The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020776	Campylobacter jejuni strain YH002 chromosome, complete genome	1774584	189699	198254	1774584	transposase	Streptococcus_phage(50.0%)	9	NA	NA
WP_001129922.1|189699_190074_+	TnpV protein	NA	D0R0F4	Streptococcus_phage	96.8	6.6e-64
WP_002915791.1|190440_192360_+	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	98.4	0.0e+00
WP_002779755.1|192411_192585_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
WP_153604878.1|192788_192935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032588198.1|192959_194228_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5RFS3	Helicobacter_phage	62.6	1.2e-141
WP_002782963.1|194238_194877_-|transposase	IS607-like element ISChh1 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	86.8	1.6e-97
WP_002915799.1|195463_195811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070307680.1|195945_197073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014516681.1|197072_198254_+	AAA family ATPase	NA	A0A127AWE7	Bacillus_phage	34.0	6.5e-49
>prophage 2
NZ_CP020776	Campylobacter jejuni strain YH002 chromosome, complete genome	1774584	1369136	1448953	1774584	tRNA,transposase,terminase,plate,integrase,tail	Campylobacter_phage(48.65%)	87	1396417:1396436	1453874:1453893
WP_002858276.1|1369136_1370144_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	37.3	9.2e-44
WP_002915833.1|1370140_1371535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002853864.1|1371536_1372607_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002858027.1|1372603_1373329_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002852397.1|1373337_1373676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858307.1|1373677_1374985_-	fibronectin-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002858185.1|1375046_1375622_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_002858083.1|1375618_1376608_+	phospholipase	NA	NA	NA	NA	NA
WP_002858230.1|1376693_1377662_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	47.2	1.1e-73
WP_002854141.1|1377654_1378593_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002858409.1|1378589_1379345_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	32.1	1.4e-20
WP_002858458.1|1379329_1380349_+	enterochelin ABC transporter substrate-binding protein CeuB	NA	NA	NA	NA	NA
WP_002855904.1|1380574_1381129_-	membrane protein	NA	NA	NA	NA	NA
WP_002858075.1|1381264_1383097_-	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
WP_010891930.1|1383111_1383627_-	cytochrome c nitrite reductase small subunit	NA	NA	NA	NA	NA
WP_002858229.1|1383815_1385900_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_002859649.1|1386343_1386796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002856258.1|1386844_1387852_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	34.2	3.4e-06
WP_002856044.1|1387855_1388899_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002857888.1|1388928_1390320_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_002915837.1|1390375_1393501_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_002858421.1|1393503_1395300_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	36.7	2.9e-93
WP_002858387.1|1395304_1397653_-	nucleotidyltransferase	NA	NA	NA	NA	NA
1396417:1396436	attL	GAAAAACTTGCTCATCAAAA	NA	NA	NA	NA
WP_002858079.1|1397796_1398861_+	aminofutalosine synthase MqnE	NA	NA	NA	NA	NA
WP_002856518.1|1398870_1400190_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.3	1.6e-51
WP_002852389.1|1400203_1400647_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002853724.1|1400691_1401390_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_002852394.1|1401399_1401969_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002858465.1|1401968_1404440_+	RND family transporter	NA	NA	NA	NA	NA
WP_002853680.1|1404470_1405073_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	29.7	1.0e-10
WP_002857990.1|1405239_1406535_+	MFS transporter	NA	NA	NA	NA	NA
WP_002908983.1|1407313_1409011_+	AAA family ATPase	NA	X2KLG0	Campylobacter_phage	38.3	1.9e-89
WP_002865000.1|1409788_1410109_+	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_002875224.1|1410118_1410313_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	98.4	5.1e-28
WP_002873745.1|1410392_1410680_+	hypothetical protein	NA	A7YG83	Campylobacter_phage	100.0	3.0e-48
WP_002922158.1|1410707_1411523_-	DNA adenine methylase	NA	A7YG95	Campylobacter_phage	100.0	6.3e-152
WP_002922157.1|1411627_1412116_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	99.4	5.9e-89
WP_002875579.1|1412119_1414342_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	100.0	0.0e+00
WP_002784655.1|1414383_1414689_+	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
WP_002843342.1|1414800_1415040_-|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	62.5	3.2e-11
WP_002865376.1|1415192_1415702_-|tail	tail protein	tail	A7YG76	Campylobacter_phage	100.0	3.3e-90
WP_002922156.1|1415728_1416922_-|tail	tail sheath protein	tail	A7YGA3	Campylobacter_phage	100.0	5.0e-198
