The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	0	71907	4142593	transposase,integrase,holin	Bacillus_phage(50.0%)	56	21460:21519	48025:49310
WP_162287120.1|174_654_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_162287121.1|788_1163_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_014479963.1|4580_4973_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_041516452.1|8520_16224_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.1	1.9e-149
WP_033881989.1|16598_18074_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_014479967.1|18107_19085_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_004399508.1|19218_20610_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014479968.1|20896_21442_+	DL-endopeptidase inhibitor IseA	NA	NA	NA	NA	NA
21460:21519	attL	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATT	NA	NA	NA	NA
WP_087614160.1|21553_22703_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003231473.1|22949_23495_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
WP_003231472.1|23811_24042_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_014479969.1|24226_25990_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_014479970.1|26151_27009_-	LysR family transcriptional regulator YofA	NA	Q6JIH3	Burkholderia_virus	35.0	4.5e-07
WP_014479971.1|27136_28126_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_014479972.1|28181_29663_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
WP_014479973.1|29679_34242_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_004399246.1|34387_35290_+	glutamate biosynthesis transcriptional regulator GltC	NA	NA	NA	NA	NA
WP_003220337.1|37382_37751_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
WP_014479980.1|38049_38766_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
WP_017697324.1|38916_39225_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_014479982.1|39291_40062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479983.1|40105_40639_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014479985.1|40778_41771_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014479986.1|41764_42511_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014479987.1|42520_43459_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	6.1e-26
WP_014479988.1|43474_44026_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033880940.1|44421_45666_-	MFS transporter	NA	NA	NA	NA	NA
WP_031600262.1|45764_47012_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_142767572.1|47013_47283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881179.1|47462_47759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|48118_49268_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_052006227.1|49309_49549_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
48025:49310	attR	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATTGTTATCCGAAATTAGACTTGGAGGTGTTTTTTCTATGGGGACAAGAGTGAGTTATCCGGTTGAAGTGAAACAGAAGGCTGTAGAAATGAGATTGGCAGGCGTACCTATGAAAGAGATCATGCAGGAGTTGAATATCAAAAATAATACGCAGATTAAGACATGGGTCAGATGGTATAAGGCTGGTGATACACATCGATTTGAACAGCCTGTTGGTAAGCAATACACTTATGGAAAAGGTCCGGAGTATTCTTCCGAATTAGAGAAACTGCAGGCAGAGAATCGATATCTGAGACAACAGAATGAAGTGTTAAAAAAGTACAACGAATTGGAAAGGAAGTTGATAGCCAAACGTCAGTCGAACTTGTAGAAGAATTGCACAGCACAATGACCGTGCAGGATATCTGTATTCATTTAGGTATCTCTCGCTCGTCTTATTATCGTTGGAAGAAGAATCTGAAGAAAGATCATCCCAAGCGCCATTTAGAAAAACAAATCGGCACGTTGTGCCGAGAGCACCAGTATCGATATGGATATCGAAAAATCACAGCTATATTAAAAAAGAGAATGTGTATTAACCATAAAACGGTTCAGCGTATTATGCAGAAAAATCAGTGGCAGTGCCGGGTTAAGGTGAAAAAGCGCAAGAAGAATGGGCAGCCATATGCCGTGGTCGACAATATATTAGATAGGAACTTTCAGTCTGATCATCCTCTTGAAAAACTAGTAACAGACATCACGTATTTGCCTTATGGACAGAAACAATTGTACCTTTCCAGTATATTGGATGTATATAATGGAGAAGTGATTGCTTTTACGATTGGAGATAAGCAGGACACAGACTTTGTCTTACACACACTTGATCAACTGCCAACACTGCCTGAGAACTGCGTGTTACATAGTGACCAAGGATCTGTGTATACATCTTACGAGTATCAGAAAGCTGTTAAAACAAAAGGCATTACCATGAGCATGTCCCGCAAAGGGACACCCGCTGATAATGCCTCCATCGAATCGTTTCATTCCTCACTAAAGTCTGAAACGTTCTATCTTAACAGCATTGATCGAACCACGACCGCCATCGTAGAACGCACTGTCATAGAATACATTCATTATTATAACAATATTCGTATTCAAACGAAACTAAACAACCAATCACCGATAAATTATCGGCAATTGGCTGTTTAAAAGGTGTTTTGATCCCTGTCTCAAAAACGGGGGTCAGTCCC	NA	NA	NA	NA
WP_033881696.1|49585_49819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|50278_51526_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033881211.1|51598_51742_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	92.5	9.6e-16
WP_033881213.1|51978_52230_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
WP_033881218.1|52598_54026_-	serine hydrolase	NA	NA	NA	NA	NA
WP_033881214.1|54159_54390_+	membrane protein	NA	NA	NA	NA	NA
WP_033881215.1|54399_54792_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
WP_087614174.1|54836_55061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837923.1|55095_55449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592540.1|55567_56212_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_031601042.1|56425_57550_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_052006225.1|57909_59055_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
WP_033881552.1|59059_59890_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080480860.1|59901_61134_-	MFS transporter	NA	NA	NA	NA	NA
WP_031600262.1|61217_62465_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033881859.1|64671_65031_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|65290_65374_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_014479996.1|65662_66196_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
WP_014479997.1|66255_66810_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
WP_014479998.1|66865_67324_-	hypothetical protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
WP_003231326.1|67416_67875_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_014479999.1|67884_69687_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_029318053.1|69785_70343_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
WP_121509415.1|70470_71907_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 2
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	76007	78920	4142593		Streptococcus_phage(100.0%)	4	NA	NA
WP_033881863.1|76007_76946_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	26.0	9.2e-06
WP_014480010.1|77152_77698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231284.1|77724_78048_-	Zn(II)-responsive metalloregulatory transcriptional repressor CzrA	NA	NA	NA	NA	NA
WP_014480011.1|78242_78920_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	7.6e-18
>prophage 3
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	85851	88738	4142593		Bacillus_phage(50.0%)	2	NA	NA
WP_014480017.1|85851_86715_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.7	3.1e-32
WP_014480018.1|86962_88738_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.7	1.8e-79
>prophage 4
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	97019	97856	4142593		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_014480023.1|97019_97856_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	1.4e-34
>prophage 5
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	106717	111211	4142593		Halovirus(33.33%)	4	NA	NA
WP_072592545.1|106717_107632_-	MoxR family ATPase	NA	R4TG24	Halovirus	27.6	3.0e-09
WP_004399243.1|107695_108286_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_014480030.1|108378_109623_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	1.0e-15
WP_014480031.1|109993_111211_-	hypothetical protein	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.7	1.1e-11
>prophage 6
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	121484	122634	4142593	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_087614160.1|121484_122634_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 7
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	128797	129619	4142593		Freshwater_phage(100.0%)	1	NA	NA
WP_014480046.1|128797_129619_-	LD-carboxypeptidase LdcB	NA	A0A1B0XTX0	Freshwater_phage	33.1	8.9e-05
>prophage 8
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	145854	146880	4142593		Catovirus(100.0%)	1	NA	NA
WP_003230816.1|145854_146880_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.0	5.9e-38
>prophage 9
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	156432	157615	4142593		Bacillus_virus(100.0%)	2	NA	NA
WP_014480071.1|156432_156939_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	49.1	4.2e-37
WP_014480072.1|157081_157615_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.9	2.0e-50
>prophage 10
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	163018	163636	4142593		Pandoravirus(100.0%)	1	NA	NA
WP_014480078.1|163018_163636_-	Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase	NA	S4W232	Pandoravirus	27.4	3.1e-10
>prophage 11
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	167001	170982	4142593		Lactococcus_phage(50.0%)	9	NA	NA
WP_003230776.1|167001_167202_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	4.2e-17
WP_003230774.1|167253_167436_-	transcriptional regulator DegR	NA	NA	NA	NA	NA
WP_004398863.1|167591_167861_+	DUF2564 family protein	NA	NA	NA	NA	NA
WP_004399003.1|167888_168071_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_014480081.1|168063_168744_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_014480082.1|168826_169516_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_014480083.1|169515_169914_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_014480084.1|169955_170084_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_003230763.1|170091_170982_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	3.2e-24
>prophage 12
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	186583	188509	4142593		Streptomyces_phage(100.0%)	1	NA	NA
WP_014477152.1|186583_188509_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	23.3	1.0e-11
>prophage 13
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	193678	195928	4142593		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014480101.1|193678_195928_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.3	3.0e-10
>prophage 14
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	199898	200519	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014480105.1|199898_200519_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	9.4e-23
>prophage 15
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	204529	216170	4142593	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_004398499.1|204529_205228_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	4.3e-24
WP_004398777.1|205321_206614_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	1.7e-58
WP_003230667.1|206757_207939_-	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_014477164.1|207961_208447_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_003225588.1|208455_208626_-	YpmA family protein	NA	NA	NA	NA	NA
WP_014480106.1|208768_211564_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	6.5e-55
WP_003225586.1|211689_212073_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_014480107.1|212074_212935_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_014480108.1|212936_213770_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.4	8.4e-51
WP_014480109.1|214014_214992_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_014480110.1|214976_216170_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	2.6e-37
>prophage 16
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	219726	220599	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_003230635.1|219726_220599_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.8	9.6e-74
>prophage 17
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	224832	225372	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_004399171.1|224832_225372_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	2.1e-42
>prophage 18
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	229510	234996	4142593		Acinetobacter_phage(66.67%)	6	NA	NA
WP_014480119.1|229510_230593_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.2	1.3e-24
WP_014480120.1|230603_231407_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014480121.1|231399_232602_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_014480122.1|232582_233230_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_014480123.1|233234_233987_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.6	3.1e-44
WP_014480124.1|233979_234996_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	8.3e-61
>prophage 19
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	238199	244921	4142593		Pandoravirus(25.0%)	9	NA	NA
WP_004398727.1|238199_239372_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	4.2e-40
WP_014480127.1|239446_240217_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_010886554.1|240453_240903_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.4e-28
WP_010886555.1|241018_242065_-	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_014480129.1|242006_242708_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_014480130.1|242714_243470_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003230576.1|243633_243861_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003225516.1|243882_244455_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	4.9e-50
WP_003153447.1|244642_244921_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
>prophage 20
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	258251	259169	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014480142.1|258251_259169_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
>prophage 21
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	266025	277003	4142593		Bacillus_phage(60.0%)	10	NA	NA
WP_014480148.1|266025_267516_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.3	3.2e-61
WP_014480149.1|267508_268567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003225461.1|268832_269081_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_014480150.1|269120_269693_-	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_004398713.1|270189_271767_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.1	1.3e-36
WP_014480151.1|271808_272576_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_033881334.1|272687_273791_-	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
WP_003230521.1|273726_274311_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_014480153.1|274514_276284_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	1.2e-38
WP_003246107.1|276280_277003_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
>prophage 22
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	282482	290442	4142593		Staphylococcus_phage(57.14%)	10	NA	NA
WP_014480157.1|282482_283631_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	6.0e-23
WP_014477219.1|283753_284293_-	YpuI family protein	NA	NA	NA	NA	NA
WP_014480158.1|284347_284941_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|284930_285686_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|285965_286490_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|286503_286878_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|286990_287455_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|287487_288684_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|288698_289346_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_014480162.1|289356_290442_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 23
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	295049	306680	4142593	protease,transposase	Bacillus_phage(20.0%)	16	NA	NA
WP_031600647.1|295049_295769_+	hypothetical protein	NA	D2XR29	Bacillus_phage	37.8	7.2e-43
WP_031600648.1|296153_297119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881339.1|297192_297513_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_031600649.1|297536_298391_-	C1 family peptidase	NA	A0A1X6WFA2	Pacmanvirus	29.5	3.4e-23
WP_031600650.1|298674_299397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|299618_300866_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_031600651.1|300991_301357_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_033882065.1|301406_302822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882064.1|302834_303140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832642.1|303249_303489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033882066.1|303611_303809_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	33.9	2.1e-05
WP_041516485.1|304000_304312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882069.1|304326_304719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882070.1|304912_305161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882071.1|305866_306121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480166.1|306248_306680_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.9	1.2e-16
>prophage 24
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	314608	320660	4142593		Bacillus_phage(25.0%)	7	NA	NA
WP_003230458.1|314608_315376_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.7	1.0e-71
WP_003230452.1|315387_315828_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_004398633.1|315824_316178_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_014480174.1|316273_317443_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	1.4e-35
WP_003230447.1|317596_318412_-	purine nucleoside phosphorylase I, inosine and guanosine-specific	NA	Q5YBA4	Grouper_iridovirus	48.2	1.3e-69
WP_014480175.1|318424_319609_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_014480176.1|319769_320660_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	2.2e-41
>prophage 25
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	333365	345114	4142593		Erysipelothrix_phage(14.29%)	13	NA	NA
WP_014480184.1|333365_334397_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	40.6	8.2e-32
WP_072557091.1|334389_334734_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014477254.1|334743_335214_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014480186.1|335399_335738_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	27.9	2.8e-05
WP_010886562.1|335734_336973_-	DNA polymerase IV	NA	O64031	Bacillus_phage	42.8	2.3e-76
WP_004398642.1|337138_337345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480187.1|337847_339080_+	MFS transporter	NA	NA	NA	NA	NA
WP_014480188.1|339285_339672_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	56.5	1.5e-34
WP_014480189.1|339676_340636_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.3	5.5e-30
WP_014480190.1|340707_342054_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_014480191.1|342129_342909_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.1	7.4e-09
WP_014480192.1|342914_343874_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014477264.1|344277_345114_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.8	3.1e-29
>prophage 26
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	348123	354867	4142593	transposase	Streptococcus_phage(33.33%)	6	NA	NA
WP_014478984.1|348123_349476_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014480195.1|349677_350439_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003226511.1|350482_350632_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004398681.1|350713_351637_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_014480196.1|351863_353333_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.7	6.1e-81
WP_014480197.1|353457_354867_-	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.4	4.4e-36
>prophage 27
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	363291	364014	4142593		Planktothrix_phage(100.0%)	1	NA	NA
WP_014480208.1|363291_364014_-	arginine ABC transporter ATP-binding protein ArtR	NA	G9BWD6	Planktothrix_phage	40.9	2.6e-32
>prophage 28
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	386882	391548	4142593		Staphylococcus_phage(33.33%)	6	NA	NA
WP_014480224.1|386882_387614_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	29.2	1.1e-17
WP_010886565.1|387692_388313_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	2.9e-24
WP_014480225.1|388332_388629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480226.1|388936_389089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017696437.1|389161_390280_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003226427.1|390744_391548_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.0	7.1e-07
>prophage 29
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	399641	401977	4142593		Gordonia_phage(50.0%)	2	NA	NA
WP_033881196.1|399641_400988_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.9	1.5e-28
WP_014480234.1|401125_401977_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.0	4.5e-44
>prophage 30
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	405163	406516	4142593	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_014478984.1|405163_406516_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 31
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	416739	425749	4142593		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_014480243.1|416739_417615_-	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	28.3	3.7e-17
WP_003236923.1|417740_418169_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_014480244.1|418268_419105_-	octanoyltransferase LipM	NA	NA	NA	NA	NA
WP_004398485.1|419295_419676_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014480245.1|419710_421177_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.2	8.3e-86
WP_014480246.1|421169_422516_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	7.6e-62
WP_014480247.1|422545_423634_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_014480248.1|424075_425749_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.2	4.4e-59
>prophage 32
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	442871	444788	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014480266.1|442871_444788_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.9	1.0e-99
>prophage 33
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	451507	453110	4142593		Indivirus(50.0%)	2	NA	NA
WP_072173925.1|451507_452317_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.5	2.2e-16
WP_033881038.1|452300_453110_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	1.2e-14
>prophage 34
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	459733	460342	4142593		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_014480278.1|459733_460342_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	61.1	4.2e-68
>prophage 35
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	466548	476607	4142593	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
WP_009967756.1|466548_467442_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	1.3e-25
WP_015483443.1|467451_468768_-	DEAD-box ATP-dependent RNA helicase CshB	NA	A0A1V0SIR5	Klosneuvirus	34.5	8.6e-50
WP_014480284.1|468936_469680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014477361.1|469802_470747_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_014480285.1|470769_471891_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	7.1e-21
WP_072557184.1|471883_472573_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_014480287.1|472790_473153_-	cytochrome c-550	NA	NA	NA	NA	NA
WP_014480289.1|473481_474597_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	7.5e-39
WP_014480290.1|474795_476607_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	8.7e-53
>prophage 36
