The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	59381	112110	7040952	plate,transposase	Shigella_phage(16.67%)	49	NA	NA
WP_086937300.1|59381_60544_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
WP_003114585.1|60810_61089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003083536.1|61187_61583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083553.1|61847_63101_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003083555.1|63419_64793_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003083559.1|65288_65975_+	curli production assembly protein CsgG	NA	NA	NA	NA	NA
WP_003083569.1|66005_66359_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|66355_67021_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003083575.1|67035_67419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083144622.1|67700_69353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|69962_70103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083586.1|70924_72757_+	asparagine synthase (glutamine-hydrolyzing)	NA	G9E4W0	Ostreococcus_lucimarinus_virus	23.7	6.2e-22
WP_003083588.1|72809_73238_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003083590.1|73445_73994_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	8.0e-34
WP_003083593.1|74032_74539_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003083596.1|74604_75525_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|75632_76520_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003083601.1|76582_77287_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|77370_77826_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003083610.1|77936_78170_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|78181_78619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|78675_79092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|79183_80311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114660.1|80318_81302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083616.1|81334_82000_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003083618.1|81992_82535_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|82612_84658_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|84654_84930_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003083628.1|85018_86077_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003083630.1|86306_87221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083632.1|87282_88995_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003083634.1|88987_90187_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003136959.1|90186_90906_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	2.1e-18
WP_014603460.1|90902_94001_-	protein kinase	NA	M1PCM5	Moumouvirus	27.4	1.6e-22
WP_003083639.1|94008_94737_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003083642.1|94746_95427_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_003083648.1|95423_98957_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_014603461.1|98953_100303_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|100309_101644_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|101659_102124_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_034065165.1|102168_103638_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_003083664.1|104005_105040_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|105128_105647_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003083668.1|105659_107156_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|107231_107720_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|107887_108733_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003083674.1|108734_109244_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|109240_111100_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003083679.1|111063_112110_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	634233	686899	7040952	tRNA,plate,tail,holin	Pseudomonas_phage(24.0%)	55	NA	NA
WP_003085059.1|634233_635259_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|635337_635907_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|635990_636344_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|636334_636877_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003085069.1|636849_638082_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085071.1|638125_638632_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|638726_640280_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085075.1|640276_641548_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|641648_643571_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|643849_644182_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003085083.1|644225_645077_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|645076_645457_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|645493_646300_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|646415_647402_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|647398_648691_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|648671_651473_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003085094.1|651599_652616_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|652612_653287_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|653288_654047_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003085099.1|654047_655109_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_083144650.1|655260_657654_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|657699_658332_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|658460_659495_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|659728_660838_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003085111.1|660893_661940_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023656960.1|662054_663302_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|663407_664238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|664361_665036_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|665035_665854_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|665926_667405_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|667591_667906_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003085129.1|668005_668776_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|669233_669434_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|669481_669841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|670203_670653_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003085139.1|670674_671190_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003085141.1|671186_671744_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|671896_672223_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|672219_673107_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|673099_673633_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003085168.1|673634_675743_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	51.1	2.6e-218
WP_003085172.1|675751_676192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085173.1|676234_677395_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|677407_677911_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|677925_678270_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023098436.1|678439_680677_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085182.1|680686_681559_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|681533_681740_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003085186.1|681797_682787_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	3.7e-106
