tail family protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	87.7	4.8e-267
WP_085310024.1|1497731_1502165_+|tail	tail fiber domain-containing protein	tail	H0USX5	Bacillus_phage	72.3	0.0e+00
WP_085310026.1|1502289_1502985_+	hypothetical protein	NA	D2XR29	Bacillus_phage	91.8	6.4e-113
WP_085310028.1|1503192_1504152_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	94.4	2.9e-172
WP_085310030.1|1504167_1504593_+|holin	phage holin family protein	holin	Q2I8E7	Bacillus_phage	85.8	9.1e-62
WP_085310032.1|1504592_1505399_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	91.0	4.8e-152
1512463:1512478	attR	TCCAAAATCAAAAACA	NA	NA	NA	NA
>prophage 5
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	1983836	1992650	5597907		Bacillus_phage(85.71%)	8	NA	NA
WP_085310514.1|1983836_1985114_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	33.1	2.5e-14
WP_002135756.1|1985294_1986059_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085310516.1|1986334_1988095_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	94.3	1.2e-264
WP_085310518.1|1988181_1988859_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	92.0	1.1e-117
WP_085310521.1|1988855_1989929_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	87.4	2.7e-171
WP_000818985.1|1990097_1990817_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_085312954.1|1990966_1991638_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	89.1	5.9e-63
WP_085310523.1|1991771_1992650_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.0	1.2e-63
>prophage 6
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	2068921	2132873	5597907	transposase,terminase,tail,integrase,portal,coat	Bacillus_phage(93.18%)	77	2087922:2087938	2133218:2133234
WP_085310605.1|2068921_2069380_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_016120072.1|2069567_2069747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085310607.1|2069985_2070606_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000217328.1|2070630_2071113_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_002086044.1|2071114_2072422_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002012455.1|2072631_2073519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085310609.1|2073906_2074554_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_172805410.1|2074980_2076333_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_085310613.1|2076399_2076729_+	chaperone CsaA	NA	NA	NA	NA	NA
WP_085310615.1|2076709_2077276_+	DUF1572 family protein	NA	NA	NA	NA	NA
WP_002012463.1|2077557_2077854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002135865.1|2077943_2079098_+	stage II sporulation protein SpoIIP	NA	NA	NA	NA	NA
WP_085310617.1|2079384_2079882_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085310619.1|2079893_2080634_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_002127013.1|2080657_2081104_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_085310621.1|2081291_2082773_+	amidase	NA	NA	NA	NA	NA
WP_085310623.1|2082822_2084040_-	MFS transporter	NA	NA	NA	NA	NA
WP_002012470.1|2084315_2084744_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002012471.1|2084746_2085718_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_085312957.1|2085791_2086946_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_002065036.1|2087036_2087627_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
2087922:2087938	attL	GGTCATAGTGTTTCTTA	NA	NA	NA	NA
WP_085310625.1|2087958_2089050_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.6	1.8e-162
WP_085310627.1|2089782_2091003_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.2	3.7e-108
WP_001033792.1|2091260_2091407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085310629.1|2091403_2091748_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_000714354.1|2091922_2092129_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016109799.1|2092204_2092393_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
WP_172805411.1|2092417_2092573_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	90.0	4.1e-20
WP_085310631.1|2092610_2093426_+	ORF6C domain-containing protein	NA	Q3HL19	Bacillus_phage	78.2	1.1e-119
WP_085309217.1|2093585_2093900_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	87.5	1.2e-45
WP_085309219.1|2094173_2094821_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	80.5	1.1e-93
WP_085312931.1|2095066_2095969_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	65.3	2.9e-105
WP_172805449.1|2095937_2096744_+	ATP-binding protein	NA	D2XQ17	Bacillus_virus	80.9	6.1e-123
WP_085309223.1|2096828_2097095_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	87.5	2.4e-36
WP_085309225.1|2097167_2097335_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	75.9	6.6e-16
WP_085309227.1|2097367_2097637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404885.1|2097731_2097899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085308667.1|2097972_2098500_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157404881.1|2098475_2099039_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085309233.1|2099318_2099684_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	61.2	4.1e-34
WP_085308769.1|2100004_2100304_+	hypothetical protein	NA	D2XR51	Bacillus_phage	90.9	9.9e-47
WP_172805399.1|2101387_2101552_+	hypothetical protein	NA	W8CYP0	Bacillus_phage	84.9	7.6e-17
WP_085309242.1|2101737_2102022_+	hypothetical protein	NA	A0A1B1P8C3	Bacillus_phage	61.7	2.0e-25
WP_085312932.1|2102258_2102537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805400.1|2102533_2102695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309244.1|2102731_2103103_+	hypothetical protein	NA	A0A140HLN4	Bacillus_phage	41.5	2.5e-15
WP_157404886.1|2103121_2103256_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_172805401.1|2103358_2103529_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	69.6	3.9e-08
WP_050000419.1|2103549_2104020_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.8	4.9e-48
WP_085309246.1|2104016_2104559_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	90.6	1.1e-88
WP_085309248.1|2105179_2105629_+	hypothetical protein	NA	A0A288WG64	Bacillus_phage	53.8	5.2e-31
WP_157404887.1|2105660_2105990_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	54.5	7.7e-16
WP_085309250.1|2105976_2106189_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	72.9	2.1e-19
WP_085309252.1|2106470_2106701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309254.1|2106690_2107047_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	56.0	1.6e-30
WP_085309256.1|2107060_2107294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309258.1|2107443_2107824_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	93.7	8.2e-62
WP_085310633.1|2107804_2109577_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	88.1	0.0e+00
WP_085310635.1|2109598_2110816_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	62.5	5.2e-150
WP_157404897.1|2112780_2112984_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_085309276.1|2114407_2114989_+|tail	phage tail protein	tail	A0A1B1P7S4	Bacillus_phage	91.7	7.5e-99
WP_157404898.1|2115056_2115461_+	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	88.4	2.9e-49
WP_085309278.1|2115462_2115603_+	LysR family transcriptional regulator	NA	A0A1B1P7R9	Bacillus_phage	89.1	2.5e-16
WP_085310637.1|2115617_2120627_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	74.3	0.0e+00
WP_085310639.1|2120667_2122155_+|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	78.8	6.1e-238
WP_085310641.1|2122151_2126165_+|tail	tail fiber domain-containing protein	tail	H0USX5	Bacillus_phage	82.0	0.0e+00
WP_085310643.1|2126187_2126637_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	97.3	1.8e-79
WP_085308828.1|2126871_2127831_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	94.0	6.4e-172
WP_085308830.1|2127844_2128126_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	83.9	1.4e-34
WP_085308832.1|2128128_2128341_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	89.7	4.6e-30
WP_085308834.1|2128340_2129126_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7T9	Bacillus_phage	83.1	4.6e-35
WP_085310645.1|2129306_2129510_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	48.4	1.4e-07
WP_085310647.1|2129683_2130001_+	hypothetical protein	NA	H0USY0	Bacillus_phage	99.0	8.3e-52
WP_085310649.1|2129997_2130180_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	83.3	9.7e-21
WP_085310651.1|2130295_2131477_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	7.6e-215
WP_085310653.1|2131418_2132039_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	93.7	2.2e-109
WP_085310655.1|2132048_2132873_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	71.3	2.8e-107