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	487763	488723	4142593		Rhizobium_phage(100.0%)	1	NA	NA
WP_014477373.1|487763_488723_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	54.0	1.8e-52
>prophage 37
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	493177	493624	4142593		Xanthomonas_phage(100.0%)	1	NA	NA
WP_014480300.1|493177_493624_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.7	9.7e-14
>prophage 38
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	498051	506014	4142593		Catovirus(33.33%)	6	NA	NA
WP_003230010.1|498051_499179_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.8	4.5e-23
WP_004398786.1|499378_501214_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	6.2e-139
WP_003230005.1|501237_501801_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014480306.1|501871_502903_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014480307.1|502983_504123_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003229999.1|504175_506014_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	2.6e-20
>prophage 39
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	510808	513712	4142593		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
WP_033881047.1|510808_513139_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	34.7	1.2e-35
WP_003229978.1|513142_513712_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	52.5	2.8e-34
>prophage 40
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	517030	517600	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_004398676.1|517030_517600_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.5	1.1e-22
>prophage 41
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	522168	526986	4142593		Bacillus_phage(75.0%)	6	NA	NA
WP_014480318.1|522168_522921_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	64.8	6.1e-69
WP_014480319.1|523107_523734_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_014480320.1|523752_524646_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	35.4	2.4e-56
WP_014480321.1|524896_525619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967785.1|525651_526062_-	sporulation-specific Dnase NucB	NA	F8WPS9	Bacillus_phage	60.6	7.8e-42
WP_003226102.1|526260_526986_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.5	1.8e-12
>prophage 42
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	532033	533161	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014480328.1|532033_533161_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	5.0e-91
>prophage 43
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	542466	543225	4142593		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014479891.1|542466_543225_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
>prophage 44
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	547515	547668	4142593		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_049832653.1|547515_547668_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
>prophage 45
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	555926	556964	4142593		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014480356.1|555926_556964_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	6.4e-16
>prophage 46
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	567190	568045	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014480369.1|567190_568045_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	9.7e-95
>prophage 47
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	575553	576369	4142593		Streptomyces_phage(100.0%)	1	NA	NA
WP_014480377.1|575553_576369_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
>prophage 48
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	581005	587634	4142593	protease,coat	Synechococcus_phage(33.33%)	8	NA	NA
WP_014480383.1|581005_582142_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	7.7e-15
WP_014480384.1|582160_582358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480385.1|582373_582673_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480386.1|582935_583358_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_014480387.1|583540_583735_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014480388.1|583865_584915_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_003229836.1|585047_585557_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_033881349.1|585600_587634_-	levanase	NA	S6ATV4	Bacillus_phage	37.8	8.2e-84
>prophage 49
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	612348	616211	4142593	transposase	Streptococcus_phage(33.33%)	4	NA	NA
WP_014478984.1|612348_613701_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014480408.1|613833_614064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480409.1|614146_615286_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	5.9e-23
WP_014480410.1|615287_616211_-	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	42.1	2.4e-59
>prophage 50
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	621362	632232	4142593	tRNA	Catovirus(20.0%)	11	NA	NA
WP_003225916.1|621362_621998_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
WP_003229802.1|622004_623273_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.8	9.5e-38
WP_014480415.1|623291_624221_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_014480416.1|624226_624880_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	31.7	3.2e-05
WP_003229799.1|625031_626114_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003246199.1|626244_626526_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003229795.1|626543_626960_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003225903.1|626967_627234_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_014480417.1|627318_629955_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
WP_033881628.1|630285_631347_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014480419.1|631503_632232_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	1.9e-35
>prophage 51
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	635429	637826	4142593		Brevibacillus_phage(100.0%)	1	NA	NA
WP_014477509.1|635429_637826_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.2	1.4e-79
>prophage 52
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	641479	658255	4142593	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_014480427.1|641479_642745_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.2	1.4e-113
WP_014480428.1|642784_643549_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	31.8	9.1e-20
WP_014480429.1|643883_645662_-|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	33.6	5.4e-07
WP_014480430.1|645675_646950_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004399157.1|647331_647502_-	YrzK family protein	NA	NA	NA	NA	NA
WP_033881623.1|647634_649191_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	28.7	9.3e-11
WP_004398689.1|649217_649658_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003229747.1|649670_651875_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.9e-09
WP_003229745.1|652042_652555_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.9	1.5e-29
WP_014480432.1|652560_654921_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	7.3e-92
WP_003229740.1|654987_655311_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_014480433.1|655386_655884_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_014480434.1|656041_658255_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.5e-30
>prophage 53
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	661565	715337	4142593	tRNA,protease,coat	uncultured_Mediterranean_phage(22.22%)	57	NA	NA
WP_004398708.1|661565_661832_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.3	1.5e-06
WP_003229725.1|661868_663014_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|663040_664069_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|664098_664299_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|664291_665296_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|665306_665912_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014480438.1|666050_666563_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_014480439.1|666610_667918_-	MFS transporter	NA	NA	NA	NA	NA
WP_014480440.1|667988_669014_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014480441.1|669251_669899_+	hypothetical protein	NA	A0A2R3ZQF2	Marseillevirus	26.3	9.2e-05
WP_003229707.1|669944_670067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600754.1|670172_670598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|670604_670745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480443.1|670908_672363_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_033881612.1|672403_673126_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014480445.1|673228_673825_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_014480446.1|673972_675136_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014480447.1|675252_676359_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014480448.1|676345_677215_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014480449.1|677168_678764_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033881608.1|678866_680054_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|680013_680556_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|680580_681438_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|681454_681898_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|681958_683245_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014480451.1|683278_683857_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|683934_684057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|684177_684462_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|684474_684813_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|684815_685124_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|685270_686137_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014480453.1|686129_686924_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480454.1|687073_687880_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|687881_688562_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|688614_689133_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|689129_690002_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|690032_691046_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|691137_691833_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014480456.1|691869_692439_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014480457.1|692591_693590_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|693723_694470_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014480460.1|694609_695902_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014480461.1|695961_698604_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|699051_699243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|699261_700287_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|700319_702041_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|702171_703464_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|703493_704468_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|704464_705253_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|705242_706187_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|706219_707050_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|707057_708425_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|708654_709152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|709173_709761_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|709757_712082_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_004398923.1|712262_713921_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|714074_715337_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 54
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	721432	737915	4142593	transposase	Staphylococcus_phage(33.33%)	10	NA	NA
WP_033881607.1|721432_722989_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|722975_724004_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|724027_724546_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_014480476.1|724542_726267_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
WP_038827685.1|727079_727415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480481.1|728216_729041_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_087614160.1|729175_730325_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014480487.1|731829_733149_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	1.3e-16
WP_014480488.1|733145_734576_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	25.9	2.6e-28
WP_014480489.1|734708_737915_-	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
>prophage 55
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	742575	743172	4142593		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_015251523.1|742575_743172_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
>prophage 56
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	746758	746983	4142593		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003184172.1|746758_746983_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 57
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	755055	755370	4142593		Indivirus(100.0%)	1	NA	NA
WP_003222500.1|755055_755370_-	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 58
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	760650	767031	4142593		Staphylococcus_phage(33.33%)	4	NA	NA
WP_014480502.1|760650_762333_-	long-chain-fatty-acid--CoA ligase LcfA	NA	A0A2H4PQM9	Staphylococcus_phage	26.7	6.0e-32
WP_003237674.1|762521_762926_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_014480503.1|762940_765298_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
WP_014480504.1|765318_767031_-	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	1.4e-12
>prophage 59
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	771597	772632	4142593	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003229529.1|771597_772632_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.0	7.7e-30
>prophage 60
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	794975	795497	4142593		Agrobacterium_phage(100.0%)	1	NA	NA
WP_010886591.1|794975_795497_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	7.1e-16
>prophage 61
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	798597	808900	4142593	tRNA	Enterobacteria_phage(25.0%)	9	NA	NA
WP_014480527.1|798597_800379_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	31.0	7.0e-71
WP_033881438.1|800545_801328_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014480529.1|801367_803299_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.3	4.9e-110
WP_014480530.1|803692_804538_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_003229468.1|804616_805258_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_014480531.1|805291_806227_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.4	9.7e-40
WP_014480532.1|806254_807673_-	replication initiation membrane attachment protein DnaB	NA	NA	NA	NA	NA
WP_014480533.1|807787_808246_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003223584.1|808519_808900_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	1.6e-17
>prophage 62
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	812144	823093	4142593		Bacillus_phage(50.0%)	9	NA	NA
WP_003229455.1|812144_812987_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.8	4.2e-82
WP_014480535.1|813026_813620_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003229449.1|813635_814268_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_072592553.1|814434_815265_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.3	1.5e-23
WP_014480537.1|815287_817930_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.7	2.9e-41
WP_014480538.1|818173_819913_-	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	40.6	8.4e-45
WP_003229442.1|819905_820628_-	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	43.6	3.5e-45
WP_014480540.1|820839_821778_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014477637.1|821821_823093_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.1e-12
>prophage 63
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	826896	828654	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014480544.1|826896_828654_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	49.4	1.7e-13
>prophage 64
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	833377	836725	4142593		Streptomyces_phage(100.0%)	1	NA	NA
WP_014480547.1|833377_836725_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.2	6.5e-179
>prophage 65
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	840932	842285	4142593	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_014478984.1|840932_842285_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 66
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	852541	858156	4142593		Klebsiella_phage(33.33%)	5	NA	NA
WP_014480554.1|852541_853549_-	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	26.3	4.0e-15
WP_014480556.1|853734_854538_+	NAD kinase	NA	NA	NA	NA	NA
WP_014480557.1|854569_856159_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014480558.1|856178_857768_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.7	3.9e-73
WP_003223491.1|857946_858156_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.9	4.7e-19
>prophage 67
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	866198	872445	4142593	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_014480563.1|866198_867938_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.1	1.1e-20
WP_003229307.1|868020_868203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229304.1|868232_868835_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_014480566.1|869116_870385_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.7	3.4e-80
WP_004399030.1|870726_872445_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.2	1.1e-209
>prophage 68
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	877958	879035	4142593		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003223454.1|877958_879035_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.5	1.6e-14
>prophage 69
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	882239	886679	4142593		Mycobacterium_phage(50.0%)	3	NA	NA
WP_014480573.1|882239_885089_-	DNA translocase SftA	NA	S5VNE3	Mycobacterium_phage	49.6	9.1e-89
WP_003229269.1|885248_885854_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_009967991.1|885869_886679_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	54.5	9.6e-36
>prophage 70
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	898955	904614	4142593		Streptococcus_phage(33.33%)	5	NA	NA
WP_003229237.1|898955_899891_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.9	5.5e-83
WP_014480582.1|899924_901316_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_014480583.1|901412_902711_+	hypoxanthine/guanine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	32.8	4.6e-48
WP_014480584.1|902749_903907_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014480585.1|903903_904614_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	1.4e-19
>prophage 71
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	907871	910862	4142593		Staphylococcus_phage(50.0%)	2	NA	NA
WP_072557170.1|907871_909134_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	8.8e-28
WP_015384403.1|909323_910862_+	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	26.3	2.0e-21
>prophage 72
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	924393	926845	4142593		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_033882157.1|924393_925509_-	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.2	1.0e-35
WP_014480606.1|925498_926845_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.1e-12
>prophage 73
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	934735	944193	4142593	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_014480614.1|934735_937150_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.3	0.0e+00
WP_003246114.1|937574_937910_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_014480616.1|938314_939100_+	blue-light photoreceptor	NA	NA	NA	NA	NA
WP_014480617.1|939336_940530_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	51.8	1.0e-105
WP_014480618.1|940718_941465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480619.1|941501_943442_-	bacitracin ABC transporter permease BceB	NA	NA	NA	NA	NA
WP_003229137.1|943431_944193_-	bacitracin ABC transporter ATP-binding protein BceA	NA	G9BWD6	Planktothrix_phage	35.8	6.1e-32
>prophage 74
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	947383	970432	4142593	holin	Staphylococcus_phage(58.33%)	28	NA	NA
WP_014477726.1|947383_948079_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	8.0e-39
WP_014480623.1|948093_949071_-	ABC transporter permease YtrD	NA	NA	NA	NA	NA
WP_014480624.1|949102_950089_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003229123.1|950082_950961_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	6.8e-19
WP_003229121.1|950953_951346_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003229119.1|951379_951517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229117.1|951672_951945_-	YtzC family protein	NA	NA	NA	NA	NA
WP_009968016.1|952106_953075_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	4.2e-54
WP_014480625.1|953071_953656_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	52.1	9.7e-46
WP_033882168.1|953645_954749_-	tetraprenyl-beta-curcumene synthase	NA	NA	NA	NA	NA
WP_004398545.1|954769_955549_-	phospholipase YtpA	NA	A0A220T682	Eptesipox_virus	25.7	3.6e-11
WP_003229106.1|955597_956113_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003229105.1|956358_957750_-	amino acid permease	NA	NA	NA	NA	NA
WP_004398625.1|957885_959784_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.4	4.3e-34
WP_003229102.1|959933_961136_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	4.3e-165
WP_014480627.1|961638_963222_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	1.6e-196
WP_003223304.1|963260_963503_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_014480628.1|963554_964328_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.5	7.5e-38
WP_003245977.1|964478_965483_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003229092.1|965495_966278_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	7.4e-33
WP_003229090.1|966252_967065_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229087.1|967091_967568_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_003229085.1|967776_968181_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|968346_968784_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|968876_969053_+	YtzI protein	NA	NA	NA	NA	NA
WP_014480629.1|969046_969484_-	FixH family protein	NA	NA	NA	NA	NA
WP_003219361.1|969603_970077_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|970204_970432_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
>prophage 75
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	976375	980919	4142593		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_014480635.1|976375_977128_-	manganese ABC transporter ATP-binding protein MntB	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	5.1e-15