WP_003085188.1|682819_683449_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003085190.1|683445_683808_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	48.7	6.5e-16
WP_003118919.1|683804_684062_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003085194.1|684409_685015_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|685016_686066_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|686062_686899_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 3
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	862491	904170	7040952	capsid,integrase,lysis,portal,terminase,tRNA,head,tail,holin,protease	Pseudomonas_phage(68.0%)	57	856428:856445	877167:877184
856428:856445	attL	GGGCGGATGCCGCGCACC	NA	NA	NA	NA
WP_031642560.1|862491_863541_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.7	1.0e-101
WP_019396210.1|863540_863783_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	61.6	5.1e-17
WP_003119025.1|863766_864123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074198347.1|864127_864817_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	88.6	4.6e-111
WP_023093224.1|864813_865005_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	100.0	5.4e-30
WP_079868517.1|865117_865645_-	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	1.2e-50
WP_023099128.1|865641_866442_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	85.5	6.9e-95
WP_023099127.1|866444_866675_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	94.7	4.5e-31
WP_156900445.1|866677_867658_-	hypothetical protein	NA	Q775A9	Bordetella_phage	53.0	3.1e-36
WP_003085692.1|867700_868537_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	100.0	1.0e-128
WP_003085694.1|868533_868788_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_014603617.1|868887_869121_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_022580279.1|869123_869507_-	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	99.2	1.1e-61
WP_031294207.1|869858_870647_-	helix-turn-helix domain-containing protein	NA	A0A2K8HKD5	Pseudomonas_phage	60.9	4.6e-83
WP_022580278.1|870749_871070_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	52.4	7.0e-06
WP_003085704.1|871066_871459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123822966.1|871764_872082_+	hypothetical protein	NA	A0A1W6JTB5	Pseudomonas_phage	76.2	2.6e-37
WP_079380365.1|872153_872351_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	69.2	5.6e-14
WP_023103745.1|872647_872926_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	79.3	7.1e-31
WP_003085714.1|872918_873152_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	96.1	6.4e-33
WP_044069802.1|873277_873640_+	hypothetical protein	NA	A0A1W6JTB9	Pseudomonas_phage	90.8	9.8e-57
WP_023103742.1|874427_874733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058198515.1|874732_874963_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	75.0	1.7e-25
WP_023086959.1|874959_875799_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	96.1	7.9e-150
WP_003085722.1|875974_876595_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.5	2.9e-109
WP_003085724.1|876591_877989_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	1.5e-265
877167:877184	attR	GGTGCGCGGCATCCGCCC	NA	NA	NA	NA
WP_003085726.1|877985_878270_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.6	4.5e-41
WP_003085729.1|878266_878824_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	97.1	1.2e-74
WP_003085732.1|879352_879883_+	hypothetical protein	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_004353177.1|879968_880301_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085737.1|880297_880909_+	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.1	4.0e-103
WP_003085739.1|880922_881153_+	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	60.6	4.1e-16
WP_003085741.1|881159_881633_+|lysis	lysis protein Rz	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	3.3e-68
WP_023103989.1|881632_881962_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_003119048.1|882376_882868_+	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_083144659.1|882871_884551_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	64.8	1.2e-189
WP_058146978.1|884553_885777_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.5	1.3e-172
WP_015649331.1|885760_886405_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_023099109.1|886401_887616_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.6	8.2e-156
WP_003085760.1|887667_887871_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_083144661.1|887870_888194_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	62.5	2.9e-28
WP_023099108.1|888193_888520_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JC00	uncultured_Caudovirales_phage	47.7	5.6e-19
WP_003119054.1|888525_888720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003119055.1|888723_889296_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	49.7	2.0e-40
WP_023099107.1|889288_889675_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	64.6	7.6e-39
WP_023099106.1|889706_890213_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	72.8	3.3e-58
WP_003119059.1|890283_890628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725898.1|890624_890852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071580093.1|890891_894167_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	34.9	8.3e-86
WP_031689713.1|894166_894505_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	52.7	1.1e-30
WP_019725901.1|894501_895248_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	79.1	6.4e-119
WP_071580092.1|895250_896009_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	78.1	1.6e-117
WP_071580091.1|896046_896397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071580090.1|896439_897063_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	58.1	2.4e-58
WP_083144663.1|897119_900572_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	82.9	0.0e+00
WP_083144855.1|901930_902656_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.0	1.2e-56
WP_009877078.1|902931_904170_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 4
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	1341726	1381171	7040952	integrase,transposase	Pseudomonas_phage(98.04%)	51	1333053:1333068	1359289:1359304
1333053:1333068	attL	TTCCTCTCCGGCCTGC	NA	NA	NA	NA
WP_003094179.1|1341726_1342086_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_023657063.1|1342088_1342652_-	regulatory protein GemA	NA	J9RWI3	Pseudomonas_phage	100.0	5.0e-100
WP_003129239.1|1342638_1343106_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003148480.1|1343107_1343326_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|1343327_1344017_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_003094190.1|1344018_1344642_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	100.0	2.0e-110
WP_003148482.1|1344634_1344835_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	100.0	2.7e-32
WP_100814931.1|1344827_1345181_-	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	95.7	1.1e-60
WP_003148486.1|1345438_1345744_-	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	99.0	1.1e-48
WP_003148488.1|1345740_1346082_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	3.9e-55
WP_003148490.1|1346083_1347253_-	AAA family ATPase	NA	A0A0S4L1G1	Pseudomonas_phage	97.4	2.7e-212
WP_023657067.1|1347252_1349031_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0S4L2U5	Pseudomonas_phage	99.5	0.0e+00
WP_023657068.1|1349035_1349992_-	hypothetical protein	NA	A0A0S4L093	Pseudomonas_phage	93.1	3.5e-154