2133218:2133234	attR	GGTCATAGTGTTTCTTA	NA	NA	NA	NA
>prophage 7
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	2227372	2231495	5597907		Caldibacillus_phage(42.86%)	9	NA	NA
WP_085310777.1|2227372_2227759_-	helix-turn-helix transcriptional regulator	NA	A0A290GJU0	Caldibacillus_phage	45.5	4.3e-18
WP_085310779.1|2227931_2228150_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	52.2	5.2e-13
WP_085310781.1|2228163_2228463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085310784.1|2228530_2229046_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	24.0	1.2e-10
WP_002141496.1|2229076_2229298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085310786.1|2229479_2229764_+	hypothetical protein	NA	D2XR42	Bacillus_phage	56.4	3.2e-26
WP_085310788.1|2229881_2230859_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	45.0	1.0e-52
WP_085310791.1|2230869_2231232_+	cell division protein SepF	NA	D2XR47	Bacillus_phage	74.2	5.4e-47
WP_085310793.1|2231303_2231495_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	66.7	1.7e-15
>prophage 8
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	3450384	3498153	5597907	terminase,transposase,capsid,portal,holin	Bacillus_phage(43.48%)	48	NA	NA
WP_172805416.1|3450384_3451236_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.4	3.9e-27
WP_085311986.1|3451519_3452566_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JEZ1	uncultured_Caudovirales_phage	87.6	1.2e-176
WP_000439592.1|3452658_3453147_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_085311987.1|3453327_3454626_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	8.5e-42
WP_085311988.1|3455179_3455638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311989.1|3455647_3456631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311990.1|3456642_3457557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311991.1|3457569_3457959_-	hypothetical protein	NA	G3MAB0	Bacillus_virus	34.8	3.9e-11
WP_085311992.1|3457973_3464621_-	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	34.0	2.3e-50
WP_085311993.1|3464914_3468748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311994.1|3468778_3470515_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	42.6	1.3e-125
WP_085311995.1|3470530_3471862_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	33.3	9.8e-70
WP_085311996.1|3471874_3472252_-	Low copy number virion structural protein	NA	NA	NA	NA	NA
WP_000464270.1|3472265_3472640_-	hypothetical protein	NA	A0A0K2CPN7	Brevibacillus_phage	39.2	2.2e-19
WP_085311997.1|3472684_3473068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311998.1|3473078_3474623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085311999.1|3474619_3475303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312000.1|3475299_3477684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169534.1|3477714_3478119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210326.1|3478097_3478595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118567.1|3478637_3479234_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	29.1	3.4e-14
WP_000208341.1|3479247_3479664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169535.1|3479660_3480077_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002169536.1|3480078_3480405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169537.1|3480433_3480967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000691127.1|3480980_3481145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169538.1|3481161_3482142_-|capsid	phage major capsid protein	capsid	H7BVA6	unidentified_phage	41.4	8.0e-69
WP_085312001.1|3482162_3483353_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	33.7	6.0e-34
WP_085312002.1|3483381_3484722_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002169541.1|3484815_3486072_-|terminase	phage terminase large subunit	terminase	A0A2H4J7G6	uncultured_Caudovirales_phage	52.8	1.0e-116
WP_085312003.1|3486252_3486744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169544.1|3486761_3486947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312005.1|3487473_3487974_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	59.8	4.4e-47
WP_085312006.1|3488244_3488625_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	41.4	1.4e-16
WP_085312007.1|3488688_3488865_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_085312008.1|3488869_3489484_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	30.7	2.0e-09
WP_172805453.1|3489720_3490503_-	ATP-binding protein	NA	U5PWH5	Bacillus_phage	35.6	9.6e-33
WP_000096620.1|3490486_3491251_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	49.2	7.9e-56
WP_085312010.1|3491328_3491607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312011.1|3491676_3491922_-	hypothetical protein	NA	A0A1B1P7U4	Bacillus_phage	62.2	2.0e-24
WP_000549412.1|3492118_3492325_-	transcriptional regulator	NA	W8CYN7	Bacillus_phage	51.7	1.8e-10
WP_002169552.1|3492463_3493108_+	helix-turn-helix domain-containing protein	NA	A0A2H4J245	uncultured_Caudovirales_phage	33.8	1.2e-28
WP_157404914.1|3493531_3494473_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.4	2.9e-39
WP_078175295.1|3494394_3494703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157404915.1|3494770_3496074_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.5	7.0e-28
WP_172805391.1|3496148_3496310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149282397.1|3497302_3497437_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172805433.1|3497433_3498153_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	44.2	3.7e-07
>prophage 9
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	3610077	3618071	5597907	transposase	Bacillus_phage(33.33%)	10	NA	NA
WP_033709367.1|3610077_3610923_-	exonuclease	NA	G3MBN3	Bacillus_virus	27.7	1.8e-13
WP_001179147.1|3611112_3611313_-	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	69.2	2.6e-19
WP_002087724.1|3611531_3612431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062757.1|3612447_3612891_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.0	1.7e-10
WP_157404883.1|3613064_3614418_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	84.4	7.6e-126
WP_000070943.1|3614482_3615103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060749166.1|3615189_3615585_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012261378.1|3615581_3615923_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002128459.1|3616062_3616620_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	51.4	7.6e-40
WP_002137449.1|3616772_3618071_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	8.5e-42
>prophage 10
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	4302809	4345832	5597907	terminase,tail,capsid,head,integrase,portal,protease	Bacillus_phage(89.36%)	61	4304293:4304308	4350526:4350541
WP_002131210.1|4302809_4303460_-	2OG-Fe(II) oxygenase	NA	A0A1V0SIE1	Klosneuvirus	30.4	4.7e-17
WP_002167676.1|4303634_4304006_-	competence protein ComG	NA	NA	NA	NA	NA
WP_085312339.1|4304002_4304335_-	ComGF family competence protein	NA	NA	NA	NA	NA
4304293:4304308	attL	TTTGTCCTAAAAATAG	NA	NA	NA	NA
WP_085312340.1|4305252_4306059_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	89.6	1.1e-148
WP_085312341.1|4306058_4306271_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	94.3	1.3e-32
WP_085312342.1|4306273_4306555_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	5.9e-33
WP_085312343.1|4306568_4307528_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.9	2.1e-175
WP_085310643.1|4307760_4308210_-	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	97.3	1.8e-79
WP_085310639.1|4312242_4313730_-|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	78.8	6.1e-238
WP_085310637.1|4313770_4318780_-|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	74.3	0.0e+00
WP_085309278.1|4318794_4318935_-	LysR family transcriptional regulator	NA	A0A1B1P7R9	Bacillus_phage	89.1	2.5e-16
WP_085312344.1|4318952_4319342_-	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	80.3	1.2e-47
WP_085309276.1|4319409_4319991_-|tail	phage tail protein	tail	A0A1B1P7S4	Bacillus_phage	91.7	7.5e-99
WP_085309274.1|4320004_4320364_-	structural protein	NA	A0A1B1P7S7	Bacillus_phage	93.3	2.5e-60
WP_085312345.1|4320360_4320795_-	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	91.0	3.5e-69
WP_085309270.1|4320782_4321130_-|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	93.9	1.7e-58
WP_085309268.1|4321136_4321388_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	47.1	4.9e-15
WP_157404921.1|4321400_4321652_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_085313001.1|4321680_4322865_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	78.0	5.2e-163