WP_014480636.1|977146_978067_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_014480637.1|978346_979462_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_014480638.1|979458_980919_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.5e-74
>prophage 76
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	986840	990064	4142593		Bacillus_phage(66.67%)	3	NA	NA
WP_014480643.1|986840_987659_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	6.3e-51
WP_014480644.1|987830_989117_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.5	5.0e-71
WP_014480645.1|989113_990064_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	3.8e-31
>prophage 77
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	995836	998233	4142593		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_014480652.1|995836_998233_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.2e-12
>prophage 78
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1012574	1014104	4142593		Orpheovirus(100.0%)	1	NA	NA
WP_014480656.1|1012574_1014104_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
>prophage 79
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1022944	1023793	4142593		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003228938.1|1022944_1023793_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
>prophage 80
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1038292	1044453	4142593		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_033881493.1|1038292_1040278_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	5.8e-26
WP_014480674.1|1042464_1044453_-	methyl-accepting chemotaxis protein McpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	4.4e-13
>prophage 81
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1050873	1051860	4142593		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014480680.1|1050873_1051860_+	potassium channel protein KbfO	NA	A0A1B0Y2S3	Lactobacillus_phage	34.8	4.8e-05
>prophage 82
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1059599	1060421	4142593		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014480683.1|1059599_1060421_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.5	3.3e-07
>prophage 83
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1073099	1078131	4142593		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_014480695.1|1073099_1074632_+	guanosine ABC transporter ATP-binding protein NupO	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	3.6e-07
WP_014480696.1|1074624_1075671_+	guanosine ABC transporter permease NupP	NA	NA	NA	NA	NA
WP_014480697.1|1075671_1076631_+	guanosine ABC transporter permease NupQ	NA	NA	NA	NA	NA
WP_003244241.1|1076784_1078131_+	sodium/malate symporter MaeN	NA	A0A140XAH4	Dickeya_phage	48.4	8.8e-18
>prophage 84
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1091452	1092925	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_014480708.1|1091452_1092925_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.8	1.1e-106
>prophage 85
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1101910	1106398	4142593		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014480714.1|1101910_1106398_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.6	2.9e-33
>prophage 86
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1112516	1119653	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_014480721.1|1112516_1119653_-	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	26.9	3.4e-100
>prophage 87
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1128414	1145374	4142593	protease,tail	Mycoplasma_phage(16.67%)	21	NA	NA
WP_014480727.1|1128414_1129917_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.3e-57
WP_003244337.1|1130074_1130551_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_072175151.1|1130581_1131238_-	stationary phase survival protein SpsC	NA	A0A217ER34	Bacillus_phage	31.8	7.4e-10
WP_014480728.1|1131341_1131662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243733.1|1131715_1131859_-	YuiA family protein	NA	NA	NA	NA	NA
WP_033881474.1|1132031_1133252_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014480730.1|1133583_1134582_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	4.7e-32
WP_003228723.1|1134620_1134761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480732.1|1135037_1136018_+	GMP reductase	NA	G3MBI2	Bacillus_virus	85.5	9.5e-163
WP_014480733.1|1136091_1136715_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_014480734.1|1136738_1137257_-	spermidine/spermine N(1)-acetyltransferase	NA	NA	NA	NA	NA
WP_014480735.1|1137908_1138361_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_014480736.1|1138494_1141608_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	57.1	2.5e-07
WP_033881466.1|1141607_1141940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480738.1|1141996_1142623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600858.1|1142634_1143120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480739.1|1143116_1143467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480740.1|1143463_1143838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881469.1|1143816_1144017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480741.1|1144147_1144366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480742.1|1144441_1145374_-	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	27.9	1.0e-20
>prophage 88
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1151157	1159265	4142593	integrase	Bacillus_phage(50.0%)	10	1152331:1152344	1157237:1157250
WP_033882127.1|1151157_1151709_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	45.8	6.3e-39
WP_031600865.1|1152040_1152766_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.5	3.6e-18
1152331:1152344	attL	TTTGAGAAATAATA	NA	NA	NA	NA
WP_014480748.1|1152926_1153973_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.6	9.2e-31
WP_003244166.1|1154143_1154506_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.4e-18
WP_003243745.1|1154584_1155439_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003228710.1|1155561_1156776_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.3	1.6e-13
WP_003222913.1|1156912_1157149_-	YuzB family protein	NA	NA	NA	NA	NA
WP_003228707.1|1157411_1158479_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
1157237:1157250	attR	TATTATTTCTCAAA	NA	NA	NA	NA
WP_014477874.1|1158504_1158831_-	YuzD family protein	NA	NA	NA	NA	NA
WP_003151955.1|1159028_1159265_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
>prophage 89
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1166045	1166546	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_003243814.1|1166045_1166546_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
>prophage 90
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1169996	1170977	4142593		Microcystis_phage(100.0%)	1	NA	NA
WP_014480753.1|1169996_1170977_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
>prophage 91
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1179046	1181694	4142593		Enterobacteria_phage(100.0%)	2	NA	NA
WP_033882116.1|1179046_1180396_+	uric acid permease PucJ	NA	Q9KX94	Enterobacteria_phage	28.1	2.3e-26
WP_014480761.1|1180401_1181694_+	uric acid permease PucK	NA	Q9KX94	Enterobacteria_phage	30.0	7.7e-27
>prophage 92
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1193702	1194806	4142593		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014480776.1|1193702_1194806_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	29.7	5.0e-19
>prophage 93
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1199792	1200779	4142593		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_014480782.1|1199792_1200779_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
>prophage 94
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1205692	1215611	4142593		Mycobacterium_phage(20.0%)	14	NA	NA
WP_014480785.1|1205692_1206136_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	2.5e-14
WP_014480786.1|1206125_1207346_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.2e-116
WP_014480787.1|1207345_1208659_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|1208676_1209462_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003228600.1|1209655_1209793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003228595.1|1210448_1211273_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_003228593.1|1211286_1211955_-	methionine ABC transporter permease MetP	NA	NA	NA	NA	NA
WP_014480789.1|1211947_1212973_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_014480791.1|1213299_1213644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480792.1|1213750_1214071_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014480793.1|1214072_1214513_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_014480794.1|1214512_1214749_-	YusG family protein	NA	NA	NA	NA	NA
WP_003222781.1|1214804_1215188_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003222779.1|1215254_1215611_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
>prophage 95
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1221422	1222331	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014480798.1|1221422_1222331_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	1.4e-62
>prophage 96
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1225700	1228622	4142593		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_014480803.1|1225700_1226441_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.1	8.0e-13
WP_014480804.1|1226574_1227462_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243692.1|1227481_1227727_-	YusU family protein	NA	NA	NA	NA	NA
WP_080265401.1|1227794_1228622_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	4.2e-10
>prophage 97
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1234006	1234732	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014480811.1|1234006_1234732_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.7e-20
>prophage 98
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1241606	1247451	4142593	protease	Emiliania_huxleyi_virus(25.0%)	4	NA	NA
WP_014480818.1|1241606_1242869_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	30.9	2.5e-46
WP_014480821.1|1244614_1245076_+	metalloregulation DNA-binding stress protein MgrA	NA	A0A0A7RTZ1	Clostridium_phage	49.6	2.0e-30
WP_014480822.1|1245119_1246496_-|protease	serine protease Do-like protein HtrB	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	4.3e-20
WP_014480823.1|1246773_1247451_+	secretion stress-responsive two-component system response regulator CssR	NA	W8CYM9	Bacillus_phage	34.5	1.1e-27
>prophage 99
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1255470	1256106	4142593		Caldibacillus_phage(100.0%)	1	NA	NA
WP_014480830.1|1255470_1256106_-	two-component system response regulator LiaR	NA	A0A290GJH9	Caldibacillus_phage	53.8	4.0e-05
>prophage 100
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1262189	1264579	4142593		Bacillus_phage(50.0%)	2	NA	NA
WP_072592611.1|1262189_1263518_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.7	1.1e-07
WP_033882094.1|1263517_1264579_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.1	2.0e-17
>prophage 101
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1267661	1270114	4142593		Bacillus_phage(100.0%)	2	NA	NA
WP_014480842.1|1267661_1269404_-	two-component system sensor histidine kinase YvrG	NA	W8CYF6	Bacillus_phage	24.2	1.3e-16
WP_003243545.1|1269400_1270114_-	two-component system response regulator YvrH	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
>prophage 102
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1274395	1277242	4142593		Planktothrix_phage(50.0%)	3	NA	NA
WP_014480848.1|1274395_1275085_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.4e-40
WP_014480849.1|1275068_1276262_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003243882.1|1276432_1277242_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	1.1e-10
>prophage 103
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1282816	1288624	4142593		Bacillus_phage(33.33%)	6	NA	NA
WP_003228444.1|1282816_1283299_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
WP_014480853.1|1283398_1285252_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.3	3.6e-86
WP_033882087.1|1285279_1286206_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_014480855.1|1286316_1287099_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_121517036.1|1287070_1287763_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033882084.1|1287793_1288624_-	glyoxal/methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.4	5.0e-80
>prophage 104
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1300823	1305504	4142593		Streptococcus_phage(50.0%)	2	NA	NA
WP_121509435.1|1300823_1302932_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.2	6.7e-113
WP_033882081.1|1303092_1305504_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-120
>prophage 105
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1312982	1369154	4142593	portal,head,protease,terminase,capsid,plate,tail,holin	Bacillus_phage(67.44%)	70	NA	NA
WP_033882082.1|1312982_1313171_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
WP_014480874.1|1313332_1314916_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
WP_014480875.1|1314930_1315320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105778748.1|1315662_1316265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480877.1|1316304_1317246_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|1317287_1317710_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480879.1|1317763_1317934_-	XkdX family protein	NA	NA	NA	NA	NA
WP_031600923.1|1317930_1318230_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_031600924.1|1318245_1319469_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	79.9	6.5e-177
WP_072592555.1|1319505_1321080_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
WP_031600926.1|1321116_1322823_-	hypothetical protein	NA	D6R400	Bacillus_phage	81.8	9.4e-267
WP_031600927.1|1322834_1323674_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_033882059.1|1323673_1327552_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
WP_017696308.1|1327564_1327744_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_003220222.1|1327746_1328085_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696306.1|1328139_1328751_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_031600930.1|1328751_1329132_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_033882058.1|1329128_1329512_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
WP_033882056.1|1329504_1329876_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
WP_031600933.1|1329808_1330156_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
WP_031600934.1|1330171_1330663_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
WP_031600935.1|1330691_1331006_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
WP_033882054.1|1331021_1332224_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
WP_003220242.1|1332260_1332887_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
WP_033882052.1|1332876_1334124_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_033882051.1|1334129_1334345_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_031600939.1|1334357_1336067_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
WP_017697674.1|1336066_1336600_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_046160532.1|1336979_1337354_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_033881251.1|1337403_1338150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600943.1|1338540_1339314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123772464.1|1339464_1339830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600945.1|1341038_1341491_-	hypothetical protein	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
WP_014480881.1|1341744_1341945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480882.1|1341941_1342361_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
WP_014480883.1|1342357_1342690_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
WP_014480884.1|1342689_1343346_-	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
WP_014480885.1|1343463_1343721_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
WP_014480886.1|1343717_1344125_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480887.1|1344121_1344439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|1344435_1344798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220282.1|1344840_1345038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|1345284_1345425_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014480892.1|1345532_1346081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480894.1|1346395_1347223_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480895.1|1347206_1348088_-	phage replisome organiser	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_033881245.1|1348080_1348299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881244.1|1348323_1348515_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_014480896.1|1348566_1348770_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014480897.1|1349004_1349403_+	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_014480900.1|1349835_1350936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220025.1|1352860_1353331_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_003228386.1|1353475_1355815_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003242610.1|1355833_1356574_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|1356705_1356936_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014480904.1|1357084_1357858_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|1357891_1358125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|1358276_1358684_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|1358713_1359133_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|1359224_1359551_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_014480906.1|1359678_1361379_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
WP_014480907.1|1361419_1362100_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_014480908.1|1362116_1363037_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|1363048_1363702_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480909.1|1363718_1364864_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014480910.1|1365147_1365681_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|1365712_1366387_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_031600963.1|1366404_1367316_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|1367335_1367989_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_014480912.1|1368011_1369154_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 106
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1374709	1376002	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_003228333.1|1374709_1376002_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.5	6.4e-175
>prophage 107
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1396501	1399774	4142593		Lactobacillus_prophage(66.67%)	4	NA	NA
WP_072592559.1|1396501_1397407_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.0e-22
WP_014480930.1|1397806_1398325_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014480931.1|1398342_1399377_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	39.8	9.1e-63
WP_014480932.1|1399354_1399774_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	5.3e-30
>prophage 108
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1409114	1410113	4142593		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014480938.1|1409114_1410113_-	galactan degradation operon transcriptional regulator GanR	NA	C6ZCU4	Enterobacteria_phage	22.3	8.0e-08
>prophage 109
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1415524	1416691	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_014480943.1|1415524_1416691_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.8	8.7e-30
>prophage 110
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1424873	1432560	4142593		Catovirus(33.33%)	7	NA	NA
WP_014480952.1|1424873_1425710_-	glycosyltransferase EpsE	NA	A0A1V0SAH6	Catovirus	39.6	2.2e-14
WP_014480953.1|1425706_1426852_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014480954.1|1426863_1428660_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.6	2.6e-25
WP_014480955.1|1428918_1429602_-	protein tyrosine kinase EpsB	NA	NA	NA	NA	NA
WP_003228247.1|1429607_1430312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480956.1|1430557_1431016_+	transcriptional regulator SlrR	NA	NA	NA	NA	NA
WP_014480957.1|1431090_1432560_+	para-nitrobenzyl esterase	NA	A0A0M4JT58	Mollivirus	33.1	2.1e-36
>prophage 111
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1437963	1439514	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014480965.1|1437963_1439514_+	2,6-beta-fructan 6-levanbiohydrolase	NA	F8WPR5	Bacillus_phage	42.5	3.8e-97
>prophage 112
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1443485	1481805	4142593	portal,terminase,plate,tail,integrase	Bacillus_phage(32.14%)	50	1443294:1443347	1480123:1480176
1443294:1443347	attL	TATTGGACGCGCTCGGAGGGATTCGAACCCCCGACAGACGTGGTACCGGAAACC	NA	NA	NA	NA
WP_033881229.1|1443485_1443719_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
WP_014480971.1|1443997_1444276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480972.1|1444288_1445473_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
WP_014480973.1|1445459_1446092_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
WP_014480974.1|1446133_1446436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480975.1|1446557_1446815_-	hypothetical protein	NA	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
WP_033881228.1|1446834_1447782_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
WP_033881227.1|1447854_1448058_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
WP_014480977.1|1448082_1448253_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
WP_014480978.1|1448253_1448547_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
WP_031600995.1|1448562_1449786_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
WP_031600996.1|1449822_1451400_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
WP_031600997.1|1451412_1452807_-	hypothetical protein	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
WP_033880944.1|1452821_1454240_-	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
WP_080283095.1|1454243_1457066_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
WP_033880947.1|1457070_1457292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880428.1|1457387_1457744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880949.1|1457830_1458400_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
WP_033880952.1|1458440_1458815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880954.1|1458819_1459227_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
WP_033880956.1|1459223_1459562_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
WP_031601003.1|1459562_1459955_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
WP_033880957.1|1459972_1460164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601004.1|1460220_1461129_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
WP_031601005.1|1461160_1461721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695234.1|1461826_1462639_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