WP_031642102.1|1350049_1350349_-	helix-turn-helix domain-containing protein	NA	A0A0S4L7B4	Pseudomonas_phage	100.0	1.7e-46
WP_023442738.1|1350345_1350606_-	hypothetical protein	NA	A0A0S4L062	Pseudomonas_phage	100.0	6.0e-40
WP_023442737.1|1350598_1351087_-	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	100.0	8.8e-93
WP_124214277.1|1351212_1351893_-	hypothetical protein	NA	A0A0S4L0N5	Pseudomonas_phage	99.5	9.7e-106
WP_023442735.1|1351919_1352240_+	hypothetical protein	NA	A0A0S4L532	Pseudomonas_phage	99.1	2.2e-52
WP_031633127.1|1352285_1352477_-	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	98.4	2.0e-29
WP_033894733.1|1353050_1353254_+	hypothetical protein	NA	A0A0S4L2S2	Pseudomonas_phage	98.5	8.8e-31
WP_003094225.1|1354409_1354667_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_023657072.1|1354824_1355454_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	100.0	2.9e-120
WP_023657073.1|1355634_1356246_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|1356249_1356639_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003139994.1|1356640_1356937_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094238.1|1356942_1357518_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|1357519_1359223_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|1359222_1360701_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
1359289:1359304	attR	TTCCTCTCCGGCCTGC	NA	NA	NA	NA
WP_003139984.1|1360700_1361951_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|1361947_1362517_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|1362804_1363974_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|1363977_1364355_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|1364366_1365296_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|1365342_1365537_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|1365536_1365863_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|1365870_1366380_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|1366381_1366837_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|1366833_1367043_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|1367046_1367799_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139971.1|1367800_1368307_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_023657077.1|1368533_1372376_+	hypothetical protein	NA	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_023657078.1|1372383_1373340_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	9.2e-187
WP_023657079.1|1373341_1374265_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	98.7	1.2e-183
WP_023657080.1|1374264_1375968_+	hypothetical protein	NA	A0A076FRD9	Pseudomonas_phage	97.9	0.0e+00
WP_023657081.1|1375957_1376779_+	DUF2163 domain-containing protein	NA	A0A0A7DJU6	Pseudomonas_phage	97.4	2.8e-160
WP_023657082.1|1376787_1377027_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	98.7	1.4e-38
WP_023102217.1|1377023_1377242_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_023657083.1|1377231_1379439_+	hypothetical protein	NA	Q6TM49	Pseudomonas_phage	99.2	0.0e+00
WP_023657084.1|1379435_1380584_+	DUF2793 domain-containing protein	NA	A0A076FRD5	Pseudomonas_phage	99.0	1.5e-223
WP_023657085.1|1380580_1380868_+	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	97.9	1.9e-47
WP_022580010.1|1380946_1381171_+	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
>prophage 5
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	1468841	1477870	7040952		Bacillus_phage(33.33%)	8	NA	NA
WP_073660134.1|1468841_1469477_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.3e-40
WP_003092335.1|1469522_1470416_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1470520_1471525_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1471951_1472275_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003122151.1|1472341_1474909_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092265.1|1475034_1476042_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1476189_1476696_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1476829_1477870_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 6
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	2507475	2531565	7040952	integrase,transposase,protease	Virus_Rctr41k(100.0%)	29	2510795:2510811	2532569:2532585
WP_003090808.1|2507475_2507946_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003090806.1|2508294_2508525_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_003090804.1|2508703_2508901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090802.1|2508966_2509296_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003090800.1|2509406_2509781_-	DUF5064 family protein	NA	NA	NA	NA	NA
WP_003090799.1|2509916_2510360_+	DedA family protein	NA	NA	NA	NA	NA
WP_003090798.1|2510512_2510830_+	hypothetical protein	NA	NA	NA	NA	NA
2510795:2510811	attL	AGCGTCAGCGAGGCCGA	NA	NA	NA	NA
WP_003090797.1|2510819_2511719_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003090796.1|2511941_2512175_+	DUF3509 domain-containing protein	NA	NA	NA	NA	NA
WP_003090795.1|2512240_2512471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090794.1|2512445_2512964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154870.1|2513558_2514698_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534604.1|2514700_2516362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090790.1|2516361_2518236_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156900450.1|2518228_2518636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098552.1|2519023_2520130_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000935451.1|2520332_2522048_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|2522050_2523043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|2523011_2523512_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|2523639_2524479_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2524472_2524820_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_108092422.1|2524936_2525215_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_022675713.1|2525256_2526102_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA6	NA	NA	NA	NA	NA
WP_013263788.1|2526233_2526692_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_013263788.1|2526824_2527283_-	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001007673.1|2527320_2528148_-	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_051449075.1|2528229_2528784_-	aminoglycoside 6'-N-acetyltransferase AacA8	NA	NA	NA	NA	NA
WP_000845048.1|2528944_2529958_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023098450.1|2530134_2531565_+|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
2532569:2532585	attR	AGCGTCAGCGAGGCCGA	NA	NA	NA	NA
>prophage 7
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	2544805	2589843	7040952	tRNA,integrase,transposase,protease	Acinetobacter_phage(20.0%)	47	2550468:2550527	2564205:2565881
WP_003090784.1|2544805_2545900_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	8.2e-38
WP_003090785.1|2545892_2546651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154854.1|2546640_2547768_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	6.7e-27
WP_003154856.1|2547836_2548976_-	peptidase S1	NA	W5SAB9	Pithovirus	32.4	1.1e-05
WP_086005596.1|2549051_2550065_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
2550468:2550527	attL	GGCCCAGACCGTGTAAAAACGCAGCAAACGATGACCATCAACTTCCGGGGATTTTCTCAG	NA	NA	NA	NA
WP_023098450.1|2550639_2552070_-|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