WP_002922154.1|1416940_1417948_-	hypothetical protein	NA	A7YGT6	Campylobacter_phage	100.0	7.7e-192
WP_002922150.1|1418047_1418419_-	DUF1353 domain-containing protein	NA	A7YGA5	Campylobacter_phage	100.0	8.8e-69
WP_002875277.1|1418415_1418922_-	DUF4376 domain-containing protein	NA	A7YGA6	Campylobacter_phage	100.0	2.0e-87
WP_052797177.1|1418946_1419978_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	99.7	4.3e-190
WP_002855112.1|1419977_1420598_-|tail	phage tail protein I	tail	A7YH02	Campylobacter_phage	100.0	8.7e-61
WP_002876444.1|1420594_1421761_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.6	3.0e-14
WP_002795239.1|1421757_1422048_-|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002784486.1|1422044_1422236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876443.1|1422244_1422877_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.6	1.7e-08
WP_002784492.1|1422876_1423191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|1423302_1423551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002854893.1|1423547_1423889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002922136.1|1423899_1424289_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.7	2.2e-22
WP_002784501.1|1424437_1424872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876306.1|1424873_1425689_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002875114.1|1425691_1426219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876307.1|1426221_1427199_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	5.6e-06
WP_002855185.1|1427314_1427773_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002803360.1|1427765_1428365_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002875116.1|1428364_1430035_+|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.4	3.0e-92
WP_002872709.1|1430044_1431415_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
WP_002909482.1|1431416_1432655_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.8	1.9e-19
WP_002876309.1|1432780_1433155_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002784520.1|1433147_1433339_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002872707.1|1433332_1434310_+|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_002872706.1|1434274_1435066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002872705.1|1435052_1435259_-	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	100.0	2.8e-32
WP_002784523.1|1435380_1435665_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002876312.1|1435758_1436430_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002873721.1|1436421_1436697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876315.1|1436743_1437193_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002876316.1|1437189_1437882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1437881_1438151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085105329.1|1438147_1439110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002922653.1|1439168_1439654_-	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	8.4e-19
WP_002791419.1|1439760_1440102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002824157.1|1440160_1440346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002795448.1|1440342_1440534_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002806833.1|1440536_1441460_-	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	3.9e-09
WP_002876259.1|1441530_1443606_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002804142.1|1443602_1443803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002804144.1|1443952_1444627_+	LexA family transcriptional regulator	NA	X2KRC9	Campylobacter_phage	32.1	9.8e-26
WP_002804146.1|1444626_1445325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002857979.1|1445891_1447553_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_002858009.1|1447630_1448953_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
1453874:1453893	attR	GAAAAACTTGCTCATCAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP020776	Campylobacter jejuni strain YH002 chromosome, complete genome	1774584	1491167	1497811	1774584		Tupanvirus(16.67%)	9	NA	NA
WP_002916660.1|1491167_1491842_-	NTP transferase domain-containing protein	NA	A0A2K9L821	Tupanvirus	26.1	3.5e-07
WP_002916658.1|1491829_1492435_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.0	6.3e-16
WP_002858413.1|1492422_1493442_-	D-glycero-D-manno-heptose 7-phosphate kinase	NA	A0A222YW25	Synechococcus_phage	40.7	2.7e-59
WP_002857889.1|1493461_1494313_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_002858299.1|1494331_1495273_-	NAD-dependent epimerase/dehydratase	NA	A0A0F7LC08	uncultured_marine_virus	46.1	1.0e-73
WP_002864205.1|1495296_1496337_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	44.4	1.7e-69
WP_002858231.1|1496336_1496960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858116.1|1496956_1497262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858190.1|1497265_1497811_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	32.4	6.1e-18