WP_031601006.1|1462638_1464309_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
WP_031601007.1|1464313_1464748_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
WP_033880959.1|1464764_1466525_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
WP_033880961.1|1466608_1467157_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
WP_031601009.1|1467186_1467396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832644.1|1467769_1468081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880962.1|1468333_1468513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601012.1|1469557_1470100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601013.1|1470096_1470375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880965.1|1471235_1471607_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_033880966.1|1471674_1472058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880968.1|1472054_1472303_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017695246.1|1472934_1473135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880970.1|1473127_1473469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041516557.1|1473830_1474373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480746.1|1474906_1476082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881551.1|1476202_1476418_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	50.8	1.7e-08
WP_031601018.1|1476619_1476955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881293.1|1477543_1477777_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033881294.1|1477836_1478019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041516560.1|1478049_1478781_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.7	6.7e-20
WP_014480981.1|1478939_1479929_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
WP_003228214.1|1480474_1481068_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
1480123:1480176	attR	TATTGGACGCGCTCGGAGGGATTCGAACCCCCGACAGACGTGGTACCGGAAACC	NA	NA	NA	NA
WP_014480982.1|1481130_1481805_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	26.3	5.4e-08
>prophage 113
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1493191	1495824	4142593		Catovirus(50.0%)	2	NA	NA
WP_003228180.1|1493191_1493767_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	27.1	3.8e-10
WP_014480994.1|1494231_1495824_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.4	1.2e-45
>prophage 114
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1499747	1500527	4142593		Planktothrix_phage(100.0%)	1	NA	NA
WP_014480998.1|1499747_1500527_-	lantibiotic ABC transporter ATP-binding protein PsdA	NA	G9BWD6	Planktothrix_phage	33.9	3.5e-27
>prophage 115
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1503823	1513754	4142593		Streptococcus_phage(33.33%)	8	NA	NA
WP_003228147.1|1503823_1504774_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	4.3e-51
WP_003244450.1|1504796_1505750_-	gluconeogenesis morphogenetic factor	NA	A1IMD5	Streptococcus_phage	41.1	4.0e-65
WP_003243903.1|1505751_1506639_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	8.7e-06
WP_014481002.1|1506663_1507140_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014481003.1|1507479_1508409_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.5	1.5e-88
WP_014481004.1|1508614_1510024_-	peptidoglycan DL-endopeptidase CwlO	NA	A0A0A0RVE6	Bacillus_phage	52.6	1.6e-25
WP_014481005.1|1510404_1511859_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014481006.1|1511984_1513754_-	multidrug resistance ABC transporter ATP-binding protein/permease BmrA	NA	W8CYL7	Bacillus_phage	59.3	6.3e-165
>prophage 116
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1525618	1526768	4142593	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_087614160.1|1525618_1526768_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 117
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1537722	1539075	4142593	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_014478984.1|1537722_1539075_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 118
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1543014	1545888	4142593		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014481031.1|1543014_1545888_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
>prophage 119
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1555304	1558456	4142593	protease	Moraxella_phage(50.0%)	3	NA	NA
WP_014481034.1|1555304_1556747_-|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
WP_009968247.1|1556886_1557777_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_014481035.1|1557769_1558456_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	2.9e-25
>prophage 120
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1568998	1569223	4142593		Vibrio_phage(100.0%)	1	NA	NA
WP_014481044.1|1568998_1569223_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	50.0	2.6e-07
>prophage 121
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1575118	1580359	4142593		Streptococcus_phage(66.67%)	5	NA	NA
WP_014481052.1|1575118_1576510_-	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	37.3	4.8e-67
WP_014481053.1|1576616_1577462_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	5.7e-15
WP_014481054.1|1577559_1578249_-	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003227983.1|1578331_1579489_-	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_014481055.1|1579705_1580359_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.7	8.9e-40
>prophage 122
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1585897	1586557	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014481062.1|1585897_1586557_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	6.9e-32
>prophage 123
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1589615	1590374	4142593		Catovirus(100.0%)	1	NA	NA
WP_014481066.1|1589615_1590374_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.5	7.9e-16
>prophage 124
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1593449	1594784	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014481069.1|1593449_1594784_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.5	1.0e-87
>prophage 125
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1599944	1610661	4142593	transposase	Streptococcus_phage(33.33%)	7	NA	NA
WP_033881223.1|1599944_1601432_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	40.6	1.7e-25
WP_014481074.1|1601516_1603661_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	28.9	2.7e-16
WP_033881224.1|1603689_1604010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478984.1|1605250_1606603_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014478984.1|1606829_1608182_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_031601046.1|1608310_1609453_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	29.9	3.8e-30
WP_014481080.1|1609782_1610661_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.4	5.7e-82
>prophage 126
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1620526	1625915	4142593		Hokovirus(50.0%)	4	NA	NA
WP_033881770.1|1620526_1620916_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.9	2.4e-16
WP_014481091.1|1621278_1622061_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_014481092.1|1622080_1623244_+	polyglycerol phosphate assembly/export protein	NA	NA	NA	NA	NA
WP_014481093.1|1623272_1625915_-	beta-N-acetylglucosaminidase LytD	NA	Q4ZC50	Staphylococcus_virus	44.9	1.8e-38
>prophage 127
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1634661	1635903	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_033881779.1|1634661_1635903_-	gamma-DL-glutamyl hydrolase	NA	S5MM68	Bacillus_phage	41.1	1.8e-17
>prophage 128
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1642084	1643566	4142593		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014481107.1|1642084_1643566_+	ribose ABC transporter ATP-binding protein RbsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.5e-13
>prophage 129
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1649899	1652347	4142593		Lactobacillus_phage(50.0%)	2	NA	NA
WP_014481114.1|1649899_1650808_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	6.8e-14
WP_014481115.1|1651018_1652347_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	28.9	6.4e-45
>prophage 130
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1665915	1680869	4142593		Bacillus_phage(40.0%)	14	NA	NA
WP_031601067.1|1665915_1667727_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	36.4	5.5e-39
WP_003227825.1|1667745_1668006_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_010332155.1|1668015_1668438_-	DUF5082 family protein	NA	NA	NA	NA	NA
WP_121509441.1|1668627_1668765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481135.1|1669810_1671133_-	UDP-glucose 6-dehydrogenase UglF	NA	A0A127AXI2	Bacillus_phage	39.1	1.5e-86
WP_014481136.1|1671327_1672092_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_015714839.1|1672140_1672857_-	tyrosine-protein kinase PtkA	NA	A0A1X9I5D6	Streptococcus_phage	38.7	1.5e-27
WP_003227811.1|1672846_1673593_-	protein-tyrosine kinase activator TkmA	NA	NA	NA	NA	NA
WP_003242876.1|1673826_1673970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481138.1|1674173_1675784_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_014481139.1|1675770_1678539_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.5	1.3e-39
WP_014481140.1|1678664_1679522_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003244075.1|1679527_1680304_-	transcriptional regulator GlcR	NA	NA	NA	NA	NA
WP_014481141.1|1680527_1680869_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	65.1	7.6e-35
>prophage 131
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1688744	1689026	4142593		Clostridium_phage(100.0%)	1	NA	NA
WP_003221804.1|1688744_1689026_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 132
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1700018	1700891	4142593		Clostridium_phage(100.0%)	1	NA	NA
WP_014481160.1|1700018_1700891_-	stage II sporulation protein spoIIQ	NA	I3PV24	Clostridium_phage	36.1	1.1e-05
>prophage 133
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1713167	1714301	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014481175.1|1713167_1714301_-	response regulator aspartate phosphatase RapB	NA	A0A1P8CWN8	Bacillus_phage	45.2	6.4e-86
>prophage 134
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1718877	1719909	4142593		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014481182.1|1718877_1719909_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	37.2	3.8e-37
>prophage 135
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1731352	1736172	4142593		Aeromonas_phage(50.0%)	6	NA	NA
WP_003227669.1|1731352_1732600_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
WP_003227667.1|1732806_1733349_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_014481188.1|1733361_1733811_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_014481190.1|1733967_1734420_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_014481191.1|1734495_1735053_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_014481192.1|1735131_1736172_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
>prophage 136
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1739247	1740318	4142593		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003227645.1|1739247_1740318_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 137
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1744566	1745154	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_014478269.1|1744566_1745154_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.1e-36
>prophage 138
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1749914	1754461	4142593		Synechococcus_phage(33.33%)	5	NA	NA
WP_003227626.1|1749914_1750553_-	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
WP_003243339.1|1750672_1751530_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003227621.1|1751710_1752085_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
WP_014481199.1|1752250_1752772_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_003227612.1|1752853_1754461_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
>prophage 139
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1760008	1760971	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014481204.1|1760008_1760971_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.6	1.3e-39
>prophage 140
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1766939	1768403	4142593		Escherichia_phage(100.0%)	1	NA	NA
WP_014481212.1|1766939_1768403_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 141
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1775783	1851122	4142593	tRNA,protease,coat,bacteriocin	Bacillus_phage(26.67%)	74	NA	NA
WP_003227570.1|1775783_1777454_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014481216.1|1777450_1777879_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|1778191_1778323_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|1778279_1778432_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_014481217.1|1778456_1779803_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|1779815_1779977_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_014481218.1|1779973_1780693_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
WP_033881822.1|1780685_1781996_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072592616.1|1781985_1783146_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481221.1|1783150_1784431_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481222.1|1784427_1785129_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_014481223.1|1785134_1786511_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481224.1|1786549_1787905_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481226.1|1788134_1789280_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|1789263_1789383_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_105778741.1|1789480_1790038_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_003227545.1|1789972_1790845_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|1790905_1791736_-	spermidine synthase	NA	NA	NA	NA	NA
WP_014481227.1|1791937_1794013_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|1794040_1794475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|1794613_1795132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|1795145_1795805_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|1795913_1796102_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|1796144_1796564_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481228.1|1796683_1798600_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
WP_003243441.1|1799444_1800845_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|1800844_1801315_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|1801426_1801927_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|1801962_1803264_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|1803425_1803650_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003227516.1|1803864_1804641_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_033881831.1|1804784_1805675_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|1805843_1806689_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|1806737_1807637_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|1807782_1808754_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|1809023_1809788_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014481234.1|1809920_1810700_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_031601099.1|1810715_1811930_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|1811930_1813115_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|1813111_1814530_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|1814548_1815310_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|1815312_1816020_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|1816009_1816624_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_014481237.1|1816775_1818014_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|1818223_1819636_-	amino acid permease	NA	NA	NA	NA	NA
WP_014481239.1|1819635_1821336_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|1821409_1822957_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|1823183_1824458_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014481241.1|1824635_1825100_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|1825423_1825879_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_014481243.1|1825871_1826723_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
WP_003244201.1|1826736_1827684_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|1827683_1828424_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_014481244.1|1828448_1829468_-|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_014481245.1|1829470_1830193_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_031601100.1|1830185_1831307_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_014481248.1|1831306_1832176_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|1832176_1833346_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_014481250.1|1833366_1834791_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014481251.1|1834795_1835566_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
WP_014481253.1|1835885_1836431_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|1836474_1836846_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481254.1|1836907_1838230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481255.1|1838249_1838567_-	YwdI family protein	NA	NA	NA	NA	NA
WP_014481256.1|1838734_1840105_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|1840129_1840807_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_014481257.1|1840820_1841627_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014481258.1|1841818_1842634_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|1842724_1842973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481259.1|1843066_1844506_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
WP_014481260.1|1844502_1845888_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|1846189_1846960_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_015250947.1|1847869_1848172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481265.1|1848701_1851122_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 142
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1877762	1879004	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_157111207.1|1877762_1879004_-	RlmI/RlmK family 23S rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.1	5.2e-73
>prophage 143
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1886498	1887359	4142593		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014481293.1|1886498_1887359_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.9e-05
>prophage 144
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1892735	1898225	4142593	transposase	Shigella_phage(33.33%)	6	NA	NA
WP_087614167.1|1892735_1893924_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_015250916.1|1893980_1894916_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_014481297.1|1895078_1895213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227330.1|1895362_1895512_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_014481298.1|1895529_1897041_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.6	1.6e-47
WP_003227327.1|1897037_1898225_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	5.2e-22
>prophage 145
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1908250	1912857	4142593		Tupanvirus(50.0%)	4	NA	NA
WP_003243042.1|1908250_1909894_+	catalase	NA	A0A2K9L572	Tupanvirus	45.2	1.4e-97
WP_014481307.1|1909997_1911200_+	MFS transporter	NA	NA	NA	NA	NA
WP_014481308.1|1911196_1911973_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014481309.1|1911969_1912857_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	5.3e-27
>prophage 146
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1916616	1920044	4142593		Bacillus_phage(50.0%)	2	NA	NA
WP_014481316.1|1916616_1918344_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.6	1.1e-23
WP_014481317.1|1918340_1920044_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	20.5	2.4e-12
>prophage 147
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1927384	1933371	4142593		Planktothrix_phage(33.33%)	5	NA	NA
WP_003242648.1|1927384_1928482_-	maltodextrin ABC transporter ATP-binding protein MsmX	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-21
WP_003227261.1|1928602_1929496_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481324.1|1929679_1931137_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003242615.1|1931178_1932015_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.0e-40
WP_014481325.1|1932351_1933371_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.7	3.8e-98
>prophage 148
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1938908	1941431	4142593		uncultured_virus(100.0%)	2	NA	NA
WP_014481331.1|1938908_1940042_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.2	3.6e-89
WP_014481332.1|1940294_1941431_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.8	1.5e-87
>prophage 149
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1949082	1951143	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_014481342.1|1949082_1951143_-	catalase	NA	A0A2K9L0T1	Tupanvirus	52.7	7.6e-154
>prophage 150
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1956927	1958367	4142593		Catovirus(100.0%)	1	NA	NA
WP_014481347.1|1956927_1958367_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.1	2.9e-59
>prophage 151
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	1991019	1994154	4142593		Paenibacillus_phage(100.0%)	1	NA	NA
WP_014481383.1|1991019_1994154_+	DUF3427 domain-containing protein	NA	A0A2I7SC38	Paenibacillus_phage	25.3	2.4e-26
>prophage 152
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2001446	2002748	4142593		Geobacillus_virus(100.0%)	1	NA	NA
WP_003227132.1|2001446_2002748_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.5	1.6e-133
>prophage 153
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2010466	2011216	4142593		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014481395.1|2010466_2011216_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	4.6e-16
>prophage 154
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2015011	2125873	4142593	protease,transposase,holin,coat	Bacillus_phage(25.93%)	101	NA	NA
WP_014481399.1|2015011_2015998_-	penicillin V amidase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.4	8.2e-29
WP_014481400.1|2016152_2016965_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_014481401.1|2017004_2017562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481402.1|2017542_2017977_-	YxeF family protein	NA	NA	NA	NA	NA
WP_003227093.1|2018065_2018431_+|coat	inner spore coat protein CotNE	coat	NA	NA	NA	NA
WP_003242469.1|2018678_2019032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481403.1|2019075_2019474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481404.1|2019651_2020617_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003227084.1|2020657_2021005_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014481410.1|2023754_2024732_-	two-component system sensor histidine kinase YxdJ	NA	NA	NA	NA	NA