WP_000845048.1|2552246_2553260_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_013263788.1|2553406_2553865_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_022675713.1|2553996_2554842_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA6	NA	NA	NA	NA	NA
WP_108092422.1|2554883_2555162_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000679427.1|2555278_2555626_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2555619_2556459_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2556586_2557087_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|2557055_2558048_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|2558050_2559766_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003090759.1|2560221_2561709_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.7	4.3e-239
WP_003090760.1|2561723_2562575_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	1.0e-96
WP_003090764.1|2562574_2562934_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023104037.1|2562979_2563942_+	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_023098450.1|2564376_2565807_-|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
WP_003090707.1|2566125_2566833_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
2564205:2565881	attR	GGCCCAGACCGTGTAAAAACGCAGCAAACGATGACCATCAACTTCCGGGGATTTTCTCAGCGTCTAGGAGGCCGTCGGAGGCCCAATCAGGCGCAATCGATAATTCTGGTTGCTATGGCACTTTCGGCTTCAGTACGCCTGCTGGAGGGCGGTACGAGTCGTAGAACAGGCCTCAGGCCTTCATCGCTGCCATCAGGGCACCGCTGCCCAGCACGTTCAACACGCGTTTGAGATTGTAGGCGAGCACATGCAGGCTCATCTCGGTACTCACTCGGTCGAGAGTCTTGGTGAGGAAGTGGGTGGCGCCCATCCAGCTCTTCAGCGTGCCGAACGGGTGCTCGACCGTCTGACGGCGGATTCGCATCATTTCAGGCGCTTGATCCAGGCGACTCTGCATCGCTTCGAGCACTGCCTCATGCTCCCATCGGCTCACTCGGCGCTCTGAGCTAGGCGTACAGTGCTCTTTCAACGCACAACCCTGGCAATGCGAACTCCAGTAGCGGTGCAGTTTCAGCCCTTTTTCGACGCTTGAGAACCGCCAGATCAGGCTTTGCCCAGCCGGGCATCGATACTCGTTCTTGGCTGCGTCATAGATGAAATCACCTTTGCCGAAGCGACCAGCCGCTGTCGCTCCCGAGGTCAGCGTCTTGGGCACGAAAACGGTGATTCCAGCCTCATGGCACGCCAGGATTTCTTCGCCTTTGAAATACCCTCTGTCTGCGACCGCCGAGAGTTCCTCGACACCCATGGCCTCTCGCGCTTGCTTGGCCATGGAGCTCAGTTGGTCTCGATCGACCCCGTCGTTCGTGACCTCGTGGGTCACGATCAGGTGGTGCTTCGCGTCGACCGCCGCCTGCACGTTGTAGCCGACTATTCCGCTGCCCCGGGTCTTCATTGAGCGGGCATCGGGATCGGTCAGGGAGATCTGTTTATCCGGTGTTTCGTTGAGCTGTACCTCGACTTCCTTGAGCTCCCGCAGCTTAGTTTTCAAGGTCGCAATCTTGTCGTGGAGGCGTTCGGCTTTGACCTGCGCCACGGCCGGTTCCTGGCGATCAGCGGTATCCAGTGCGGTCAGGTAACGGTTGATGCTGGACTCGATCTCCTCCATTCGCCGCTGAAGCTTGGCGCTGGTGAAATTGCGGTCACGGTTGTTGACCGCCTTGAACTTGCTGCCATCAATGGCTACCAGCGCTTCAGAGAACAGGCCAAGTTGCTGGCACAGCACCACGAACTGCCGACAGACGCCGCGGATTGCCTTGCCGTTATCCTTGCGGAAGTTGGCGATGGTCTTGAAGTCCGGCATCAAACGTCCGGTCAGCCACATCAACTCAACGTTGCGCTGACTCTCGCGTTCGAGACGTCGACTGGACTGGATACGGTTGAGGTAACCGTAGATGTAGATCTTCAGCAGGTCAGCAGGATGGTAGGCGGGTCTGCCGGTTTCCGCCGGGACGACACCCTCGAAACCCAGTAGGCCAAGGTCGAGTTCATCGACGAAAACATCGACCACCCGCACCGGGTTGGTGTCCGCCACGTAGTCATCCAAGCTCTCGGGAAGCAGTGTGCTTTGCCCTCGGTGCTCTCCCTGGATAAAGCGCTTCATTGGCGTCCCCCGCTGATTTTGAATCCATCAAATCACAGCAAGGACGATGCCAACGTTTTTACACGGTCTGGGCC	NA	NA	NA	NA
WP_156900452.1|2566923_2567544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090706.1|2567492_2568719_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_021219117.1|2568931_2569624_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087819173.1|2569789_2570927_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	7.7e-47
WP_000414383.1|2571523_2571958_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|2572029_2572380_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|2572395_2572671_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003090700.1|2572742_2574428_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.3e-39
WP_003090698.1|2574445_2574811_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003090697.1|2574807_2575044_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|2575040_2576030_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_023098557.1|2576610_2577816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090694.1|2578062_2579313_+	TerD family protein	NA	NA	NA	NA	NA
WP_023083423.1|2579462_2580074_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023083424.1|2580472_2580775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090692.1|2580865_2582266_-	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	32.2	2.1e-38
WP_003090691.1|2582265_2582853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003119937.1|2582954_2583182_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003090688.1|2583930_2584152_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_003090687.1|2584148_2584931_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003090686.1|2584984_2585218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090684.1|2585416_2585704_+	DUF3509 domain-containing protein	NA	NA	NA	NA	NA
WP_003090682.1|2586028_2586205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090681.1|2586289_2586616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090679.1|2586807_2587671_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003090677.1|2587920_2589843_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.5	5.1e-128
>prophage 8
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	2750856	2823662	7040952	integrase,terminase,tRNA,holin,protease	Pseudomonas_phage(65.62%)	78	2763446:2763463	2800201:2800218
WP_003131114.1|2750856_2751984_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003090438.1|2752027_2752498_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003090437.1|2752584_2754810_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003090436.1|2755168_2756425_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	3.1e-17
WP_003090435.1|2756498_2756771_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.1e-15
WP_003097649.1|2756996_2757365_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|2757392_2759669_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|2759750_2759969_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003090424.1|2760073_2760781_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003090423.1|2760835_2761516_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003090421.1|2761553_2762504_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	9.2e-62
WP_003131123.1|2762731_2765167_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
2763446:2763463	attL	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_003090414.1|2765192_2765819_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003090411.1|2765828_2767154_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003090402.1|2767275_2768556_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	2.4e-97
WP_003108773.1|2768557_2769955_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003090397.1|2769959_2770934_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023098569.1|2771021_2772005_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	73.4	1.0e-140
WP_003090393.1|2772001_2772337_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2772333_2772639_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2772638_2772998_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2772994_2773390_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2773500_2774169_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_083144706.1|2774504_2775581_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	67.9	1.3e-133
WP_034068179.1|2777742_2778249_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	93.5	2.0e-84
WP_034068182.1|2778245_2778611_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	94.6	1.4e-58
WP_034068183.1|2778607_2779231_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	83.3	1.9e-95
WP_016852962.1|2779227_2779671_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	81.0	4.0e-60