WP_085312346.1|4322888_4323647_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	63.9	8.1e-85
WP_085312347.1|4323624_4324842_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	62.2	8.8e-150
WP_085310633.1|4324863_4326636_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	88.1	0.0e+00
WP_085309258.1|4326616_4326997_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	93.7	8.2e-62
WP_085312348.1|4327146_4327380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170972832.1|4327393_4327759_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	56.0	9.4e-31
WP_085309252.1|4327739_4327970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312350.1|4328252_4328465_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	82.9	2.0e-25
WP_085312351.1|4328451_4328787_-	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	47.7	6.0e-16
WP_085312353.1|4329407_4329950_-|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	90.0	3.8e-89
WP_085312354.1|4329946_4330417_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.8	1.7e-48
WP_172805435.1|4330437_4330608_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	73.2	7.9e-09
WP_085312356.1|4330736_4331033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312357.1|4331112_4331409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805399.1|4332066_4332231_-	hypothetical protein	NA	W8CYP0	Bacillus_phage	84.9	7.6e-17
WP_085312358.1|4332389_4333085_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	79.3	7.3e-109
WP_085312359.1|4333122_4333521_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	74.2	2.1e-52
WP_085313003.1|4333541_4334075_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	54.5	6.1e-47
WP_085312360.1|4334110_4334365_-	hypothetical protein	NA	A0A1B1P779	Bacillus_phage	86.9	1.4e-38
WP_085310015.1|4334467_4334767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085310013.1|4334753_4335023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085310011.1|4335060_4335516_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	1.1e-20
WP_042596972.1|4335605_4335773_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_085312361.1|4335791_4336151_-	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	50.8	1.2e-30
WP_085312362.1|4336143_4336422_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	7.9e-14
WP_085312363.1|4336438_4336633_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	85.9	4.5e-24
WP_085313004.1|4336648_4337512_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.8	5.2e-64
WP_085312364.1|4337462_4338257_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	55.5	1.5e-65
WP_085312365.1|4338258_4338438_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	59.6	1.1e-13
WP_172805436.1|4338467_4338632_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	72.2	3.2e-15
WP_061529637.1|4338644_4338905_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	94.1	1.4e-41
WP_172805437.1|4338925_4339078_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	70.0	1.1e-14
WP_085312366.1|4339119_4339851_-	ORF6C domain-containing protein	NA	A0A1B1P7T7	Bacillus_phage	90.9	1.7e-124
WP_085312367.1|4339813_4340086_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016099708.1|4340249_4340597_+	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	38.3	6.6e-10
WP_085313005.1|4340607_4340790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805438.1|4340936_4341086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313006.1|4341082_4342222_-	hypothetical protein	NA	H0UST6	Bacillus_phage	64.5	8.0e-137
WP_085313007.1|4342720_4343074_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.4	5.9e-22
WP_085312368.1|4343262_4343871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088068512.1|4344209_4344362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312369.1|4344662_4345832_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	37.5	5.4e-64
4350526:4350541	attR	CTATTTTTAGGACAAA	NA	NA	NA	NA
>prophage 11
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	4513265	4576674	5597907	integrase,tRNA,coat,protease	Bacillus_phage(22.22%)	58	4508733:4508750	4560126:4560143
4508733:4508750	attL	ATCAACAGGAAGTGCACC	NA	NA	NA	NA
WP_002015319.1|4513265_4514405_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.8	3.3e-82
WP_002088783.1|4514417_4515470_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_085312424.1|4515489_4515690_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344470.1|4515686_4516688_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	4.0e-07
WP_016096077.1|4516693_4517311_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_002190759.1|4517500_4518445_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002167631.1|4518455_4518971_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_085313009.1|4519559_4519994_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016100589.1|4520026_4520671_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_085312425.1|4520850_4522797_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_002088797.1|4523021_4524128_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_002184918.1|4524158_4524992_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_085312426.1|4525011_4526541_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_002034158.1|4526694_4527837_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.4	1.7e-33
WP_002034157.1|4527836_4528379_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_085312427.1|4528463_4529111_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_085312428.1|4529213_4530065_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_085312429.1|4530162_4532076_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_085312430.1|4532125_4534048_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002015381.1|4534022_4534799_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	4.6e-19
WP_085312431.1|4534892_4535975_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_061689570.1|4535964_4536672_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	5.7e-24
WP_002015378.1|4536843_4538127_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_044442397.1|4538126_4538675_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|4538738_4539029_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002138477.1|4539032_4539377_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4539388_4539697_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_085312432.1|4539867_4541277_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_002088816.1|4541319_4542180_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_002034147.1|4542172_4542919_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000503308.1|4543052_4543850_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002015372.1|4543852_4544539_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002015371.1|4544574_4545120_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_085312433.1|4545134_4545986_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002015369.1|4546027_4547047_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_002169579.1|4547659_4549108_-	serine hydrolase	NA	NA	NA	NA	NA
WP_085312434.1|4549484_4550144_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_085312435.1|4550133_4552245_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085312436.1|4552407_4553760_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_085312437.1|4553772_4554087_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085312438.1|4555202_4555787_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012261761.1|4555837_4556413_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_085312439.1|4556632_4557595_-	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_085312440.1|4557759_4559061_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002129263.1|4559155_4561801_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	2.8e-164
4560126:4560143	attR	GGTGCACTTCCTGTTGAT	NA	NA	NA	NA
WP_085312441.1|4562205_4563231_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_170972587.1|4563303_4564311_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_002034163.1|4564390_4565680_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	35.2	1.3e-05
WP_002015358.1|4565679_4566669_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_085312443.1|4566689_4567442_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_002034194.1|4567444_4568374_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_002015354.1|4568389_4569223_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_002015353.1|4569240_4570572_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002015350.1|4570989_4571442_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002015349.1|4571444_4571861_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002088829.1|4571894_4572491_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002192456.1|4572487_4574818_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	1.5e-177