WP_003243527.1|2024728_2025418_-	two-component system response regulator YxdJ	NA	NA	NA	NA	NA
WP_014481411.1|2025525_2026398_-	6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase	NA	NA	NA	NA	NA
WP_014481412.1|2026418_2027255_-	2-keto-myo-inositol isomerase	NA	NA	NA	NA	NA
WP_014481413.1|2027340_2028210_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014481414.1|2028229_2029264_-	bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase	NA	NA	NA	NA	NA
WP_014481415.1|2029286_2030603_-	myo-inositol transporter IolF	NA	NA	NA	NA	NA
WP_014481416.1|2030617_2031511_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014481417.1|2031527_2033441_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_014478485.1|2033473_2034451_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_014481418.1|2034474_2035290_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_014481419.1|2035364_2036828_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_031601042.1|2037241_2038366_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_003227050.1|2038659_2039415_+	myo-inositol utilization transcriptional regulator IolR	NA	NA	NA	NA	NA
WP_014481420.1|2039468_2040401_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014481421.1|2040630_2040945_+	hypothetical protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
WP_014481422.1|2041048_2041519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481425.1|2042275_2042788_+	HPP family protein	NA	NA	NA	NA	NA
WP_014481428.1|2044333_2046214_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
WP_014481429.1|2046381_2046633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881094.1|2047824_2048025_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014481433.1|2048647_2048866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481434.1|2048910_2049132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478926.1|2049453_2050578_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_014481435.1|2050855_2051110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481436.1|2051273_2053457_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
WP_014481437.1|2053457_2054927_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014481439.1|2055335_2056370_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_014481440.1|2056463_2057039_-	transcriptional regulator YxaF	NA	NA	NA	NA	NA
WP_014481441.1|2057169_2058240_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003243994.1|2058298_2058730_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009968420.1|2058956_2059361_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227015.1|2059330_2060023_+	LrgB family protein	NA	NA	NA	NA	NA
WP_014481442.1|2060062_2061094_-	general stress protein 30	NA	NA	NA	NA	NA
WP_014481443.1|2061186_2062335_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
WP_003243132.1|2062530_2063262_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_014481444.1|2063254_2064796_+	gluconokinase	NA	NA	NA	NA	NA
WP_003243139.1|2064824_2066171_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_014478511.1|2066193_2067600_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
WP_003243686.1|2068065_2068629_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003243077.1|2068642_2070172_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
WP_014481445.1|2070282_2071722_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_014481447.1|2072288_2072999_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478516.1|2073089_2073812_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_014481448.1|2073832_2074462_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014481449.1|2074942_2076868_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_080283096.1|2077318_2077669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481451.1|2078149_2078590_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_014479891.1|2079009_2079768_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|2079764_2081312_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157111205.1|2081441_2081606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601173.1|2082238_2083702_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
WP_121591334.1|2083936_2085823_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
WP_031601176.1|2085800_2087834_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014479904.1|2088891_2089209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033881055.1|2089205_2090120_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_080283097.1|2090200_2090647_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
WP_017696296.1|2090631_2090910_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
WP_033881129.1|2091608_2091872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881055.1|2092255_2093170_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_014479904.1|2093166_2093484_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014481454.1|2093748_2096862_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
WP_014481455.1|2096827_2097736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003226975.1|2098023_2098503_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014481456.1|2098583_2098754_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_014481457.1|2098938_2099352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481458.1|2099385_2100612_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
WP_014481459.1|2100674_2100845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481460.1|2100949_2101198_-	DUF2651 family protein	NA	NA	NA	NA	NA
WP_014481461.1|2101213_2102371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481462.1|2102381_2103119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481463.1|2103260_2103731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481464.1|2103841_2104939_+	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.3	6.0e-73
WP_003226961.1|2104939_2105056_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|2105292_2106183_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_014481465.1|2106255_2107659_-	amino acid permease	NA	NA	NA	NA	NA
WP_033882007.1|2107881_2109087_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_015715048.1|2109418_2110021_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_014481469.1|2110082_2111036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715050.1|2111020_2111575_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_014481470.1|2111758_2112394_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015715052.1|2112393_2112678_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_003244510.1|2112904_2114290_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_014481472.1|2114604_2115807_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
WP_003226939.1|2115888_2116683_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	9.8e-41
WP_014481473.1|2116704_2117547_-	WalRK two-component regulatory system regulator WalI	NA	NA	NA	NA	NA
WP_014481474.1|2117533_2118901_-	WalRK two-component regulatory system regulator WalH	NA	NA	NA	NA	NA
WP_009968432.1|2118890_2120726_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	4.4e-36
WP_003244363.1|2120733_2121441_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
WP_014481475.1|2122471_2123764_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	2.4e-68
WP_014481476.1|2123969_2124389_-	VOC family protein	NA	NA	NA	NA	NA
WP_003226923.1|2124508_2125873_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
>prophage 155
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2144480	2147689	4142593		Streptococcus_phage(50.0%)	5	NA	NA
WP_014481497.1|2144480_2145002_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	47.8	7.3e-45
WP_003226867.1|2145410_2145767_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_014481498.1|2145926_2146493_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_014481499.1|2146763_2146949_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
WP_006640009.1|2147239_2147689_-	hypothetical protein	NA	A0A1P8CX48	Bacillus_phage	79.2	3.2e-65
>prophage 156
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2154347	2159609	4142593	protease	Cronobacter_phage(33.33%)	5	NA	NA
WP_033882019.1|2154347_2155379_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	35.8	3.7e-24
WP_014481505.1|2155356_2156631_+	MFS transporter	NA	NA	NA	NA	NA
WP_014481508.1|2157984_2158743_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.3	2.1e-61
WP_003219224.1|2158807_2159047_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003219228.1|2159090_2159609_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	69.8	2.3e-51
>prophage 157
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2165104	2168954	4142593	protease	Bacillus_virus(25.0%)	5	NA	NA
WP_003243890.1|2165104_2165722_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	32.7	2.0e-17
WP_003226832.1|2165761_2166610_-	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	38.9	2.0e-20
WP_003219244.1|2166602_2167364_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.1	6.5e-26
WP_014481510.1|2167611_2168052_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003226829.1|2168102_2168954_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	37.4	1.6e-17
>prophage 158
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2177749	2185270	4142593		Bacillus_virus(66.67%)	6	NA	NA
WP_003226811.1|2177749_2178886_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.8e-16
WP_003226810.1|2179016_2179232_+	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_014478578.1|2179247_2180360_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003219266.1|2180377_2180623_+	extracellular matrix regulator RemB	NA	NA	NA	NA	NA
WP_003226808.1|2180677_2182594_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.8	9.9e-156
WP_003244540.1|2182804_2185270_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	36.9	7.1e-114
>prophage 159
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2191660	2199515	4142593	tRNA	Klosneuvirus(20.0%)	7	NA	NA
WP_014478581.1|2191660_2193127_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	5.5e-98
WP_014478582.1|2193279_2194611_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.4	5.7e-25
WP_014478583.1|2194807_2195692_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_003226797.1|2195713_2196304_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_021479916.1|2196625_2197903_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.3e-95
WP_014478585.1|2198241_2198895_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.5	3.7e-22
WP_003226790.1|2198891_2199515_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	24.3	9.1e-10
>prophage 160
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2202559	2204251	4142593		Bacteriophage(100.0%)	1	NA	NA
WP_014478588.1|2202559_2204251_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	35.5	5.1e-55
>prophage 161
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2212148	2225614	4142593	tRNA	Streptococcus_phage(42.86%)	15	NA	NA
WP_014478591.1|2212148_2213309_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	31.0	4.8e-36
WP_014478592.1|2213390_2214833_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003226776.1|2214829_2215468_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.9	4.1e-58
WP_003242755.1|2215541_2215871_+	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_009966249.1|2215883_2216324_+	YaaR family protein	NA	NA	NA	NA	NA
WP_003226770.1|2216335_2217325_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	1.1e-33
WP_003226767.1|2217327_2218155_+	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_003218308.1|2218169_2218529_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003244526.1|2218587_2219331_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003242983.1|2219317_2219617_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003243457.1|2219591_2220470_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.3	2.7e-68
WP_003226760.1|2220518_2220809_-	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	54.3	8.0e-17
WP_014478594.1|2221303_2223298_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	5.2e-99
WP_014478595.1|2223377_2224145_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003226754.1|2224300_2225614_+	DUF348 domain-containing protein	NA	U5PSR6	Bacillus_phage	66.7	8.9e-31
>prophage 162
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2232024	2234371	4142593		Tupanvirus(100.0%)	2	NA	NA
WP_014478599.1|2232024_2233395_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	3.8e-32
WP_014478600.1|2233417_2234371_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.9	3.0e-44
>prophage 163
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2239771	2240308	4142593		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003218365.1|2239771_2240308_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 164
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2252654	2260545	4142593	protease	Micromonas_pusilla_virus(25.0%)	7	NA	NA
WP_003243881.1|2252654_2254568_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	1.1e-114
WP_010886388.1|2254762_2255539_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003226695.1|2255550_2256426_+	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_014478608.1|2256472_2257366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003218399.1|2257441_2258368_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.2	5.2e-110
WP_033881151.1|2258534_2259947_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.2	2.9e-35
WP_014478610.1|2259960_2260545_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.5	9.3e-65
>prophage 165
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2264397	2265897	4142593	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003226674.1|2264397_2265897_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.4	6.2e-97
>prophage 166
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2279325	2281758	4142593	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_014475592.1|2279325_2281758_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	1.1e-132
>prophage 167
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2289203	2290604	4142593	tRNA	Catovirus(100.0%)	1	NA	NA
WP_014478619.1|2289203_2290604_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	6.1e-62
>prophage 168
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2293643	2294177	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_003225764.1|2293643_2294177_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	9.2e-11
>prophage 169
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2297672	2308516	4142593		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_009966326.1|2297672_2301254_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	1.2e-48
WP_014478624.1|2301315_2304915_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	2.8e-66
WP_003225778.1|2305093_2305342_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_003225781.1|2305455_2305872_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003225784.1|2305913_2306384_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017695826.1|2306437_2308516_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	5.7e-64
>prophage 170
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2326196	2327887	4142593		Planktothrix_phage(50.0%)	2	NA	NA
WP_014478629.1|2326196_2327042_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	2.0e-20
WP_031600082.1|2327017_2327887_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.0e-11
>prophage 171
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2332359	2333073	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_004399672.1|2332359_2333073_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.5	4.8e-15
>prophage 172
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2352669	2354106	4142593		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014478635.1|2352669_2354106_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.5	1.0e-141
>prophage 173
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2375862	2380457	4142593		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_014478652.1|2375862_2377665_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.8	4.1e-103
WP_121517040.1|2377711_2377852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478655.1|2379295_2379931_+	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_014478656.1|2379917_2380457_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.7	5.3e-22
>prophage 174
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2388216	2388987	4142593		Orpheovirus(100.0%)	1	NA	NA
WP_014478663.1|2388216_2388987_-	protein kinase	NA	A0A2I2L4H4	Orpheovirus	32.7	1.9e-09
>prophage 175
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2397997	2398879	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014478672.1|2397997_2398879_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	39.3	9.8e-42
>prophage 176
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2410444	2412754	4142593	holin	Geobacillus_phage(50.0%)	2	NA	NA
WP_033881264.1|2410444_2410687_+|holin	phage holin	holin	W8ECW0	Geobacillus_phage	57.1	3.5e-18
WP_031600099.1|2411083_2412754_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	44.4	6.0e-32
>prophage 177
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2425926	2427822	4142593		Vibrio_phage(100.0%)	1	NA	NA
WP_014478695.1|2425926_2427822_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	4.0e-08
>prophage 178
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2449389	2452022	4142593		Bacillus_phage(66.67%)	3	NA	NA
WP_080283098.1|2449389_2450070_+	two-component system response regulator YcbL	NA	W8CYM9	Bacillus_phage	33.2	9.3e-32
WP_014478715.1|2450071_2451007_+	two-component system sensor histidine kinase YcbM	NA	W8CYF6	Bacillus_phage	25.6	6.8e-25
WP_014478716.1|2451098_2452022_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	7.9e-42
>prophage 179
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2457059	2457788	4142593		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014475692.1|2457059_2457788_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	5.8e-16
>prophage 180
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2474793	2489855	4142593	transposase	Caulobacter_phage(37.5%)	13	NA	NA
WP_017695036.1|2474793_2475297_-	peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	50.8	3.8e-30
WP_014478742.1|2476648_2477425_+	SDR family oxidoreductase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	32.6	2.6e-06
WP_031600124.1|2477448_2479134_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003234733.1|2479320_2480280_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014475714.1|2480334_2481030_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	3.5e-18
WP_014478745.1|2480987_2481830_+	zinc ABC transporter permease ZnuB	NA	NA	NA	NA	NA
WP_014478748.1|2483144_2483744_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.0	3.1e-23
WP_003234723.1|2483765_2484347_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.7	6.7e-31
WP_003241242.1|2484381_2484960_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.3e-29
WP_003234719.1|2485011_2485785_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	64.6	8.5e-82
WP_014478749.1|2485868_2487482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003234715.1|2487497_2488589_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_087614160.1|2488705_2489855_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 181
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2493219	2494476	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_014475722.1|2493219_2494476_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	3.1e-33
>prophage 182
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2507847	2508666	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_003246440.1|2507847_2508666_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.1	1.6e-91
>prophage 183
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2514448	2516331	4142593		Pseudomonas_phage(50.0%)	2	NA	NA
WP_033882269.1|2514448_2515231_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.9	1.7e-45
WP_003246421.1|2515419_2516331_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.6	1.6e-66
>prophage 184
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2523721	2524732	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_014478781.1|2523721_2524732_+	ferredoxin--NADP(+) reductase	NA	A0A2K9L4X0	Tupanvirus	27.4	1.9e-17
>prophage 185
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2529165	2531298	4142593		Escherichia_phage(100.0%)	1	NA	NA
WP_014478784.1|2529165_2531298_-	assimilatory nitrate reductase catalytic subunit	NA	A0A077SK27	Escherichia_phage	22.9	1.1e-17
>prophage 186
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2542633	2544978	4142593		Pandoravirus(50.0%)	3	NA	NA
WP_014478799.1|2542633_2544067_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	30.5	9.3e-50
WP_014478800.1|2544103_2544502_-	DNA-entry nuclease inhibitor	NA	NA	NA	NA	NA
WP_014475770.1|2544528_2544978_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	67.8	2.9e-42
>prophage 187
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2549336	2574728	4142593		Tupanvirus(100.0%)	3	NA	NA
WP_031600149.1|2549336_2560100_+	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	26.8	8.6e-164
WP_031600150.1|2560112_2570864_+	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.4	9.8e-168
WP_033882233.1|2570900_2574728_+	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.4	2.2e-90
>prophage 188
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2578500	2582320	4142593		Streptococcus_phage(50.0%)	4	NA	NA
WP_014478810.1|2578500_2579835_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	37.9	1.0e-66
WP_014478811.1|2579829_2580504_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_003234545.1|2580608_2581256_-	YitT family protein	NA	NA	NA	NA	NA
WP_003246629.1|2581576_2582320_-	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	37.7	5.4e-33
>prophage 189
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2588602	2592105	4142593		Acinetobacter_phage(50.0%)	2	NA	NA
WP_014478820.1|2588602_2590081_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.6	2.1e-81
WP_014478821.1|2590350_2592105_+	hypothetical protein	NA	U5PSS0	Bacillus_phage	41.5	9.8e-126
>prophage 190
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2596564	2607375	4142593		Bacillus_phage(50.0%)	12	NA	NA
WP_014478826.1|2596564_2597245_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.4	7.4e-05
WP_014478827.1|2597260_2598721_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003246532.1|2598933_2599617_+	two-component system response regulator YclJ	NA	W8CYM9	Bacillus_phage	40.4	3.6e-44
WP_072173981.1|2599603_2601025_+	two-component system sensor histidine kinase YclK	NA	W8CYF6	Bacillus_phage	35.0	6.0e-41
WP_014475800.1|2601187_2602336_+	response regulator aspartate phosphatase RapC	NA	A0A1P8CWN8	Bacillus_phage	44.6	2.2e-78
WP_003224994.1|2602319_2602442_+	phosphatase RapC inhibitor PhrC	NA	NA	NA	NA	NA
WP_015482794.1|2602540_2602630_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_014478831.1|2602711_2602825_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_014478832.1|2602977_2604342_-	aspartate kinase	NA	NA	NA	NA	NA