WP_034068184.1|2779667_2781578_-	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	95.8	8.6e-285
WP_034068185.1|2781574_2784205_-	DNA methylase N-4	NA	J7I4L6	Pseudomonas_phage	98.1	0.0e+00
WP_083144708.1|2784351_2786094_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	78.1	4.2e-238
WP_083144710.1|2786097_2786862_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	67.8	3.0e-103
WP_003116739.1|2786874_2787075_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_014602814.1|2787081_2787981_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_034071400.1|2787993_2788902_-	endonuclease	NA	Q858E0	Salmonella_phage	71.8	4.4e-122
WP_083144712.1|2788876_2789374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009314056.1|2789384_2789594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2789590_2789812_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_156900454.1|2789795_2789945_-	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	100.0	6.7e-12
WP_083144714.1|2789941_2790445_-	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	98.8	1.3e-99
WP_003099041.1|2791010_2791382_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_083144716.1|2791438_2791978_-	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	96.1	1.3e-92
WP_058148849.1|2792510_2792999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016852749.1|2793046_2793712_-	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	42.4	1.1e-45
WP_023103954.1|2794257_2794770_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	97.1	9.0e-88
WP_003136886.1|2794852_2795425_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	4.6e-101
WP_023094680.1|2795415_2795667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016263332.1|2795704_2795887_+	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	100.0	4.5e-26
WP_031632346.1|2795879_2796401_+	HNH endonuclease	NA	Q7Y3U9	Yersinia_phage	39.7	3.9e-06
WP_023094681.1|2796400_2797249_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	97.8	1.1e-74
WP_016263334.1|2797241_2798657_+	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.4	2.6e-262
WP_052180706.1|2798649_2799192_+	HNH endonuclease	NA	Q2NPD3	Xanthomonas_virus	40.2	2.4e-22
WP_034068206.1|2799191_2799629_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	85.3	2.9e-63
WP_083144718.1|2799657_2800527_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	98.6	2.0e-164
2800201:2800218	attR	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_033945342.1|2800680_2801007_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	52.5	7.1e-22
WP_083144720.1|2801028_2801571_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	95.0	2.6e-93
WP_023094684.1|2801554_2802808_+|terminase	PBSX family phage terminase large subunit	terminase	J7I4J3	Pseudomonas_phage	99.8	2.9e-249
WP_016852759.1|2802807_2803005_+	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	5.2e-28
WP_003127999.1|2803007_2804378_+	DUF1073 domain-containing protein	NA	J7I414	Pseudomonas_phage	99.3	4.0e-268
WP_083144722.1|2806074_2807352_+	hypothetical protein	NA	H2BD80	Pseudomonas_phage	99.1	8.2e-215
WP_034005435.1|2807355_2807805_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	98.7	4.8e-77
WP_058151270.1|2807820_2808915_+	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	98.9	6.4e-208
WP_014603768.1|2809200_2809602_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	98.5	7.8e-71
WP_041025734.1|2809598_2809919_+	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	97.2	1.5e-56
WP_023124723.1|2809920_2810325_+	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	99.3	2.1e-68
WP_014603770.1|2810321_2810696_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	98.4	8.3e-67
WP_083144724.1|2810710_2811706_+	Ig domain-containing protein	NA	H2BD89	Pseudomonas_phage	96.7	1.7e-167
WP_083144726.1|2811702_2812320_+	glycoprotein	NA	J7I4I5	Pseudomonas_phage	99.5	2.6e-113
WP_083144728.1|2812319_2815331_+	tape measure protein	NA	H2BD91	Pseudomonas_phage	99.0	0.0e+00
WP_083144730.1|2815327_2815795_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	96.8	7.9e-91
WP_025297794.1|2815778_2816270_+	DUF1833 family protein	NA	H2BD93	Pseudomonas_phage	96.3	1.5e-87
WP_031634252.1|2816274_2816682_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	96.3	3.2e-72
WP_083144732.1|2816653_2819377_+	hypothetical protein	NA	H2BD95	Pseudomonas_phage	84.3	0.0e+00
WP_083144734.1|2819439_2821497_+	structural protein	NA	J7HXC9	Pseudomonas_phage	99.9	0.0e+00
WP_031636483.1|2821593_2822223_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	94.3	6.6e-109
WP_083144736.1|2822219_2822588_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	85.2	7.2e-47
WP_016852781.1|2822584_2822848_+	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	93.0	1.5e-35
WP_016852782.1|2823149_2823662_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	92.9	1.2e-92
>prophage 9
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	3653985	3696181	7040952	tail,integrase,transposase	Pseudomonas_phage(72.73%)	57	3677620:3677636	3701273:3701289
WP_152995771.1|3653985_3655908_-	hypothetical protein	NA	A0A2H4J9W0	uncultured_Caudovirales_phage	38.6	5.7e-95
WP_058132457.1|3655904_3657941_-	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	41.1	2.7e-58
WP_023127491.1|3657940_3658414_-	hypothetical protein	NA	W6MVK9	Pseudomonas_phage	89.8	1.4e-66
WP_156900456.1|3658437_3658902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058132456.1|3658858_3661198_-	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	97.8	0.0e+00
WP_023093561.1|3661194_3661824_-	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	100.0	8.6e-117
WP_017001680.1|3662053_3662512_-	hypothetical protein	NA	W6MVK6	Pseudomonas_phage	99.3	5.2e-71
WP_023125056.1|3662522_3663527_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	99.7	4.5e-184
WP_058132455.1|3663539_3664163_-	hypothetical protein	NA	W6MWW5	Pseudomonas_phage	97.5	2.6e-81
WP_058132454.1|3664159_3664471_-	hypothetical protein	NA	W6MVD5	Pseudomonas_phage	96.1	8.5e-49
WP_058132453.1|3664471_3666160_-|tail	phage tail protein	tail	W6MYA0	Pseudomonas_phage	97.7	0.0e+00
WP_143485640.1|3666162_3666345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017001685.1|3666346_3666601_-	hypothetical protein	NA	W6MVK3	Pseudomonas_phage	95.2	2.2e-34
WP_023125061.1|3666612_3668076_-	hypothetical protein	NA	Q2A0C1	Sodalis_phage	57.8	1.7e-155
WP_023093569.1|3668035_3668671_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	38.6	2.0e-20
WP_023125063.1|3668674_3668905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071540043.1|3668901_3669345_-	hypothetical protein	NA	W6MYB3	Pseudomonas_phage	93.9	4.4e-67
WP_031759240.1|3669341_3669794_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	75.4	4.4e-54
WP_031640130.1|3669790_3669991_-	hypothetical protein	NA	Q8W6S7	Burkholderia_virus	60.4	2.8e-05
WP_024007940.1|3670490_3671063_-	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	36.9	2.9e-26
WP_058132452.1|3671059_3671701_-	hypothetical protein	NA	A0A0U3TGU4	Pseudomonas_phage	93.4	7.2e-111
WP_073668198.1|3671697_3671964_-	hypothetical protein	NA	H2BDI6	Pseudomonas_virus	82.6	3.5e-35
WP_023127359.1|3672059_3672323_-	hypothetical protein	NA	A0A125RNK6	Pseudomonas_phage	95.4	4.5e-43
WP_058132451.1|3672319_3672736_-	hypothetical protein	NA	B5WZY4	Pseudomonas_phage	98.6	2.9e-76
WP_071570416.1|3672735_3673260_-	HNH endonuclease	NA	W6MVN6	Pseudomonas_phage	98.3	4.5e-95
WP_058132450.1|3673252_3673468_-	hypothetical protein	NA	A0A125RNK4	Pseudomonas_phage	90.1	3.8e-32