WP_002015346.1|4575003_4576674_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	6.7e-15
>prophage 12
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	4620157	4627798	5597907		Staphylococcus_phage(16.67%)	10	NA	NA
WP_085312467.1|4620157_4621081_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	9.0e-46
WP_085312468.1|4621206_4622142_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	26.4	1.7e-12
WP_085312469.1|4622143_4622836_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.8e-06
WP_002015431.1|4623006_4623180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014315.1|4623180_4623375_+	YwbE family protein	NA	NA	NA	NA	NA
WP_085312470.1|4623418_4624618_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	4.3e-72
WP_002015426.1|4624865_4625189_+	heme oxygenase	NA	NA	NA	NA	NA
WP_085312471.1|4625258_4626023_-	class B sortase	NA	NA	NA	NA	NA
WP_002088890.1|4626054_4626825_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	4.4e-14
WP_085312472.1|4626814_4627798_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.1	1.1e-17
>prophage 13
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	4878237	4926125	5597907	transposase,tail,capsid,terminase,head,integrase,portal,protease,holin,plate	Bacillus_phage(89.36%)	66	4883772:4883787	4926180:4926195
WP_157404883.1|4878237_4879592_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	84.4	7.6e-126
WP_002129581.1|4879660_4879975_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_085312586.1|4879976_4880672_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_085312587.1|4880668_4881433_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001141371.1|4881615_4882089_-	S-ribosylhomocysteine lyase LuxS	NA	NA	NA	NA	NA
WP_085312588.1|4882217_4882454_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	68.5	1.3e-25
WP_002089163.1|4882450_4883014_-	carbonic anhydrase	NA	NA	NA	NA	NA
4883772:4883787	attL	ATGGAATATGTTCTTC	NA	NA	NA	NA
WP_085312589.1|4884100_4885168_+	cytosolic protein	NA	NA	NA	NA	NA
WP_085309294.1|4885411_4885612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085312935.1|4885618_4885885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085309292.1|4885952_4886486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085312590.1|4887635_4888337_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	87.7	2.7e-119
WP_085309288.1|4888336_4888762_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	88.7	3.4e-64
WP_085309286.1|4888839_4889064_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	95.9	5.4e-29
WP_085312591.1|4889326_4890625_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	2.5e-41
WP_085312592.1|4891185_4892373_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	72.4	1.1e-152
WP_085312593.1|4892375_4894793_-|tail	phage tail protein	tail	A0A1B1P770	Bacillus_phage	88.5	0.0e+00
WP_085312594.1|4894792_4895476_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	85.5	5.3e-112
WP_085312595.1|4895477_4900142_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	86.9	7.9e-215
WP_085312596.1|4900320_4900782_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	90.2	7.3e-73
WP_085312597.1|4900853_4901438_-|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	89.7	9.2e-97
WP_085312598.1|4901439_4901868_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	83.8	4.1e-62
WP_085313016.1|4901854_4902232_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	87.2	1.1e-53
WP_085312599.1|4902248_4902605_-|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	89.0	2.6e-54
WP_085312600.1|4902585_4902882_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	86.7	2.8e-41
WP_085313017.1|4902874_4902970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312601.1|4903022_4904186_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	42.7	1.4e-83
WP_085312602.1|4904228_4904942_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	51.5	2.6e-53
WP_085312603.1|4904928_4906095_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	82.9	4.3e-186
WP_085312604.1|4906109_4907765_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	80.9	4.7e-271
WP_085312605.1|4907757_4908072_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	57.7	1.7e-20
WP_085312606.1|4908178_4908487_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	88.5	8.1e-44
WP_085312607.1|4908489_4908837_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	52.2	1.8e-23
WP_085312608.1|4908839_4909046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312609.1|4909053_4909278_-	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	68.5	1.7e-19
WP_172805439.1|4909289_4909583_-	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	61.0	3.3e-26
WP_085312611.1|4909682_4909919_-	hypothetical protein	NA	Q2I8B4	Bacillus_phage	71.0	1.1e-16
WP_085312612.1|4909972_4910188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050000420.1|4910801_4911344_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	90.0	2.5e-88
WP_050000419.1|4911340_4911811_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.8	4.9e-48
WP_172805440.1|4911831_4912002_-	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	82.1	6.3e-06
WP_002010097.1|4912115_4912238_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_085312613.1|4912908_4913307_+	CHRD domain-containing protein	NA	A0A2K9L200	Tupanvirus	38.8	4.2e-16
WP_078179947.1|4913769_4914027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312614.1|4914500_4915004_-	hypothetical protein	NA	A0A0M4RU27	Bacillus_phage	72.0	4.5e-68
WP_172805454.1|4915043_4915418_-	hypothetical protein	NA	H0USU9	Bacillus_phage	85.6	2.7e-41
WP_085312616.1|4915496_4915742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805441.1|4915773_4915950_-	hypothetical protein	NA	I7ILW5	Bacillus_phage	89.7	1.2e-20
WP_085312617.1|4916028_4916298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312618.1|4916330_4916498_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	85.2	2.0e-20
WP_085312619.1|4916570_4916837_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	87.5	2.9e-37
WP_085312620.1|4916833_4917109_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	51.1	1.2e-17
WP_088024771.1|4917139_4917946_-	ATP-binding protein	NA	D2XQ17	Bacillus_virus	81.3	4.6e-123
WP_085312622.1|4917914_4918739_-	replication protein	NA	W8CYG5	Bacillus_phage	31.7	9.5e-31
WP_085312623.1|4918739_4918928_-	hypothetical protein	NA	A0A1B1P897	Bacillus_phage	48.1	4.8e-07
WP_085312624.1|4919213_4919861_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	84.7	9.5e-103
WP_085312625.1|4919886_4920195_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	91.6	1.3e-41
WP_085310631.1|4920354_4921170_-	ORF6C domain-containing protein	NA	Q3HL19	Bacillus_phage	78.2	1.1e-119
WP_170924938.1|4921207_4921363_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	92.0	8.2e-21
WP_085313018.1|4921387_4921576_-	helix-turn-helix domain-containing protein	NA	A0A0S2GLE9	Bacillus_phage	79.0	2.5e-19
WP_085312626.1|4921589_4921811_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085312627.1|4921995_4922349_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	46.5	1.0e-18
WP_157404922.1|4922399_4922558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805442.1|4922697_4922847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085312628.1|4922846_4924094_-	hypothetical protein	NA	H0UST6	Bacillus_phage	77.6	1.2e-165
WP_085312629.1|4925063_4926125_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	81.9	4.8e-168
4926180:4926195	attR	ATGGAATATGTTCTTC	NA	NA	NA	NA
>prophage 14
NZ_CP020743	Bacillus mycoides strain Gnyt1 chromosome, complete genome	5597907	5352933	5359823	5597907		Enterobacteria_phage(50.0%)	8	NA	NA
WP_085312828.1|5352933_5353926_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.3	2.1e-53
WP_085312829.1|5354018_5354837_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_085312830.1|5354935_5355850_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085312831.1|5355949_5356342_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.0	6.3e-17
WP_085312832.1|5356476_5357508_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	4.0e-79
WP_085312833.1|5357509_5358364_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	39.1	1.1e-37
WP_085312834.1|5358368_5358929_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	47.9	1.1e-41