WP_014475804.1|2604732_2605683_+	petrobactin ABC transporter permease YclN	NA	A0A2H4IY97	uncultured_Caudovirales_phage	54.8	2.4e-94
WP_014475805.1|2605675_2606623_+	petrobactin ABC transporter permease YclO	NA	NA	NA	NA	NA
WP_014475806.1|2606616_2607375_+	petrobactin ABC transporter ATP-binding protein YclP	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.6	1.5e-19
>prophage 191
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2615093	2619652	4142593		Klosneuvirus(50.0%)	4	NA	NA
WP_014478840.1|2615093_2616404_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.2	8.9e-23
WP_014478841.1|2616472_2617861_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003234455.1|2617983_2618847_+	glucose uptake protein GlcU	NA	NA	NA	NA	NA
WP_014478842.1|2618866_2619652_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	2.2e-24
>prophage 192
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2642952	2646095	4142593		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014478863.1|2642952_2644464_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	9.9e-42
WP_072592622.1|2644483_2645029_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014478865.1|2645234_2646095_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	2.8e-57
>prophage 193
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2650086	2654623	4142593		Streptococcus_phage(33.33%)	3	NA	NA
WP_014478870.1|2650086_2652270_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	9.2e-41
WP_014478871.1|2652382_2652832_+	8-oxo-dGTP diphosphatase MutT	NA	E5EYY7	Acinetobacter_phage	50.0	8.3e-05
WP_014478872.1|2652898_2654623_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	25.8	1.2e-35
>prophage 194
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2669379	2670306	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014478890.1|2669379_2670306_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	5.9e-37
>prophage 195
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2674224	2674545	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003234326.1|2674224_2674545_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	2.2e-07
>prophage 196
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2677628	2679113	4142593		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003246685.1|2677628_2679113_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
>prophage 197
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2685344	2685695	4142593		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|2685344_2685695_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 198
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2689271	2690060	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_003246715.1|2689271_2690060_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
>prophage 199
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2694537	2702767	4142593	integrase	Listeria_phage(33.33%)	12	2688830:2688845	2710939:2710954
2688830:2688845	attL	AATAATGCTGATTACA	NA	NA	NA	NA
WP_003234309.1|2694537_2694990_+	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	3.8e-05
WP_014478905.1|2695921_2697028_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	34.2	4.8e-38
WP_014478906.1|2697040_2697550_-	metallopeptidase ImmA	NA	NA	NA	NA	NA
WP_003240393.1|2697546_2697930_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	36.9	1.2e-12
WP_003240395.1|2698203_2698398_+	ICEBs1 excisionase	NA	NA	NA	NA	NA
WP_048356433.1|2698394_2698655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003240400.1|2698708_2698969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121517044.1|2699171_2699300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009966619.1|2699335_2699716_+	helicase processivity factor HelP	NA	NA	NA	NA	NA
WP_041516314.1|2699751_2701194_+	coupling conjugation protein ConQ	NA	A0A1S5SFB5	Streptococcus_phage	50.9	4.3e-119
WP_014478909.1|2701186_2702245_+	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	40.6	1.6e-62
WP_014478910.1|2702515_2702767_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	55.7	6.9e-17
2710939:2710954	attR	TGTAATCAGCATTATT	NA	NA	NA	NA
>prophage 200
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2711401	2714745	4142593		Streptococcus_phage(50.0%)	4	NA	NA
WP_072592581.1|2711401_2712391_+	transglycosylase SLT domain-containing protein	NA	A0A1S5SEZ8	Streptococcus_phage	43.2	5.4e-65
WP_031600193.1|2712405_2712912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592623.1|2712974_2713355_+	DUF4467 domain-containing protein	NA	NA	NA	NA	NA
WP_014478924.1|2713569_2714745_+	response regulator aspartate phosphatase RapI	NA	A0A1P8CWN8	Bacillus_phage	34.2	3.2e-56
>prophage 201
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2723964	2730474	4142593		Bacillus_phage(66.67%)	7	NA	NA
WP_014478934.1|2723964_2725686_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	56.8	2.5e-134
WP_003240464.1|2726166_2726400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009966645.1|2727570_2727747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399401.1|2727771_2728458_+	hypothetical protein	NA	O64048	Bacillus_phage	98.2	2.7e-124
WP_009966647.1|2728882_2729068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478936.1|2729417_2730011_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003234247.1|2730273_2730474_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
>prophage 202
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2735414	2736299	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014478943.1|2735414_2736299_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	32.6	1.3e-33
>prophage 203
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2748158	2751260	4142593		Streptococcus_phage(50.0%)	3	NA	NA
WP_014478959.1|2748158_2749031_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	8.2e-33
WP_014478961.1|2749604_2749940_+	metal-responsive transcriptional regulator AseR	NA	NA	NA	NA	NA
WP_014478962.1|2749952_2751260_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	67.1	7.5e-155
>prophage 204
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2760531	2761173	4142593		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_014478974.1|2760531_2761173_+	two-component system response regulator YdfI	NA	Q6XM27	Feldmannia_irregularis_virus	30.5	5.7e-07
>prophage 205
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2770780	2772133	4142593	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_014478984.1|2770780_2772133_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 206
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2777838	2779485	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014478996.1|2777838_2779485_-	ABC-F type ribosomal protection protein VmlR	NA	Q6DMX7	Streptococcus_phage	32.3	4.2e-54
>prophage 207
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2785298	2785928	4142593		Clostridioides_phage(100.0%)	1	NA	NA
WP_003234135.1|2785298_2785928_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
>prophage 208
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2791206	2792394	4142593		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_014479002.1|2791206_2792394_+	glycosyltransferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	29.1	2.3e-09
>prophage 209
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2801695	2803093	4142593		Pandoravirus(100.0%)	1	NA	NA
WP_014479015.1|2801695_2803093_+	6-phospho-beta-glucosidase GmuD	NA	A0A0B5JD41	Pandoravirus	29.1	2.1e-46
>prophage 210
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2815993	2824791	4142593	tRNA,protease	uncultured_virus(40.0%)	10	NA	NA
WP_003234076.1|2815993_2817034_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	8.8e-66
WP_014479025.1|2817259_2819188_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	5.3e-56
WP_003243499.1|2819313_2819826_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003234073.1|2819822_2820470_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003234072.1|2820491_2820665_+	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_072592586.1|2820671_2821436_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
WP_003225680.1|2821667_2821859_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003234069.1|2821855_2822590_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|2822828_2823113_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003234067.1|2823159_2824791_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	3.7e-159
>prophage 211
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2844144	2923924	4142593	tRNA,transposase,coat	Synechococcus_phage(13.64%)	67	NA	NA
WP_087614160.1|2844144_2845295_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479044.1|2845407_2845566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003234008.1|2845755_2845965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479045.1|2846047_2846863_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.8	2.4e-10
WP_014479048.1|2847961_2849503_-|coat	outer spore coat copper-dependent laccase CotA	coat	NA	NA	NA	NA
WP_014479049.1|2849651_2851061_-	GABA permease	NA	NA	NA	NA	NA
WP_009966725.1|2851098_2851386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479050.1|2851458_2852331_+	manganese transporter MneS	NA	NA	NA	NA	NA
WP_014479051.1|2852481_2853444_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014479052.1|2853443_2854640_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_014479053.1|2854661_2856875_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_003244399.1|2857037_2858579_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
WP_014479055.1|2858810_2859590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479056.1|2860217_2861540_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	31.2	5.2e-39
WP_014479057.1|2861750_2862554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479058.1|2862712_2862880_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_009966729.1|2863093_2863648_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003219403.1|2863647_2863845_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003244134.1|2864167_2864656_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_014479059.1|2864648_2865791_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003233955.1|2865787_2867083_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014479060.1|2867156_2867882_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|2867874_2868129_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|2868125_2868809_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003233949.1|2868792_2871021_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003233947.1|2870996_2872427_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_014479061.1|2872528_2873569_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_014479062.1|2873565_2874153_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_014479063.1|2874149_2875688_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.0e-78
WP_014479064.1|2875703_2876972_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_014479065.1|2877009_2877432_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479066.1|2877575_2878850_+	amino acid permease	NA	NA	NA	NA	NA
WP_014479068.1|2879220_2880963_+	adenine deaminase	NA	NA	NA	NA	NA
WP_014479069.1|2880989_2881985_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_014479070.1|2881987_2882302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600238.1|2882336_2883914_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_014479073.1|2884178_2884865_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_014479074.1|2884926_2887146_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.2e-134
WP_014479075.1|2887169_2889176_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.3	3.1e-128
WP_014479076.1|2889191_2890382_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_087614160.1|2890498_2891648_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_072592588.1|2891834_2892845_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_010886431.1|2892882_2893581_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
WP_003242814.1|2893686_2895165_-	proline transporter OpuE	NA	NA	NA	NA	NA
WP_003219442.1|2895578_2895869_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_014479078.1|2895884_2897342_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003219444.1|2897355_2898786_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_014479079.1|2898822_2899671_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479080.1|2899802_2902961_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
WP_003233894.1|2903111_2904023_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_031600241.1|2904332_2905709_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.6	3.6e-115
WP_014479083.1|2907030_2907240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029317421.1|2907473_2910491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479085.1|2910919_2911117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479086.1|2911715_2912189_-	TIGR01741 family protein	NA	NA	NA	NA	NA
WP_031600245.1|2912193_2914203_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	57.4	3.7e-145
WP_014479091.1|2915579_2916710_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	45.9	9.8e-87
WP_003242557.1|2916699_2916873_+	phosphatase RapH inhibitor PhrH	NA	NA	NA	NA	NA
WP_003233863.1|2917032_2917752_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049832634.1|2917885_2918503_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479093.1|2918617_2919202_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479094.1|2919378_2919627_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014479095.1|2919610_2919874_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014479096.1|2919888_2920458_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_014479097.1|2920582_2921125_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031600250.1|2921564_2922194_+	YesL family protein	NA	NA	NA	NA	NA
WP_014479101.1|2922190_2923924_+	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.5	6.9e-23
>prophage 212
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2952715	2964377	4142593	transposase	uncultured_Caudovirales_phage(20.0%)	7	NA	NA
WP_041516347.1|2952715_2954188_+	hypothetical protein	NA	A0A2H4JCX8	uncultured_Caudovirales_phage	34.0	3.2e-05
WP_031600262.1|2954274_2955522_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479133.1|2955631_2956705_-	DUF3900 domain-containing protein	NA	NA	NA	NA	NA
WP_014479134.1|2956849_2960035_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	3.0e-80
WP_033881176.1|2960481_2962401_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.5	1.0e-128
WP_014479136.1|2962637_2963402_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003244102.1|2963408_2964377_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
>prophage 213
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2972730	2982600	4142593	transposase	uncultured_Caudovirales_phage(20.0%)	8	NA	NA
WP_003233767.1|2972730_2973591_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.2e-09
WP_014479142.1|2973725_2975615_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	31.9	6.1e-41
WP_014476106.1|2975737_2976184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479143.1|2976308_2976731_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479144.1|2976796_2977987_+	MFS transporter	NA	NA	NA	NA	NA
WP_087614160.1|2978524_2979674_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479146.1|2979740_2981297_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	9.5e-56
WP_014479147.1|2981469_2982600_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.9	2.8e-41
>prophage 214
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2993808	2993946	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_003239885.1|2993808_2993946_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	58.1	1.1e-05
>prophage 215
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	2997062	2999012	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014479159.1|2997062_2999012_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	43.2	2.2e-134
>prophage 216
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3012109	3013259	4142593	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_087614160.1|3012109_3013259_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 217
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3026437	3027838	4142593		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003233644.1|3026437_3027838_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.6	2.9e-88
>prophage 218
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3038886	3039213	4142593		uncultured_virus(100.0%)	1	NA	NA
WP_014479184.1|3038886_3039213_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	41.5	1.6e-13
>prophage 219
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3046964	3053242	4142593		Bacillus_phage(100.0%)	3	NA	NA
WP_014479191.1|3046964_3049298_+	hypothetical protein	NA	Q9ZXE2	Bacillus_phage	38.1	7.9e-131
WP_014479192.1|3049712_3051434_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.1e-52
WP_014479193.1|3051427_3053242_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.7e-56
>prophage 220
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3061677	3062613	4142593		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014479200.1|3061677_3062613_+	linearmycin resistance ATP-binding protein LnrL	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.2	6.3e-31
>prophage 221
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3069803	3070340	4142593		Paenibacillus_phage(100.0%)	1	NA	NA
WP_014479208.1|3069803_3070340_+	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	46.0	2.9e-20
>prophage 222
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3085602	3087683	4142593		Mycobacterium_phage(50.0%)	2	NA	NA
WP_014479220.1|3085602_3086463_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.4	5.0e-06
WP_003244113.1|3086693_3087683_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	42.4	1.5e-59
>prophage 223
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3095225	3096968	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_009966836.1|3095225_3096968_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.5e-46
>prophage 224
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3114291	3116917	4142593		Tupanvirus(50.0%)	2	NA	NA
WP_014476225.1|3114291_3115743_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.3	9.0e-109
WP_014479236.1|3116149_3116917_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	5.5e-33
>prophage 225
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3127908	3131162	4142593		Thermus_phage(50.0%)	2	NA	NA
WP_003239626.1|3127908_3129804_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.5	1.4e-101
WP_003233432.1|3129983_3131162_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.3	6.5e-25
>prophage 226
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3136356	3150689	4142593	integrase	Bacillus_phage(37.5%)	18	3132232:3132248	3153307:3153323
3132232:3132248	attL	AGAAACAGATATTGCGG	NA	NA	NA	NA
WP_014479253.1|3136356_3137055_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.8e-22
WP_014479254.1|3137071_3137989_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	1.6e-39
WP_014479255.1|3137981_3138923_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003224086.1|3139014_3139218_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	1.2e-16
WP_014479256.1|3139653_3140484_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014479257.1|3140486_3141566_-	diguanylate cyclase DgcK	NA	A0A127AWB9	Bacillus_phage	37.0	5.8e-20
WP_003244685.1|3141738_3143130_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_014479259.1|3143456_3145076_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	7.8e-77
WP_014479260.1|3145087_3145504_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.3	7.9e-26
WP_123772460.1|3145551_3146142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479262.1|3146292_3146775_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_033882184.1|3146853_3147063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479264.1|3147189_3147894_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	33.6	1.6e-23
WP_014479265.1|3148020_3148158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479266.1|3148376_3149273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033882182.1|3149429_3149729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157669810.1|3149914_3150289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832636.1|3150386_3150689_+	XRE family transcriptional regulator	NA	A0A172JIG2	Bacillus_phage	63.4	4.1e-16
3153307:3153323	attR	AGAAACAGATATTGCGG	NA	NA	NA	NA
>prophage 227
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3158357	3162664	4142593		Streptococcus_phage(50.0%)	5	NA	NA
WP_033881969.1|3158357_3159347_+	transglycosylase SLT domain-containing protein	NA	A0A1S5SEZ8	Streptococcus_phage	41.9	1.6e-64
WP_031600318.1|3159361_3159868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881966.1|3159930_3160314_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_014479271.1|3160411_3161200_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_014479273.1|3161491_3162664_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	34.3	2.1e-52
>prophage 228
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3170103	3172867	4142593		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_003244785.1|3170103_3171012_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	1.1e-06
WP_003233401.1|3171122_3171518_+	YhcU family protein	NA	NA	NA	NA	NA
WP_014479280.1|3171654_3172077_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.0	6.0e-13
WP_014479281.1|3172204_3172867_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.6	5.9e-07
>prophage 229
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3176978	3177803	4142593		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_014479285.1|3176978_3177803_+	glycerol uptake facilitator protein GlpF	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.1e-31
>prophage 230
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3181251	3182997	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_014479288.1|3181251_3182997_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	49.3	5.5e-161
>prophage 231
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3186272	3187733	4142593		Clostridioides_phage(100.0%)	1	NA	NA
WP_014479292.1|3186272_3187733_-	peptidoglycan endopeptidase LytF	NA	A0A1V0DZX6	Clostridioides_phage	41.7	3.8e-14
>prophage 232
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3193471	3197574	4142593		Bacillus_virus(50.0%)	4	NA	NA
WP_003244816.1|3193471_3194476_+	peptidoglycan endopeptidase LytE	NA	M1HNA7	Bacillus_virus	43.8	3.4e-14
WP_003233357.1|3194546_3195422_-	transcriptional regulator CitR	NA	NA	NA	NA	NA
WP_014479297.1|3195530_3196631_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_014479298.1|3196704_3197574_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.1	3.3e-58
>prophage 233
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3211782	3215313	4142593		Staphylococcus_phage(33.33%)	5	NA	NA