WP_058132634.1|3673642_3674551_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	58.9	4.9e-105
WP_058132448.1|3674547_3676032_-	DEAD/DEAH box helicase	NA	A0A0H5ARP5	Pseudomonas_phage	68.0	6.2e-198
WP_023127506.1|3676531_3676735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125075.1|3676754_3676955_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	64.6	1.1e-14
WP_042939638.1|3676968_3677211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570414.1|3677310_3677997_+	LexA family transcriptional regulator	NA	A0A1W6JTC8	Pseudomonas_phage	48.1	1.0e-41
3677620:3677636	attL	ATCGCCGGCGACTGGGC	NA	NA	NA	NA
WP_021205581.1|3678706_3679036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082537.1|3679128_3679407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082538.1|3679403_3679577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034068438.1|3679644_3679830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083144759.1|3679944_3680889_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	84.4	5.5e-75
WP_023098760.1|3681121_3681262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906742.1|3681267_3681600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098761.1|3681634_3681874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098762.1|3682091_3682316_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_023098763.1|3682312_3682678_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	90.1	3.3e-60
WP_010792309.1|3682712_3683858_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.1	5.9e-164
WP_023657541.1|3683988_3684501_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	52.3	6.1e-44
WP_023098765.1|3684607_3685639_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	3.5e-107
WP_023657542.1|3685923_3686229_+	hypothetical protein	NA	A0A2H4JCG5	uncultured_Caudovirales_phage	56.2	2.9e-25
WP_083144761.1|3686271_3687336_+	hypothetical protein	NA	A0A0U4B0F0	Pseudomonas_phage	99.2	5.6e-84
WP_023127368.1|3687343_3688090_+	phage recombination protein Bet	NA	A0A0S2SY88	Pseudomonas_phage	99.2	8.6e-140
WP_023127369.1|3688073_3688700_+	hypothetical protein	NA	A0A0S2SY31	Pseudomonas_phage	97.1	2.0e-113
WP_023106481.1|3688696_3689032_+	LytTR family transcriptional regulator	NA	Q9MC72	Pseudomonas_phage	91.0	2.0e-51
WP_023098774.1|3690752_3691196_+	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	45.0	2.1e-16
WP_023098775.1|3691188_3691485_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	71.4	4.6e-28
WP_031630072.1|3691797_3692247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098777.1|3692239_3692521_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	69.1	6.3e-27
WP_052158589.1|3692713_3693094_+	hypothetical protein	NA	J7I0U3	Pseudomonas_phage	64.5	7.0e-29
WP_043106711.1|3693343_3694561_+|integrase	site-specific integrase	integrase	A0A0U4B0G7	Pseudomonas_phage	99.3	6.6e-230
WP_003111315.1|3694591_3696181_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
3701273:3701289	attR	ATCGCCGGCGACTGGGC	NA	NA	NA	NA
>prophage 10
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	3850749	3957651	7040952	capsid,integrase,portal,terminase,tRNA,head,tail,holin,transposase,protease	Pseudomonas_phage(53.85%)	115	3894533:3894592	3950242:3950302
WP_003087997.1|3850749_3851775_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.9	2.2e-21
WP_003087996.1|3852008_3852719_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003087993.1|3852779_3853094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003087989.1|3853350_3854421_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003087987.1|3854445_3855213_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003087985.1|3855373_3856135_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.0e-10
WP_003087983.1|3856266_3857172_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003087981.1|3857168_3857813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003087979.1|3857913_3858693_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003087976.1|3858660_3859497_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_003087974.1|3859496_3861185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003087972.1|3861224_3862037_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003087967.1|3862260_3863763_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_003087965.1|3863746_3865102_-	amino acid permease	NA	NA	NA	NA	NA
WP_003087961.1|3865125_3867381_-	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003132809.1|3867574_3867964_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003087958.1|3867991_3868732_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.0	1.0e-39
WP_003087954.1|3868796_3869243_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	1.7e-34
WP_003087952.1|3869245_3870007_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003087949.1|3870108_3870885_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003120244.1|3870962_3872567_+	lytic transglycosylase domain-containing protein	NA	M1HNA7	Bacillus_virus	27.8	2.2e-07
WP_023098680.1|3872757_3874587_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003087944.1|3874583_3876431_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003087943.1|3876437_3877520_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_003087942.1|3877524_3878544_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003087940.1|3878545_3880156_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-20
WP_003087936.1|3880177_3880975_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_003087933.1|3881072_3882938_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003087931.1|3883169_3883442_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
WP_003087926.1|3883577_3885974_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	4.5e-222
WP_003087924.1|3886105_3887386_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.1e-137
WP_003087922.1|3887490_3888132_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.5e-55
WP_003087920.1|3888225_3889536_-	trigger factor	NA	NA	NA	NA	NA
WP_003087915.1|3889767_3890475_+	response regulator	NA	W8CYM9	Bacillus_phage	33.2	3.5e-34
WP_003087912.1|3890475_3891762_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	6.1e-16
WP_003087908.1|3891866_3893699_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003087901.1|3893985_3894207_-	hypothetical protein	NA	NA	NA	NA	NA
3894533:3894592	attL	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATC	NA	NA	NA	NA
WP_023127344.1|3894723_3894987_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	96.6	2.4e-44
WP_003088482.1|3895022_3895283_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	89.5	4.4e-35
WP_003088479.1|3895279_3895648_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.0	2.3e-45
WP_003088477.1|3895644_3896274_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	94.7	1.0e-109
WP_031300639.1|3896318_3897059_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.4	3.1e-57
WP_023104090.1|3898402_3901894_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	66.3	0.0e+00
WP_003088475.1|3901949_3902528_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	64.4	2.3e-63
WP_003088474.1|3902524_3903307_-	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	74.8	2.9e-122
WP_003088473.1|3903309_3904011_-|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	74.4	8.5e-105
WP_031632697.1|3904568_3904916_-|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	51.3	3.2e-28
WP_083144766.1|3904916_3908306_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	43.0	5.6e-69