WP_085312835.1|5358944_5359823_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-107
>prophage 1
NZ_CP020744	Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence	460379	152510	214491	460379	integrase,transposase,tRNA	Bacillus_phage(25.0%)	50	154734:154762	216634:216662
WP_085313123.1|152510_153230_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_085313124.1|154243_154438_+	hypothetical protein	NA	NA	NA	NA	NA
154734:154762	attL	CCCAAAACGAAAAAATGAGCTTTTTTGTT	NA	NA	NA	NA
WP_085313125.1|154900_155089_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_085313126.1|155133_155298_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_172805461.1|156002_156110_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157404945.1|156093_156906_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.6	4.7e-30
WP_085313127.1|157310_159041_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	1.0e-10
WP_085313128.1|159461_160283_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_085313129.1|160356_160863_-	DUF3902 family protein	NA	NA	NA	NA	NA
WP_172805456.1|161397_161559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313130.1|161789_162344_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085313131.1|162490_163918_-	S-layer homology domain-containing protein	NA	G3MAW8	Bacillus_virus	43.6	3.8e-27
WP_085313132.1|164555_166205_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_085312016.1|167942_169247_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.2e-27
WP_085313133.1|171005_172436_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_085313134.1|172755_173208_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_085313135.1|173212_173533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016119277.1|173692_174628_-	EamA family transporter	NA	NA	NA	NA	NA
WP_085313136.1|174724_175471_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_085313137.1|175467_176208_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_085313138.1|177579_178185_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	66.9	7.2e-52
WP_085313139.1|178738_179749_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_085313140.1|179745_180417_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085313141.1|180498_182484_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001244401.1|182473_183241_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	5.5e-33
WP_085313142.1|183524_184007_-	PRK06770 family protein	NA	G3MB13	Bacillus_virus	38.4	2.4e-10
WP_085313143.1|184185_184413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313144.1|184597_185008_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_085313145.1|185639_186959_-	septum formation initiator	NA	NA	NA	NA	NA
WP_085313146.1|187269_188145_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_085313147.1|188166_188865_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_085313148.1|190029_190248_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	54.5	2.3e-13
WP_085313149.1|190589_190886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313150.1|191106_192279_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_085313151.1|192682_193684_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085313152.1|195656_195986_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_085313153.1|196240_196639_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.8e-52
WP_085313154.1|196650_197763_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	46.3	1.1e-79
WP_002191540.1|198690_199908_-	MFS transporter	NA	NA	NA	NA	NA
WP_085313155.1|200052_200508_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085313156.1|200522_201551_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_085313157.1|201561_202470_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085313158.1|202536_204552_-|tRNA	class I tRNA ligase family protein	tRNA	NA	NA	NA	NA
WP_002191545.1|204568_205858_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_016102640.1|205940_206849_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	34.5	7.3e-32
WP_085313159.1|206991_208266_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_078205060.1|208661_209009_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085313160.1|209817_210402_+	SCO family protein	NA	NA	NA	NA	NA
WP_085313161.1|211021_213385_-	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_085313162.1|214089_214491_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	70.5	1.3e-49
216634:216662	attR	CCCAAAACGAAAAAATGAGCTTTTTTGTT	NA	NA	NA	NA
>prophage 2
NZ_CP020744	Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence	460379	222638	273882	460379	integrase,transposase	Bacillus_phage(33.33%)	44	266087:266104	279425:279442
WP_085313166.1|222638_223346_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	3.9e-41
WP_085313167.1|223564_223750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002170592.1|223922_224219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157404946.1|224227_225109_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	1.5e-42
WP_085313168.1|225179_225587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805463.1|225858_226515_-	GAP family protein	NA	NA	NA	NA	NA
WP_085313170.1|226528_227287_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002090702.1|227398_227542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313171.1|228116_228665_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060749739.1|228957_229146_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_085313172.1|229173_229509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085313173.1|230145_230346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313174.1|230387_231068_+	autotransporter	NA	NA	NA	NA	NA
WP_085313175.1|231088_231361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313176.1|231741_233988_-	chitin-binding protein	NA	NA	NA	NA	NA
WP_085313177.1|234071_236312_-	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	44.0	1.7e-10
WP_085313178.1|236917_237577_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	41.5	4.2e-37
WP_085313179.1|238561_239998_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_085312175.1|240385_241663_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085313180.1|243263_245075_-	HBL/NHE enterotoxin family protein	NA	Q38196	Clostridium_botulinum_phage	37.6	1.0e-05
WP_085313181.1|245180_246383_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_085313182.1|246437_247598_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_085313183.1|248297_248624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002204018.1|248650_248848_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313184.1|249258_250686_+	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	22.2	3.3e-07
WP_085313185.1|251369_251558_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_085313186.1|252281_253325_-	Fic family protein	NA	NA	NA	NA	NA
WP_085313187.1|253991_255230_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_085313188.1|256495_256711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959445.1|257406_257766_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.5	9.5e-36
WP_002201236.1|258245_258563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002149609.1|258588_258783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805464.1|260020_260389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063218277.1|260566_260815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063218278.1|260811_262062_-	radical SAM protein	NA	NA	NA	NA	NA
WP_085313190.1|262102_263374_-	MFS transporter	NA	NA	NA	NA	NA
WP_063218280.1|263445_264426_-	radical SAM protein	NA	NA	NA	NA	NA
WP_085313191.1|265186_265984_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
266087:266104	attL	ATATGCATAATTGCATAT	NA	NA	NA	NA
WP_085313192.1|266412_266985_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.4	1.6e-32
WP_085313193.1|267899_268061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313194.1|268083_268521_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_085313195.1|268967_269960_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_085313196.1|269946_270606_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085313197.1|270855_273882_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.3	7.5e-65
279425:279442	attR	ATATGCATAATTGCATAT	NA	NA	NA	NA
>prophage 3
NZ_CP020744	Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence	460379	290106	295191	460379		Bacillus_phage(83.33%)	7	NA	NA
WP_085313211.1|290106_290619_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	81.3	9.9e-71
WP_078205591.1|291873_292062_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	57.1	9.7e-08