WP_014479308.1|3211782_3212178_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	8.9e-11
WP_014479309.1|3212164_3212896_-	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	29.5	5.9e-16
WP_009966908.1|3213129_3213237_+	YhdX family protein	NA	NA	NA	NA	NA
WP_014479310.1|3213384_3214500_+	small-conductance mechanosensitive channel protein MscY	NA	NA	NA	NA	NA
WP_014479311.1|3214569_3215313_+	sirtuin NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	31.2	1.4e-20
>prophage 234
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3219793	3226375	4142593	transposase	Bacillus_phage(75.0%)	6	NA	NA
WP_014479317.1|3219793_3221551_+	multidrug ABC transporter ATP-binding protein BmrC	NA	W8CYL7	Bacillus_phage	29.9	5.9e-54
WP_014479318.1|3221547_3223569_+	multidrug resistance ABC transporter ATP-binding protein/permease BmrD	NA	W8CYL7	Bacillus_phage	28.7	5.9e-42
WP_014479319.1|3223618_3224239_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003245136.1|3224277_3224403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003233287.1|3224507_3224711_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.6	4.5e-19
WP_014478984.1|3225022_3226375_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 235
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3230803	3231157	4142593		Streptococcus_phage(100.0%)	1	NA	NA
WP_003224239.1|3230803_3231157_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	4.5e-06
>prophage 236
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3238646	3239543	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003233262.1|3238646_3239543_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.7e-25
>prophage 237
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3251349	3254244	4142593		Streptococcus_phage(50.0%)	3	NA	NA
WP_014479338.1|3251349_3252429_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	1.8e-82
WP_003233231.1|3252575_3253013_-	HIT family protein	NA	NA	NA	NA	NA
WP_003233230.1|3253500_3254244_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	9.2e-25
>prophage 238
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3277047	3281636	4142593		Staphylococcus_phage(50.0%)	4	NA	NA
WP_017695353.1|3277047_3278589_+	long-chain-fatty-acid--CoA ligase LcfB	NA	A0A2H4PQM9	Staphylococcus_phage	28.0	1.7e-44
WP_014479359.1|3278627_3279023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003233175.1|3279171_3280452_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014479360.1|3280490_3281636_-	subtilisin AprE	NA	A0A217EQY2	Bacillus_phage	48.8	9.4e-53
>prophage 239
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3286549	3294693	4142593		Trichoplusia_ni_ascovirus(50.0%)	7	NA	NA
WP_014479366.1|3286549_3287989_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	3.6e-25
WP_003233151.1|3287995_3288556_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_014479367.1|3288690_3289989_-	heme-based aerotactic transducer HemAT	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.7	2.6e-06
WP_014479371.1|3291759_3292617_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	46.1	7.8e-52
WP_003233142.1|3292644_3292878_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_003245329.1|3293170_3293749_+	competence transcription factor ComK	NA	NA	NA	NA	NA
WP_014479372.1|3293793_3294693_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.6	8.7e-70
>prophage 240
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3305091	3306417	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_014479381.1|3305091_3306417_-	3-dehydro-glucose-6-phosphate--glutamate transaminase	NA	A0A2K9L0G1	Tupanvirus	27.5	9.6e-25
>prophage 241
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3312155	3313508	4142593	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_014478984.1|3312155_3313508_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 242
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3318189	3326524	4142593		Bacillus_virus(100.0%)	3	NA	NA
WP_014479389.1|3318189_3321888_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.4	6.6e-15
WP_014479390.1|3321959_3323135_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_014479391.1|3323131_3326524_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.1	1.5e-10
>prophage 243
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3332172	3337459	4142593	protease	Bacillus_phage(50.0%)	3	NA	NA
WP_014479398.1|3332172_3334857_+|protease	cell wall-associated protease WprA	protease	A0A217EQY2	Bacillus_phage	37.0	8.2e-31
WP_072592592.1|3334887_3335469_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_014479400.1|3335614_3337459_+	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	24.6	3.2e-34
>prophage 244
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3346663	3347470	4142593		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014479411.1|3346663_3347470_+	alpha/beta hydrolase	NA	A0A0A1ELD0	Mycobacterium_phage	26.5	3.3e-12
>prophage 245
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3352526	3353378	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014479418.1|3352526_3353378_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.1	1.6e-12
>prophage 246
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3357452	3357623	4142593		Bacteriophage(100.0%)	1	NA	NA
WP_003232996.1|3357452_3357623_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	60.0	9.4e-10
>prophage 247
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3362925	3365215	4142593		Klosneuvirus(50.0%)	2	NA	NA
WP_014479429.1|3362925_3364083_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.2	4.3e-29
WP_014479430.1|3364153_3365215_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	40.1	6.0e-62
>prophage 248
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3368287	3425676	4142593	tRNA,transposase,coat	Bacillus_phage(25.0%)	68	NA	NA
WP_014479432.1|3368287_3369247_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.6	1.2e-21
WP_087614160.1|3369294_3370445_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003245356.1|3370622_3370802_+	YjzC family protein	NA	NA	NA	NA	NA
WP_003245236.1|3370847_3371033_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
WP_014479433.1|3371281_3372016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479435.1|3372097_3372655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479436.1|3372745_3373699_+	transcriptional regulator Med	NA	NA	NA	NA	NA
WP_003224559.1|3373713_3373905_+	ComG operon repressor	NA	NA	NA	NA	NA
WP_031600361.1|3373934_3374162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232971.1|3374326_3375265_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014479438.1|3375287_3376529_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014479439.1|3376604_3377390_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|3377581_3378568_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|3378564_3379554_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_014479440.1|3379641_3381273_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003245828.1|3381348_3382299_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_014479441.1|3382315_3383227_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|3383432_3384185_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|3384219_3385212_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014479443.1|3385955_3387593_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_014479444.1|3387700_3388636_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|3388639_3389557_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|3389561_3390638_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|3390639_3391557_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_072592593.1|3391664_3392882_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|3393045_3393624_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|3393804_3394200_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014479447.1|3394242_3394899_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|3395068_3395209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479448.1|3395175_3395832_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|3395826_3395949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479449.1|3395992_3397144_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_014479450.1|3397190_3399203_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|3399240_3399408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|3399722_3400622_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|3400618_3401017_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072592594.1|3401271_3401817_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
WP_014479452.1|3402020_3402593_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014479453.1|3402717_3403086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|3403114_3403750_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|3403768_3404569_+	NAD kinase	NA	NA	NA	NA	NA
WP_072592595.1|3404631_3405483_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232912.1|3405495_3406230_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
WP_014479455.1|3406464_3408309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479456.1|3408557_3409268_+	thiaminase II	NA	NA	NA	NA	NA
WP_014479457.1|3409242_3409860_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_014479458.1|3409843_3410953_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072592596.1|3410952_3411153_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_072592522.1|3411149_3411920_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014479461.1|3411916_3412927_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|3412945_3413761_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|3413896_3414673_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_031600370.1|3414773_3415457_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|3415549_3415999_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|3416126_3416615_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|3416766_3417249_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_014479467.1|3417333_3417654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|3417693_3418080_-|coat	spore coat protein V	coat	NA	NA	NA	NA
WP_014476457.1|3418239_3418596_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_014479470.1|3418877_3419084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232872.1|3419165_3419315_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_014479471.1|3419447_3419702_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_014479472.1|3419775_3422055_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
WP_003232866.1|3422171_3422426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479473.1|3422498_3422921_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232861.1|3422924_3423440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245358.1|3423476_3424199_-	esterase family protein	NA	NA	NA	NA	NA
WP_003232857.1|3424554_3425676_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
>prophage 249
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3430716	3434882	4142593		Bacillus_phage(66.67%)	5	NA	NA
WP_010329852.1|3430716_3431064_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
WP_014479480.1|3431076_3431598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479481.1|3431960_3432332_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
WP_106610850.1|3432497_3432773_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014479483.1|3433712_3434882_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	2.0e-87
>prophage 250
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3442310	3447390	4142593	transposase	Bacillus_phage(66.67%)	4	NA	NA
WP_014479496.1|3442310_3443426_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	2.4e-146
WP_031600385.1|3443773_3445549_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.3	5.8e-126
WP_014479498.1|3445551_3446010_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_031600262.1|3446142_3447390_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 251
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3460548	3461760	4142593	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_031600391.1|3460548_3461760_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
>prophage 252
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3477990	3481934	4142593		Leucania_separata_nucleopolyhedrovirus(33.33%)	5	NA	NA
WP_014479528.1|3477990_3479169_+	hypothetical protein	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	9.5e-08
WP_003232781.1|3479209_3479398_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_014479529.1|3479571_3480384_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232776.1|3480429_3481182_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003232774.1|3481181_3481934_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
>prophage 253
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3491993	3492830	4142593		Moumouvirus(100.0%)	1	NA	NA
WP_003232752.1|3491993_3492830_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
>prophage 254
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3501018	3535898	4142593	transposase,portal,terminase,plate,tail,holin	uncultured_Caudovirales_phage(32.35%)	45	NA	NA
WP_087614160.1|3501018_3502169_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_015252291.1|3502581_3503718_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|3503707_3503842_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|3504239_3505193_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|3505232_3505610_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|3505714_3506317_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|3506393_3507230_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|3507273_3507870_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|3508032_3508374_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|3508552_3508732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232710.1|3508718_3509555_+	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_072592528.1|3509454_3510255_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|3510254_3510422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479549.1|3510506_3510857_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|3510853_3511060_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014479550.1|3511175_3511685_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_003244697.1|3511800_3512598_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003232697.1|3512594_3513896_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_003232695.1|3513899_3515387_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_014479551.1|3515406_3516234_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|3516259_3517195_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|3517216_3517600_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|3517596_3517953_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|3517949_3518435_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_014479553.1|3518447_3518888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|3518891_3519110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479554.1|3519106_3520507_+	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
WP_014479555.1|3520508_3520952_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
WP_014479556.1|3521043_3521490_+	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479557.1|3521531_3521672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600410.1|3521672_3526676_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
WP_014479559.1|3526668_3527328_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|3527343_3528321_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|3528320_3528587_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_014479560.1|3528644_3529070_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_003232669.1|3529062_3530109_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_014476551.1|3530092_3530671_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232665.1|3530667_3530940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479561.1|3530942_3533006_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_014479562.1|3533017_3533347_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
WP_014479563.1|3533343_3533508_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_014479564.1|3533554_3534394_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|3534446_3534716_+	phage-like element PBSX protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|3534728_3534992_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_014479567.1|3535004_3535898_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 255
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3544125	3546946	4142593	protease	Salmonella_phage(50.0%)	2	NA	NA
WP_014479573.1|3544125_3545097_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
WP_033881739.1|3545596_3546946_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
>prophage 256
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3550802	3551810	4142593		Planktothrix_phage(100.0%)	1	NA	NA
WP_014479578.1|3550802_3551810_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
>prophage 257
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3555601	3557494	4142593		Clostridium_phage(50.0%)	2	NA	NA
WP_014479583.1|3555601_3556492_+	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	45.8	5.3e-19
WP_003232600.1|3556504_3557494_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
>prophage 258
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3566158	3581672	4142593	protease	Streptococcus_phage(33.33%)	15	NA	NA
WP_014479591.1|3566158_3567256_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_014479592.1|3567267_3568515_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
WP_003232574.1|3568640_3569066_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014479593.1|3569096_3569540_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_014479594.1|3569681_3570092_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245084.1|3570339_3570810_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_014479596.1|3570984_3573273_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014479598.1|3573688_3574648_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_003232560.1|3574870_3575704_+	RsbT co-antagonist RsbRB	NA	NA	NA	NA	NA
WP_014479600.1|3575734_3576499_-	HMP/thiamine ABC transporter permease ThiX	NA	NA	NA	NA	NA
WP_014479601.1|3576473_3578117_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-18
WP_003232554.1|3578103_3578703_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014479602.1|3578704_3579307_-	HMP/thiamine ABC transporter substrate-binding protein ThiU	NA	NA	NA	NA	NA
WP_003232551.1|3579617_3580304_+	two-component system response regulator YkoG	NA	NA	NA	NA	NA
WP_014479603.1|3580307_3581672_+	two-component system sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	29.0	7.1e-15
>prophage 259
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3591142	3594956	4142593		Salmonella_phage(50.0%)	3	NA	NA
WP_014479611.1|3591142_3592156_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	41.3	5.4e-52
WP_031600436.1|3592181_3594017_-	DNA ligase D	NA	NA	NA	NA	NA
WP_031600437.1|3594020_3594956_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.4	2.2e-44
>prophage 260
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3598317	3601658	4142593		Bacillus_phage(100.0%)	4	NA	NA
WP_014479617.1|3598317_3599292_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	41.9	2.5e-30
WP_003245855.1|3599555_3600311_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_014479618.1|3600307_3601453_+	anti-sigma-I factor RsgI	NA	NA	NA	NA	NA
WP_003218568.1|3601463_3601658_-	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	66.7	1.4e-14
>prophage 261
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3605204	3611176	4142593	transposase	Streptococcus_phage(33.33%)	6	NA	NA
WP_014478984.1|3605204_3606557_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_003232510.1|3606801_3606957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479620.1|3606959_3607136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479621.1|3607190_3608213_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003232504.1|3608465_3610682_+	sporulation two-component system sensor histidine kinase KinE	NA	W8CYF6	Bacillus_phage	29.8	8.8e-23
WP_003232502.1|3610678_3611176_+	methylated-DNA--protein-cysteine methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.5	5.9e-20
>prophage 262
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3624878	3643402	4142593	protease	Enterobacteria_phage(25.0%)	18	NA	NA
WP_017695065.1|3624878_3626978_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.9	1.4e-131
WP_014479636.1|3627345_3628389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479637.1|3628701_3629361_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	6.2e-65
WP_003232462.1|3629353_3629803_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_014479638.1|3629795_3630527_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	1.7e-55
WP_003218613.1|3630544_3631042_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	1.4e-56
WP_014479639.1|3631362_3631653_+	YkvR family protein	NA	NA	NA	NA	NA
WP_003232446.1|3631774_3631960_-	YkvS family protein	NA	NA	NA	NA	NA
WP_003218622.1|3632125_3632320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479640.1|3632618_3633245_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	52.7	1.8e-26
WP_003245552.1|3633362_3634700_+	sporulation protein YkvU	NA	NA	NA	NA	NA
WP_014479641.1|3634750_3635248_+	sporulation thiol-disulfide oxidoreductase StoA	NA	NA	NA	NA	NA
WP_014479642.1|3635483_3637397_+	metal-transporting ATPase PfeT	NA	E4ZFI9	Streptococcus_phage	40.7	1.4e-117
WP_014476643.1|3637435_3637639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479643.1|3637804_3638899_+	di/tri-peptidase	NA	NA	NA	NA	NA
WP_014479644.1|3639180_3640146_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	9.8e-19
WP_014479645.1|3640208_3641075_+	ptsGHI operon transcription antiterminator GlcT	NA	NA	NA	NA	NA
WP_014479646.1|3641302_3643402_+	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	50.0	2.0e-08
>prophage 263
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3647742	3660009	4142593	transposase	uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_014479648.1|3647742_3649710_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.4	1.8e-11
WP_014479649.1|3649847_3650714_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031600262.1|3650860_3652108_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479651.1|3652180_3652903_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	68.3	3.1e-33
WP_014479652.1|3653239_3655360_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_014479653.1|3655523_3657353_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.1e-07
WP_014479654.1|3657349_3658531_-	aminotransferase A	NA	NA	NA	NA	NA
WP_003245246.1|3658732_3658894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476655.1|3659097_3660009_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	8.0e-47
>prophage 264