WP_128688109.1|3908795_3909125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088470.1|3909222_3909489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088469.1|3909518_3909869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031632701.1|3909878_3910382_-|tail	phage major tail protein	tail	Q9MCA5	Pseudomonas_phage	71.7	9.5e-66
WP_031632703.1|3910445_3910811_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	96.7	2.4e-63
WP_031632705.1|3910810_3911284_-	phage-like protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	53.0	1.3e-32
WP_031632706.1|3911276_3911834_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	94.6	3.6e-106
WP_045404966.1|3911844_3912657_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	97.4	1.3e-160
WP_023098729.1|3912735_3913308_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_031630036.1|3913426_3913783_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	98.3	2.8e-64
WP_012614021.1|3913783_3914104_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JX27	Pseudomonas_phage	100.0	1.8e-54
WP_031630039.1|3914084_3914681_-	hypothetical protein	NA	H2BDB2	Pseudomonas_virus	93.9	2.6e-110
WP_023098730.1|3914847_3916035_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	97.2	3.3e-210
WP_023098731.1|3916031_3916922_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	98.3	2.1e-164
WP_031630043.1|3916925_3918230_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	99.3	1.6e-250
WP_023098733.1|3918383_3920075_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.6	0.0e+00
WP_023098734.1|3920076_3920457_-	hypothetical protein	NA	Q9XJT7	Pseudomonas_phage	97.6	2.7e-65
WP_033936245.1|3920669_3920984_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	94.2	1.5e-53
WP_033936247.1|3921484_3921703_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	86.4	1.1e-23
WP_033936248.1|3922071_3922356_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	100.0	3.2e-47
WP_033936249.1|3922348_3922717_-	membrane protein	NA	A0A0S2SYH4	Pseudomonas_phage	99.2	2.3e-61
WP_023098737.1|3923072_3924296_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	60.2	7.5e-133
WP_033942789.1|3924465_3924972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031641840.1|3925379_3925754_-	hypothetical protein	NA	W6MVN8	Pseudomonas_phage	100.0	7.8e-65
WP_153574826.1|3925823_3925970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083144772.1|3925966_3926629_-	hypothetical protein	NA	Q9MC46	Pseudomonas_phage	92.5	9.1e-109
WP_023102142.1|3926625_3926832_-	hypothetical protein	NA	A0A2H4IY74	uncultured_Caudovirales_phage	66.2	5.8e-22
WP_083144774.1|3926828_3927092_-	hypothetical protein	NA	H2BDI5	Pseudomonas_virus	96.5	1.7e-42
WP_003124795.1|3927088_3927676_-	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.5	1.2e-109
WP_023102145.1|3927668_3928301_-	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	99.5	1.8e-122
WP_025297838.1|3928290_3928494_-	TraR/DksA family transcriptional regulator	NA	H2BDI2	Pseudomonas_virus	95.5	6.8e-31
WP_033946921.1|3928495_3929005_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	99.4	7.5e-87
WP_023093580.1|3929117_3929804_-	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	86.8	2.6e-114
WP_023093581.1|3929803_3931144_-	replicative DNA helicase	NA	A0A0S2SYB4	Pseudomonas_phage	97.8	5.5e-246
WP_033936259.1|3931140_3932130_-	phage replication protein O	NA	Q9MC55	Pseudomonas_phage	95.4	4.9e-175
WP_083144776.1|3932320_3932632_-	transcriptional regulator	NA	Q37905	Pseudomonas_phage	44.7	2.6e-13
WP_023081927.1|3932633_3932807_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	41.1	7.1e-05
WP_031641788.1|3932915_3933644_+	helix-turn-helix transcriptional regulator	NA	A0A059VA53	Pseudomonas_phage	53.1	1.2e-58
WP_023118145.1|3934113_3934320_+	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	94.1	4.9e-29
WP_023657539.1|3934329_3934536_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	98.5	2.5e-33
WP_023098759.1|3936078_3936570_+	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	81.1	4.4e-68
WP_023098760.1|3936717_3936858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906742.1|3936863_3937196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098761.1|3937230_3937470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156900459.1|3937742_3938000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083144778.1|3937996_3938362_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	96.7	5.3e-66
WP_010792309.1|3938396_3939542_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.1	5.9e-164
WP_023657541.1|3939672_3940185_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	52.3	6.1e-44
WP_023098765.1|3940291_3941323_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	3.5e-107
WP_023657542.1|3941607_3941913_+	hypothetical protein	NA	A0A2H4JCG5	uncultured_Caudovirales_phage	56.2	2.9e-25
WP_083144761.1|3941955_3943020_+	hypothetical protein	NA	A0A0U4B0F0	Pseudomonas_phage	99.2	5.6e-84
WP_023127368.1|3943027_3943774_+	phage recombination protein Bet	NA	A0A0S2SY88	Pseudomonas_phage	99.2	8.6e-140
WP_023127369.1|3943757_3944384_+	hypothetical protein	NA	A0A0S2SY31	Pseudomonas_phage	97.1	2.0e-113
WP_023106481.1|3944380_3944716_+	LytTR family transcriptional regulator	NA	Q9MC72	Pseudomonas_phage	91.0	2.0e-51
WP_023098774.1|3946440_3946884_+	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	45.0	2.1e-16
WP_023098775.1|3946876_3947173_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	71.4	4.6e-28
WP_031630072.1|3947485_3947935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098777.1|3947927_3948209_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	69.1	6.3e-27
WP_052158589.1|3948401_3948782_+	hypothetical protein	NA	J7I0U3	Pseudomonas_phage	64.5	7.0e-29
WP_003098018.1|3948900_3949242_+	helix-turn-helix domain-containing protein	NA	Q9MC86	Pseudomonas_phage	100.0	5.4e-49
WP_023104132.1|3949127_3950237_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	99.2	5.1e-213
WP_003087898.1|3950867_3951722_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
3950242:3950302	attR	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATCC	NA	NA	NA	NA
WP_003087895.1|3951779_3953162_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_023098681.1|3953171_3954842_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.3	1.4e-198
WP_003087890.1|3954964_3955462_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
WP_003087888.1|3955466_3956189_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_003087885.1|3956319_3957651_+	hypothetical protein	NA	A0A0F6WCV7	Sinorhizobium_phage	28.1	5.3e-39
>prophage 11
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	4496224	4539648	7040952	integrase,transposase	Pseudomonas_phage(96.0%)	50	4495615:4495632	4525792:4525809
4495615:4495632	attL	CGGTCACCGTGTCGGCGG	NA	NA	NA	NA
WP_003086768.1|4496224_4498063_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	26.9	4.8e-06
WP_033894987.1|4500195_4500558_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	85.0	2.8e-51
WP_023657608.1|4500560_4501124_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	97.3	1.4e-97
WP_023657609.1|4501110_4501578_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	78.1	1.2e-54
WP_003148480.1|4501579_4501798_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|4501799_4502489_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_003094190.1|4502490_4503114_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	100.0	2.0e-110
WP_014603989.1|4503106_4503307_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	98.5	2.3e-31