WP_078205590.1|292551_292770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313212.1|293095_293866_-	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	44.8	1.4e-47
WP_085313213.1|293867_294053_-	transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	60.7	1.6e-10
WP_085313214.1|294327_294753_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	72.9	2.8e-50
WP_085313215.1|294768_295191_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	70.2	1.5e-51
>prophage 4
NZ_CP020744	Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence	460379	299858	382680	460379	integrase,transposase	Bacillus_phage(39.13%)	63	308087:308106	372595:372614
WP_085313220.1|299858_300566_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.7	3.5e-42
WP_085313221.1|302018_303326_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	7.8e-27
WP_002166777.1|304995_305160_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_085313222.1|305729_306212_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_085313223.1|306251_307361_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_085313225.1|307697_308093_-	DUF4320 family protein	NA	NA	NA	NA	NA
308087:308106	attL	TTTGCATTTCTTACACACCT	NA	NA	NA	NA
WP_085313226.1|308118_308568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313227.1|308584_310078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313228.1|310097_311051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002069459.1|313203_313944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002069458.1|313978_315433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078205620.1|315447_315861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313229.1|317412_318696_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_085313230.1|318885_319278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313231.1|319295_320807_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_085313232.1|321392_323210_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	4.5e-25
WP_076775021.1|324188_326063_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.4	1.5e-36
WP_002166831.1|328475_328676_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002166832.1|328681_328975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313235.1|330258_331185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002069440.1|331654_332602_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157404949.1|332779_333811_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_085313238.1|333807_334863_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_085313239.1|334863_335832_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_085312175.1|336185_337463_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016096929.1|337847_338135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078205634.1|339326_339611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313241.1|339678_339870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313242.1|340617_341004_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_085313243.1|340990_341404_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_172805467.1|343273_343432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313244.1|343765_344719_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	33.0	2.2e-39
WP_172805468.1|344859_345003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313245.1|345943_347653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313246.1|349089_350787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313247.1|351011_351662_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_085313248.1|352498_353611_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	46.3	1.5e-79
WP_085313153.1|353622_354021_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.8e-52
WP_085313249.1|356841_357693_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_085313250.1|360016_360295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002134894.1|361568_361889_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172805416.1|361912_362764_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.5	6.4e-38
WP_085313251.1|362955_363297_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_085313252.1|363293_364559_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.8	8.7e-108
WP_157404950.1|364658_364829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313253.1|364880_365102_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	43.8	1.0e-08
WP_085313254.1|365367_365688_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	66.0	3.7e-31
WP_085313255.1|365703_366870_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	82.7	2.5e-186
WP_085313332.1|366892_367468_+	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	76.2	3.3e-83
WP_085313256.1|367805_368162_+	YxeA family protein	NA	NA	NA	NA	NA
WP_085313257.1|368571_369219_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	32.6	1.2e-15
WP_085313258.1|369693_371118_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060751035.1|371129_371816_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.7e-25
WP_085313259.1|372607_372823_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
372595:372614	attR	AGGTGTGTAAGAAATGCAAA	NA	NA	NA	NA
WP_085313333.1|372953_373196_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_085313260.1|373904_374756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313153.1|374843_375242_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.8e-52
WP_085313261.1|375253_376366_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	46.6	2.3e-80
WP_085313262.1|376844_377321_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	45.3	1.6e-30
WP_085313263.1|378039_379368_+	nucleotide sugar dehydrogenase	NA	M1H5A7	Paramecium_bursaria_Chlorella_virus	29.6	5.3e-39
WP_085313264.1|379376_380534_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.1	1.5e-42
WP_085313265.1|380540_381464_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.0	7.9e-26
WP_085313266.1|381438_382680_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2P1ELT3	Moumouvirus	34.4	4.5e-16
>prophage 5
NZ_CP020744	Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence	460379	392899	433183	460379	protease,transposase	Bacillus_phage(33.33%)	35	NA	NA
WP_001011319.1|392899_393427_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_085313275.1|393563_394337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002090450.1|395192_395540_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	35.3	2.5e-09
WP_085313276.1|395773_396181_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000787545.1|396170_396584_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_085313277.1|397096_398833_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	5.9e-14
WP_085313278.1|398992_399208_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	64.2	2.2e-16
WP_085313279.1|399354_399747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170972676.1|399860_399971_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_085313280.1|400313_401393_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	31.8	4.9e-19
WP_085313281.1|401398_401800_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	72.7	3.1e-51
WP_157404954.1|402060_403062_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.0	4.4e-22
WP_085313283.1|403651_403903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313284.1|403972_405139_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.5	6.1e-23
WP_085313285.1|405232_407317_+	serine hydrolase	NA	NA	NA	NA	NA
WP_085313335.1|407557_407680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805469.1|408021_409221_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.5	8.7e-25
WP_085313287.1|409571_410996_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	2.1e-25
WP_085313288.1|410988_411654_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.4e-35
WP_172805470.1|411822_411978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313289.1|413514_415878_+	S8 family serine peptidase	NA	G1FGA4	Mycobacterium_phage	47.8	5.7e-12
WP_085313290.1|416900_417263_+	cell division protein SepF	NA	D2XR47	Bacillus_phage	87.5	3.0e-53
WP_085313292.1|417727_418327_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_085313293.1|418519_418768_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	93.9	1.7e-36
WP_085313294.1|419485_419779_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313295.1|420500_421871_+	lytic polysaccharide monooxygenase	NA	G1FGA4	Mycobacterium_phage	36.1	6.5e-08
WP_085313153.1|422216_422615_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.8e-52
WP_085313296.1|422626_423739_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.0	6.3e-78