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3663564	3664329	4142593		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003232398.1|3663564_3664329_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.0	1.0e-39
>prophage 265
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3669155	3670986	4142593		Bacillus_phage(100.0%)	3	NA	NA
WP_014479661.1|3669155_3669632_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	3.2e-15
WP_014479662.1|3669621_3670515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479663.1|3670530_3670986_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.9	1.3e-13
>prophage 266
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3674990	3677696	4142593	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_014479665.1|3674990_3675437_+	thiol-disulfide oxidoreductase YkuV	NA	A0A127AW88	Bacillus_phage	47.9	5.9e-35
WP_003232378.1|3675902_3676478_+	transcriptional regulator Rok	NA	NA	NA	NA	NA
WP_087614160.1|3676545_3677696_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 267
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3685063	3689514	4142593		Bacillus_phage(50.0%)	4	NA	NA
WP_014479676.1|3685063_3686878_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	7.2e-55
WP_014479677.1|3686987_3687683_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_014479678.1|3687687_3688821_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014479679.1|3688821_3689514_+	ABC transporter ATP-binding protein YknY	NA	G9BWD6	Planktothrix_phage	39.9	1.3e-36
>prophage 268
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3695778	3697401	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_003232344.1|3695778_3697401_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
>prophage 269
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3701269	3703021	4142593		Paenibacillus_phage(50.0%)	2	NA	NA
WP_003244728.1|3701269_3701548_+	transcriptional regulator AbhA	NA	A0A2I7SC16	Paenibacillus_phage	47.3	7.4e-12
WP_014479686.1|3701737_3703021_+	two-component sensor histidine kinase KinC	NA	W8CYF6	Bacillus_phage	30.1	1.1e-20
>prophage 270
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3708787	3710152	4142593		Lactococcus_phage(50.0%)	2	NA	NA
WP_014479690.1|3708787_3709561_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.6	2.0e-06
WP_003245474.1|3709597_3710152_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.2e-14
>prophage 271
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3715273	3716686	4142593		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003232309.1|3715273_3716686_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.5e-44
>prophage 272
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3730937	3735610	4142593		Streptococcus_phage(50.0%)	5	NA	NA
WP_003232278.1|3730937_3732776_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
WP_003232274.1|3732832_3733150_+	membrane protein	NA	NA	NA	NA	NA
WP_003232271.1|3733205_3733415_-	YlaI family protein	NA	NA	NA	NA	NA
WP_014479704.1|3733497_3734127_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014479705.1|3734281_3735610_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.5	6.2e-56
>prophage 273
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3751201	3755386	4142593		Bacillus_phage(50.0%)	7	NA	NA
WP_014479713.1|3751201_3752242_+	CAP domain-containing protein	NA	U5Q1E2	Bacillus_phage	39.5	9.9e-17
WP_003232233.1|3752473_3752872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232231.1|3752887_3753127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003221370.1|3753242_3753692_+	competence/sporulation regulator complex protein RicF	NA	NA	NA	NA	NA
WP_009967171.1|3753746_3754019_+	YlbG family protein	NA	NA	NA	NA	NA
WP_033881642.1|3754341_3754896_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003245283.1|3754900_3755386_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	3.2e-26
>prophage 274
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3784103	3792175	4142593		Bacillus_phage(75.0%)	5	NA	NA
WP_014479728.1|3784103_3788405_+	bacillopeptidase F	NA	A0A217EQY2	Bacillus_phage	32.1	4.5e-23
WP_014479729.1|3788599_3789529_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_003221446.1|3789591_3790311_+	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.3	8.1e-18
WP_033881656.1|3790450_3791233_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	7.6e-46
WP_014479731.1|3791380_3792175_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.8e-11
>prophage 275
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3798175	3808559	4142593	tRNA	Moumouvirus(25.0%)	9	NA	NA
WP_014479739.1|3798175_3800941_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.0	1.0e-81
WP_014479740.1|3801084_3801459_+	sporulation-related RNA polymerase-binding protein YlyA	NA	NA	NA	NA	NA
WP_014479741.1|3801561_3802020_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_014479742.1|3802021_3802933_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232127.1|3803115_3803661_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033881657.1|3803834_3805139_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.7	4.5e-59
WP_014479744.1|3805283_3806198_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	36.0	1.3e-36
WP_003232117.1|3806181_3807468_+	dihydroorotase	NA	NA	NA	NA	NA
WP_003232115.1|3807464_3808559_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.2	1.5e-60
>prophage 276
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3814127	3818770	4142593		Pandoravirus(33.33%)	5	NA	NA
WP_031600492.1|3814127_3814778_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	37.9	8.0e-33
WP_003221498.1|3815189_3815891_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_014479750.1|3815902_3816967_+	sulfate permease	NA	NA	NA	NA	NA
WP_014479751.1|3817015_3818164_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.2	1.0e-38
WP_003232097.1|3818176_3818770_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	41.9	3.3e-09
>prophage 277
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3822772	3832760	4142593	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	9	NA	NA
WP_014479756.1|3822772_3825445_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	6.8e-86
WP_009967215.1|3825527_3826403_+	YicC family protein	NA	NA	NA	NA	NA
WP_003154355.1|3826479_3826749_+	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_003232083.1|3826756_3827371_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.7	1.1e-12
WP_003221520.1|3827374_3827578_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_014479757.1|3827658_3828879_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	4.1e-46
WP_014479758.1|3828875_3831293_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_072592532.1|3831304_3831802_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	3.6e-17
WP_014479760.1|3831806_3832760_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.1e-09
>prophage 278
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3835949	3837896	4142593		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014479763.1|3835949_3837896_+	serine/threonine protein kinase PrkC	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	8.3e-25
>prophage 279
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3849320	3851267	4142593		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_014476789.1|3849320_3850061_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.0e-20
WP_003154310.1|3850144_3850378_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003232030.1|3850517_3851267_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	4.2e-25
>prophage 280
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3862258	3863026	4142593		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_014479773.1|3862258_3863026_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	41.7	6.6e-26
>prophage 281
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3867387	3874887	4142593	tRNA,protease	Thermus_phage(25.0%)	6	NA	NA
WP_014479775.1|3867387_3868281_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	1.3e-28
WP_014479776.1|3868468_3870544_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	39.9	4.7e-103
WP_003244725.1|3870619_3871927_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_014479777.1|3871994_3872909_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.8	1.8e-30
WP_003238555.1|3872921_3873467_+|protease	ATP-dependent protease subunit ClpQ	protease	NA	NA	NA	NA
WP_014476801.1|3873483_3874887_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.0	4.5e-41
>prophage 282
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3901287	3902052	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_003220911.1|3901287_3902052_+	RNA polymerase sigma-28 factor SigD	NA	A0A0A0PIT2	Bacillus_phage	26.0	1.8e-07
>prophage 283
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3906008	3906791	4142593		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003231925.1|3906008_3906791_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	3.7e-24
>prophage 284
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3911927	3923579	4142593	tRNA	Clostridium_phage(33.33%)	10	NA	NA
WP_014479800.1|3911927_3916241_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.2	2.7e-23
WP_003231915.1|3916570_3917041_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003231912.1|3917075_3918191_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_009967250.1|3918204_3918480_+	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003220946.1|3918481_3918784_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_014479801.1|3918803_3920954_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	3.8e-23
WP_003231905.1|3920950_3921229_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_009967251.1|3921245_3921599_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_014479802.1|3921680_3922610_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_014479803.1|3922628_3923579_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.5	2.6e-08
>prophage 285
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3927410	3928640	4142593		Bacillus_virus(100.0%)	1	NA	NA
WP_003245717.1|3927410_3928640_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.1	8.8e-49
>prophage 286
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3937071	3945180	4142593		Mycobacterium_phage(25.0%)	6	NA	NA
WP_014479810.1|3937071_3939435_+	DNA translocase SpoIIIE	NA	A0A218M9A2	Mycobacterium_phage	47.1	1.4e-87
WP_003245732.1|3939578_3940304_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479811.1|3940421_3941654_+	bacillibactin exporter BcbE	NA	NA	NA	NA	NA
WP_014479812.1|3941833_3943114_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	1.3e-50
WP_003244823.1|3943110_3944397_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.9	6.1e-08
WP_003244676.1|3944451_3945180_+	EF-P-5 aminopentanone reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	4.2e-14
>prophage 287
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3949443	3957492	4142593		Bacillus_phage(40.0%)	7	NA	NA
WP_003245789.1|3949443_3950490_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.7	1.9e-137
WP_014479815.1|3950656_3951832_+	serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	24.3	5.5e-08
WP_003221010.1|3952107_3953670_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_014479816.1|3953738_3954533_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_003154135.1|3954732_3954993_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_014479818.1|3955257_3956301_+	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	1.7e-21
WP_014479819.1|3956313_3957492_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	1.7e-49
>prophage 288
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3960541	3966375	4142593		Catovirus(33.33%)	3	NA	NA
WP_014479821.1|3960541_3963118_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_041516431.1|3963133_3965017_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
WP_031600520.1|3966126_3966375_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	4.6e-05
>prophage 289
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	3971529	4071918	4142593	transposase,portal,tRNA,protease,terminase,head,coat,capsid,plate,integrase,tail,holin	Bacillus_phage(57.14%)	113	3974247:3974306	4039025:4039190
WP_041516434.1|3971529_3971904_+	HNH endonuclease	NA	Q38456	Bacillus_phage	87.1	1.3e-64
WP_017697674.1|3972283_3972817_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_031600532.1|3972816_3972984_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	87.5	4.4e-12
WP_031600391.1|3973104_3974316_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
3974247:3974306	attL	ACTGTTCGATAATCTTGTTAGCTAATTCTACGGAGTTCGGATCTCTTTTCAATTTCCCCA	NA	NA	NA	NA
WP_072592534.1|3975362_3975818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479830.1|3975972_3976530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479831.1|3976650_3977265_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|3977403_3977760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592535.1|3977838_3978663_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033881122.1|3978773_3980102_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
WP_014476869.1|3980326_3980560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479835.1|3980839_3981547_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014479836.1|3981616_3982069_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014479837.1|3982082_3982436_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|3982449_3982767_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_014479838.1|3982901_3983180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592536.1|3983268_3983682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479840.1|3983781_3984726_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|3984765_3984987_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|3985181_3985454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|3985535_3985766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|3986008_3986401_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|3986360_3988463_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|3988480_3989470_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|3989519_3990140_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|3990203_3990971_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|3991611_3992580_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|3992712_3993975_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014479845.1|3993992_3995258_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|3995367_3995775_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_031600540.1|3995833_3997168_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_088272329.1|3997280_3998438_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
WP_105778744.1|3998453_3999509_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
WP_014479849.1|3999492_3999879_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
WP_033881118.1|4000003_4000222_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
WP_014479850.1|4000336_4001101_+	hypothetical protein	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
WP_014479851.1|4001116_4001428_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105778750.1|4001488_4001680_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
WP_014479853.1|4001676_4001952_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
WP_014479855.1|4002147_4002702_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
WP_014479856.1|4002705_4003641_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
WP_014479857.1|4003630_4003945_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
WP_014479858.1|4003965_4004403_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
WP_014479859.1|4004463_4006881_+	hypothetical protein	NA	D6R422	Bacillus_phage	88.7	0.0e+00
WP_014479860.1|4007080_4007518_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_014479861.1|4007514_4008054_+	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
WP_014479862.1|4008088_4008604_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
WP_046159992.1|4008857_4009271_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
WP_033881110.1|4009642_4010026_+	hypothetical protein	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
WP_033881107.1|4010028_4010235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479865.1|4010473_4010959_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
WP_014479866.1|4010948_4012682_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
WP_014479867.1|4012698_4012905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479868.1|4012909_4014136_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
WP_014479869.1|4014128_4014725_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
WP_014479870.1|4014772_4015981_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
WP_014479871.1|4016008_4016392_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
WP_014479872.1|4016446_4016740_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
WP_014479873.1|4016729_4017056_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_031600548.1|4017055_4017448_+	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_014479875.1|4017444_4017852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479876.1|4017857_4018442_+	hypothetical protein	NA	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
WP_014479877.1|4018501_4018864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479878.1|4018875_4019058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479879.1|4019120_4022861_+	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
WP_014479880.1|4022873_4023707_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
WP_033881098.1|4023720_4025595_+	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
WP_031600552.1|4027219_4028341_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
WP_031600553.1|4028356_4028656_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|4028652_4028823_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031600555.1|4028874_4029087_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600556.1|4029101_4029365_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600557.1|4029420_4030398_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
WP_031600558.1|4030443_4030908_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_033881288.1|4030926_4032690_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
WP_080283100.1|4032859_4032931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479884.1|4032946_4034032_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_049832641.1|4034068_4034269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881290.1|4034865_4035156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|4035394_4035886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479887.1|4037216_4037468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592598.1|4037651_4038086_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014479891.1|4039128_4039887_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
4039025:4039190	attR	TGGGGAAATTGAAAAGAGATCCGAACTCCGTAGAATTAGCTAACAAGATTATCGAACAGTTGTAGACGTCAAGTCAAAATTTACATTTTTTGCTTATTTGCTTTTTACACTTCTGCTGAAAATACACTTTTTCGATGTTTCATTCGATAGCTATCTCCATCCATAT	NA	NA	NA	NA
WP_014480339.1|4039883_4041431_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479132.1|4041593_4042748_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
WP_033881852.1|4042744_4043644_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|4043721_4044102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479898.1|4044643_4044874_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_014479901.1|4046385_4046550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|4046689_4047160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479903.1|4047956_4049348_+	MFS transporter	NA	NA	NA	NA	NA
WP_014479904.1|4049420_4049738_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|4049734_4050649_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479906.1|4050787_4052389_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014479907.1|4052526_4053681_-	ROK family protein	NA	NA	NA	NA	NA
WP_014479908.1|4053918_4055256_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014479909.1|4055406_4056906_+	xylulokinase	NA	NA	NA	NA	NA
WP_031600262.1|4057390_4058638_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479910.1|4058767_4059403_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|4059815_4061231_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|4061332_4062517_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|4062927_4063353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|4064271_4064706_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|4065306_4065570_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|4065976_4066141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|4066415_4067255_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_121509411.1|4067377_4067665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|4067707_4068427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|4068586_4068943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|4069188_4069389_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_003231634.1|4069563_4069752_-	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_009967329.1|4070005_4070404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478984.1|4070565_4071918_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 290
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4079328	4082358	4142593		Bacillus_phage(66.67%)	4	NA	NA
WP_014479934.1|4079328_4080087_+	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	52.9	3.3e-54
WP_031600569.1|4080113_4080653_-	YndM family protein	NA	NA	NA	NA	NA
WP_014479937.1|4080771_4081191_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.1	2.0e-40
WP_003238209.1|4081740_4082358_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
>prophage 291
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4097579	4101971	4142593		Bacillus_virus(50.0%)	2	NA	NA
WP_014479944.1|4097579_4099547_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	6.7e-123
WP_014479945.1|4099550_4101971_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	2.8e-99
>prophage 292
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4110894	4111788	4142593		Bacillus_phage(100.0%)	1	NA	NA
WP_014479952.1|4110894_4111788_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	2.3e-83
>prophage 293
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4118716	4120366	4142593		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014479959.1|4118716_4120366_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	1.2e-29
>prophage 294
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4127730	4135434	4142593		Tupanvirus(100.0%)	1	NA	NA
WP_041516452.1|4127730_4135434_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.1	1.9e-149
>prophage 295
NZ_CP020722	Bacillus subtilis strain Bacillus subtilis Bs-115 chromosome, complete genome	4142593	4140742	4141892	4142593	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_157111206.1|4140742_4141892_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.4	5.0e-38