WP_085313297.1|424331_425078_+	zeta toxin family protein	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	38.1	3.7e-34
WP_085313298.1|425645_426569_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_033707385.1|426643_427006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002069055.1|427207_427699_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_085313299.1|427781_427982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313300.1|430358_431672_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_087943055.1|431853_433183_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.7	2.6e-30
>prophage 1
NZ_CP020745	Bacillus mycoides strain Gnyt1 plasmid unnamed2, complete sequence	114265	34886	100352	114265	transposase,integrase	Bacillus_phage(57.14%)	52	32525:32540	47351:47366
32525:32540	attL	CAGGTCGCCAAACTCA	NA	NA	NA	NA
WP_085313366.1|34886_35837_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	45.1	3.5e-69
WP_085313367.1|36079_37246_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_085313368.1|37270_37690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313369.1|37745_38330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313370.1|38649_38871_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313371.1|38908_39127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313372.1|39141_39798_-	replication-relaxation family protein	NA	A0A1B1P7T2	Bacillus_phage	66.2	2.0e-79
WP_085313373.1|39781_40954_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	71.9	2.4e-160
WP_085313374.1|40960_41284_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	67.3	6.8e-33
WP_085313375.1|41295_41712_-	hypothetical protein	NA	A0A1B1P7T3	Bacillus_phage	73.8	1.3e-49
WP_085308762.1|42080_43310_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	1.7e-84
WP_085313376.1|43858_44716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313377.1|45192_45549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313428.1|45629_46133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313378.1|46420_46888_-	LacI family transcriptional regulator	NA	A0A0N6W8H7	Bacillus_phage	28.5	1.4e-07
WP_085313379.1|47054_47294_-	DUF3961 domain-containing protein	NA	NA	NA	NA	NA
WP_085313380.1|47390_47558_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
47351:47366	attR	TGAGTTTGGCGACCTG	NA	NA	NA	NA
WP_085313381.1|47664_48105_-	sporulation protein	NA	F8WPS9	Bacillus_phage	51.8	2.7e-32
WP_085313382.1|49216_51226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313383.1|52382_53378_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_085313384.1|54056_55058_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	56.1	4.6e-88
WP_085313385.1|55408_63031_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	1.0e-139
WP_085313386.1|64124_64697_+	methyltransferase	NA	NA	NA	NA	NA
WP_085313387.1|65100_66501_+	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_085313388.1|67394_68522_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_085313389.1|68521_71125_-	endospore germination permease	NA	NA	NA	NA	NA
WP_085313390.1|71620_72664_+	Fic family protein	NA	NA	NA	NA	NA
WP_085313391.1|73496_75140_-	pesticidial crystal protein	NA	NA	NA	NA	NA
WP_085313392.1|75207_77142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313393.1|77181_80163_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.7	1.1e-257
WP_000690668.1|80175_80727_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	3.2e-43
WP_085313394.1|81319_83296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805479.1|83363_84947_+	pesticidial crystal protein	NA	NA	NA	NA	NA
WP_157404955.1|85592_85847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313396.1|86312_86954_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	34.5	2.8e-14
WP_085313397.1|87330_87543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805475.1|88018_88369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313399.1|88740_89646_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_085313400.1|90014_90323_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_085313401.1|90391_90682_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313402.1|91225_91666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313403.1|93138_93552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313404.1|93582_93894_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_085313405.1|94365_94797_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_085313406.1|96236_96545_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_085313407.1|96616_96907_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313408.1|96981_97215_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_085313409.1|97256_97565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157404956.1|97580_97847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313411.1|97913_98147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313429.1|98294_98894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157404958.1|98997_100352_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	84.4	7.6e-126
>prophage 1
NZ_CP020749	Bacillus mycoides strain Gnyt1 plasmid unnamed6, complete sequence	64682	3681	54044	64682	terminase,transposase,holin,portal,capsid	Bacillus_phage(50.0%)	57	NA	NA
WP_002141558.1|3681_4179_+|holin	phage holin family protein	holin	A0A0M4R5G6	Bacillus_phage	44.9	6.6e-27
WP_085313657.1|4259_5318_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	72.9	4.6e-147
WP_172805493.1|5377_5515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313658.1|5516_6605_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.1	2.2e-75
WP_085313659.1|6894_7635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313661.1|8152_8389_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	48.1	1.2e-15
WP_002167225.1|8483_8723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313662.1|8712_9723_-	plasmid segregation protein ParM	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	28.0	4.1e-28
WP_085313663.1|9916_10531_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_085313664.1|10837_11047_+	preprotein translocase	NA	NA	NA	NA	NA
WP_085313667.1|12826_14038_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_085313706.1|14891_15395_-	ribonuclease	NA	NA	NA	NA	NA
WP_085313668.1|15749_16094_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAY7	uncultured_Caudovirales_phage	35.0	4.7e-08
WP_085313669.1|16689_17877_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	48.5	2.9e-89
WP_172805492.1|17896_18037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099889.1|19796_19976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001213815.1|19996_20335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313707.1|20569_20758_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085313670.1|20833_21508_+	Rha family transcriptional regulator	NA	A0A0U4IS08	Exiguobacterium_phage	41.5	1.0e-35
WP_001121080.1|21531_21894_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	66.9	1.3e-40
WP_085313671.1|21916_22264_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	59.3	3.0e-26
WP_085313672.1|22433_22934_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	70.6	3.1e-61
WP_085313673.1|22902_23319_+	cell division protein SepF	NA	A0A0S2MVI0	Bacillus_phage	62.8	5.8e-45
WP_085313674.1|23321_23789_+	hypothetical protein	NA	A0A0S2MVB7	Bacillus_phage	48.4	3.3e-36
WP_085313675.1|23995_24277_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	56.1	2.4e-18
WP_085313676.1|24273_24723_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	80.7	8.2e-69
WP_085313677.1|24719_25298_+	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	80.3	7.2e-86
WP_085313678.1|25314_25824_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	91.7	1.4e-80
WP_085313679.1|25807_26380_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	81.6	3.0e-84
WP_085313680.1|26551_26770_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	42.9	4.7e-06
WP_085313681.1|27107_27443_+	DUF3307 domain-containing protein	NA	D2XQ28	Bacillus_virus	90.1	2.0e-51
WP_085313682.1|27823_28354_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	87.1	1.1e-83
WP_170969889.1|28353_28689_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_085313683.1|28836_29337_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	83.0	1.4e-72
WP_085313684.1|29861_30263_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	53.3	1.0e-06
WP_061129717.1|30409_30985_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	44.1	5.1e-31
WP_085313685.1|30984_31407_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_085311987.1|31949_33248_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	8.5e-42
WP_000390758.1|33530_33710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313686.1|33731_34559_+|terminase	terminase	terminase	A0A1L2JY44	Aeribacillus_phage	37.7	1.1e-34
WP_085313687.1|34551_35829_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	64.2	6.8e-153
WP_085313688.1|35898_37380_+|portal	phage portal protein	portal	Q9HH53	Methanothermobacter_phage	29.6	1.5e-31
WP_085313689.1|37493_38012_+|capsid	minor capsid protein	capsid	Q1WDG7	Streptomyces_phage	34.4	4.9e-09
WP_085313690.1|38125_39328_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	40.9	6.6e-57
WP_085313709.1|39357_40335_+|capsid	major capsid protein	capsid	H7BVA6	unidentified_phage	44.5	1.5e-70
WP_002135994.1|40505_40670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313691.1|40669_41206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313692.1|41202_41574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313693.1|41580_41991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313694.1|41995_42418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313695.1|42430_43033_+	hypothetical protein	NA	D3W0E4	Lactococcus_phage	28.0	7.0e-15
WP_085313696.1|43090_43609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313697.1|43572_43995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172805479.1|46278_47862_-	pesticidial crystal protein	NA	NA	NA	NA	NA
WP_085313394.1|47929_49906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000690668.1|50498_51050_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	3.2e-43
WP_085313393.1|51062_54044_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.7	1.1e-257
>prophage 1
NZ_CP020750	Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence	51563	115	50939	51563	terminase,holin,portal,capsid,tail	Bacillus_phage(78.33%)	75	NA	NA
WP_172805495.1|115_253_-	hypothetical protein	NA	A0A1B1P8A8	Bacillus_phage	75.0	6.8e-11
WP_172805494.1|269_494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313710.1|520_1315_-	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	52.3	1.1e-68
WP_085313711.1|1380_1578_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P8C7	Bacillus_phage	95.4	8.9e-28
WP_085313712.1|1791_2139_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P8C2	Bacillus_phage	94.8	5.4e-52
WP_170972591.1|2144_2282_-	hypothetical protein	NA	A0A0S2MVE3	Bacillus_phage	88.9	3.0e-14
WP_170972590.1|2428_2584_-	hypothetical protein	NA	A0A1B1P8B4	Bacillus_phage	73.1	1.8e-12
WP_085313713.1|2580_3807_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	90.0	2.1e-207
WP_085313714.1|4366_4684_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	91.9	4.0e-46
WP_085313715.1|4999_6133_+	excalibur calcium-binding domain-containing protein	NA	A0A0A7AR49	Bacillus_phage	46.6	5.3e-40
WP_085313716.1|6394_7066_-	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	43.7	9.1e-40
WP_085313717.1|8656_9604_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.4	2.9e-31
WP_085313778.1|9587_9839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313718.1|9871_10156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085313719.1|10309_10900_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.7	2.3e-10
WP_085313720.1|10991_11246_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	43.2	9.7e-11
WP_085313721.1|11727_12792_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	93.5	2.3e-194
WP_085313722.1|12788_13028_-|holin	holin	holin	A0A0A7AR38	Bacillus_phage	73.4	6.1e-23
WP_085313723.1|13029_13263_-	hemolysin XhlA family protein	NA	A0A1B1P887	Bacillus_phage	84.4	1.3e-25
WP_085313724.1|13300_18034_-|tail	phage tail protein	tail	D2XR28	Bacillus_phage	51.5	0.0e+00
WP_085313725.1|18033_19512_-|tail	phage tail family protein	tail	A0A1B1P894	Bacillus_phage	88.6	8.5e-264
WP_085313726.1|22621_23269_-	hypothetical protein	NA	D2XPZ3	Bacillus_virus	56.9	2.9e-59
WP_085313727.1|23268_23670_-	DUF1892 domain-containing protein	NA	A0A1B1P876	Bacillus_phage	66.9	1.1e-40
WP_085313779.1|23765_24203_-|capsid	capsid protein	capsid	I1TLE8	Bacillus_phage	60.8	2.6e-43
WP_085313728.1|24228_24651_-|capsid	minor capsid protein	capsid	A0A1B1P879	Bacillus_phage	80.0	4.2e-59
WP_085313729.1|24661_25012_-|capsid	minor capsid protein	capsid	A0A1B1P872	Bacillus_phage	75.0	1.8e-47
WP_085313730.1|25008_25344_-|capsid	minor capsid protein	capsid	A0A1B1P893	Bacillus_phage	46.4	4.7e-21
WP_085313731.1|25336_25738_-	hypothetical protein	NA	A0A1B1P889	Bacillus_phage	52.3	1.5e-29
WP_085313732.1|25746_26025_-	hypothetical protein	NA	A0A1B1P891	Bacillus_phage	88.9	9.6e-20
WP_085313733.1|26077_26980_-|capsid	capsid protein	capsid	A0A1B1P885	Bacillus_phage	96.0	1.0e-163
WP_085313734.1|27006_27639_-	hypothetical protein	NA	A0A1B1P865	Bacillus_phage	88.6	3.4e-81
WP_085313735.1|27650_28772_-|capsid	phage minor capsid protein	capsid	B5LPR2	Bacillus_virus	94.6	3.8e-192
WP_085313736.1|28771_30274_-|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	87.2	5.2e-245
WP_085313737.1|30286_31564_-|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	84.7	2.4e-222
WP_085313738.1|31544_32333_-	hypothetical protein	NA	D2XPX8	Bacillus_virus	86.8	6.6e-114
WP_085313739.1|32383_32614_-	hypothetical protein	NA	A0A1B1P862	Bacillus_phage	78.6	6.5e-22
WP_085313740.1|32600_32972_-	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	68.8	6.4e-27
WP_085313741.1|33011_33260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313742.1|33859_34084_-	hypothetical protein	NA	A0A0A7AR10	Bacillus_phage	62.2	3.7e-06
WP_085313743.1|34176_34560_-	hypothetical protein	NA	A0A1B1P874	Bacillus_phage	85.8	4.1e-53
WP_085313780.1|34587_34797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157404967.1|34918_35134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313746.1|36152_36350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313747.1|36388_36772_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	44.1	4.4e-23
WP_085313748.1|36911_37100_-	hypothetical protein	NA	B5LPP9	Bacillus_virus	65.6	3.9e-17
WP_085313749.1|37113_37536_-	DUF1064 domain-containing protein	NA	A0A1B1P859	Bacillus_phage	90.7	4.1e-70
WP_172805496.1|37552_37726_-	hypothetical protein	NA	A0A1B1P875	Bacillus_phage	87.7	6.4e-22
WP_085313751.1|37755_38178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313752.1|38280_38514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313781.1|38550_38757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313753.1|39002_39401_-	hypothetical protein	NA	A0A2H4J3B9	uncultured_Caudovirales_phage	61.1	5.8e-18
WP_085313755.1|39846_40257_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	55.1	1.2e-34
WP_085313756.1|40285_40690_-	hypothetical protein	NA	H0USU9	Bacillus_phage	73.1	1.0e-49
WP_085313757.1|40726_40969_-	hypothetical protein	NA	A0A1B1P7A3	Bacillus_phage	82.1	6.4e-36
WP_085313758.1|40989_41358_-	spore protein H	NA	NA	NA	NA	NA
WP_085309233.1|41528_41894_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	61.2	4.1e-34
WP_085313759.1|41933_42437_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A0U3SLD3	Bacillus_phage	62.9	5.2e-48
WP_085313760.1|42414_42624_-	hypothetical protein	NA	A0A1B1P8E4	Bacillus_phage	93.7	3.6e-27
WP_085313761.1|42636_42888_-	glutaredoxin family protein	NA	A0A0U3TI10	Bacillus_phage	53.0	2.8e-18
WP_085313762.1|42972_43206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313763.1|43273_43468_-	hypothetical protein	NA	A0A1B1P7U9	Bacillus_phage	71.9	1.3e-18
WP_085313764.1|43464_43974_-	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	29.7	3.1e-08
WP_085313765.1|43960_44104_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_085313766.1|44740_45190_-	nucleoside permease	NA	A0A1B1P8B9	Bacillus_phage	39.6	4.9e-21
WP_085313767.1|45201_45471_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	61.8	5.3e-23
WP_085313768.1|45467_45755_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	42.1	8.2e-14
WP_085313769.1|45723_45933_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	6.8e-18
WP_085313770.1|45947_46706_-	ATP-binding protein	NA	U5PWH5	Bacillus_phage	40.3	1.6e-37
WP_085313771.1|46689_47559_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A218KCJ2	Bacillus_phage	32.7	1.7e-38
WP_085313772.1|47559_47802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805497.1|47802_47973_-	hypothetical protein	NA	A0A1B1P897	Bacillus_phage	42.0	2.0e-07
WP_085313773.1|47969_48935_-	recombinase RecT	NA	A0A0C5AEC1	Paenibacillus_phage	42.6	9.4e-54
WP_046944911.1|48927_49158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085313774.1|49150_50683_-	AAA family ATPase	NA	A0A2I7SC81	Paenibacillus_phage	38.4	5.4e-80
WP_085313775.1|50666_50939_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	53.8	2.3e-18