WP_033894988.1|4503299_4503833_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	97.7	4.8e-92
WP_014603990.1|4504457_4504742_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_023657612.1|4504738_4505080_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	1.3e-55
WP_003094200.1|4505081_4506248_-	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	100.0	1.8e-216
WP_023657613.1|4506247_4508032_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	97.8	0.0e+00
WP_023657614.1|4508035_4509010_-	hypothetical protein	NA	J9SW46	Pseudomonas_phage	98.7	9.8e-152
WP_023123661.1|4509019_4509334_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	99.0	1.0e-49
WP_023123662.1|4509330_4509591_-	hypothetical protein	NA	J9SNT9	Pseudomonas_phage	100.0	9.3e-41
WP_023123663.1|4509583_4510072_-	hypothetical protein	NA	J9SHM0	Pseudomonas_phage	100.0	7.5e-92
WP_023657615.1|4510199_4510691_-	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	78.5	2.1e-62
WP_023123664.1|4510704_4510935_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_003094225.1|4512886_4513144_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_023657072.1|4513301_4513931_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	100.0	2.9e-120
WP_023657073.1|4514111_4514723_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|4514726_4515116_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003139994.1|4515117_4515414_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	4.6e-52
WP_003094238.1|4515419_4515995_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|4515996_4517700_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|4517699_4519178_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
WP_003139984.1|4519177_4520428_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|4520424_4520994_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|4521281_4522451_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|4522454_4522832_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|4522843_4523773_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|4523819_4524014_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|4524013_4524340_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|4524347_4524857_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|4524858_4525314_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|4525310_4525520_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|4525523_4526276_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
4525792:4525809	attR	CCGCCGACACGGTGACCG	NA	NA	NA	NA
WP_003139971.1|4526277_4526784_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_023657077.1|4527010_4530853_+	hypothetical protein	NA	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_023657078.1|4530860_4531817_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	9.2e-187
WP_023657079.1|4531818_4532742_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	98.7	1.2e-183
WP_023657080.1|4532741_4534445_+	hypothetical protein	NA	A0A076FRD9	Pseudomonas_phage	97.9	0.0e+00
WP_023657081.1|4534434_4535256_+	DUF2163 domain-containing protein	NA	A0A0A7DJU6	Pseudomonas_phage	97.4	2.8e-160
WP_023657082.1|4535264_4535504_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	98.7	1.4e-38
WP_023102217.1|4535500_4535719_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_023657083.1|4535708_4537916_+	hypothetical protein	NA	Q6TM49	Pseudomonas_phage	99.2	0.0e+00
WP_023657084.1|4537912_4539061_+	DUF2793 domain-containing protein	NA	A0A076FRD5	Pseudomonas_phage	99.0	1.5e-223
WP_023657085.1|4539057_4539345_+	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	97.9	1.9e-47
WP_022580010.1|4539423_4539648_+	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
>prophage 12
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	4828589	4890626	7040952	capsid,integrase,portal,terminase,head,tail,holin,transposase,protease	Pseudomonas_phage(74.63%)	83	4829932:4829991	4889732:4889795
WP_073660296.1|4828589_4829582_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.0	5.0e-10
4829932:4829991	attL	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAAT	NA	NA	NA	NA
WP_023098716.1|4830124_4830388_-	hypothetical protein	NA	H2BDA2	Pseudomonas_phage	98.9	9.7e-46
WP_023098717.1|4830423_4830687_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	90.7	2.0e-35
WP_023098718.1|4830683_4831052_-	hypothetical protein	NA	A0A125RNP2	Pseudomonas_phage	63.9	8.3e-27
WP_033964071.1|4831048_4831678_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	94.7	1.0e-109
WP_031300639.1|4831722_4832463_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.4	3.1e-57
WP_023104090.1|4833806_4837298_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	66.3	0.0e+00
WP_003088475.1|4837353_4837932_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	64.4	2.3e-63
WP_003088474.1|4837928_4838711_-	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	74.8	2.9e-122
WP_003088473.1|4838713_4839415_-|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	74.4	8.5e-105
WP_031632697.1|4839972_4840320_-|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	51.3	3.2e-28
WP_083144766.1|4840320_4843710_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	43.0	5.6e-69
WP_128688109.1|4844199_4844529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088470.1|4844626_4844893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088469.1|4844922_4845273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031632701.1|4845282_4845786_-|tail	phage major tail protein	tail	Q9MCA5	Pseudomonas_phage	71.7	9.5e-66
WP_031632703.1|4845849_4846215_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	96.7	2.4e-63
WP_031632705.1|4846214_4846688_-	phage-like protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	53.0	1.3e-32
WP_031632706.1|4846680_4847238_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	94.6	3.6e-106
WP_045404966.1|4847248_4848061_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	97.4	1.3e-160
WP_043084922.1|4848139_4848640_-	DNA-binding protein	NA	Q9XJS9	Pseudomonas_phage	100.0	7.4e-95
WP_033942774.1|4848756_4849113_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	89.0	1.1e-57
WP_043084926.1|4849321_4849642_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	88.7	5.3e-46
WP_043084929.1|4849622_4850219_-	hypothetical protein	NA	H2BDB2	Pseudomonas_virus	93.9	1.5e-110
WP_043084931.1|4850384_4851572_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	99.2	2.9e-214
WP_023657532.1|4851568_4852459_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	99.7	6.4e-166
WP_023657533.1|4852590_4853853_-|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	97.4	4.4e-237
WP_023657535.1|4854006_4855698_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.6	0.0e+00
WP_023108931.1|4855699_4856080_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	98.4	1.0e-64
WP_045404979.1|4856292_4856607_-	HNH endonuclease	NA	D4FUN2	Pseudomonas_phage	97.1	1.8e-54
WP_045404982.1|4856599_4856860_-	hypothetical protein	NA	Q9MC37	Pseudomonas_phage	95.3	3.2e-41
WP_045404984.1|4856856_4857108_-	hypothetical protein	NA	Q9MC38	Pseudomonas_phage	95.2	2.6e-40
WP_033985920.1|4857107_4857410_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	76.0	1.4e-35
WP_045404990.1|4857527_4857812_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	98.9	8.5e-48
WP_020989315.1|4857804_4858173_-	hypothetical protein	NA	A0A0S2SYH4	Pseudomonas_phage	99.2	6.7e-61
WP_058163743.1|4859057_4859636_-	hypothetical protein	NA	Q9MC44	Pseudomonas_phage	97.9	7.7e-104
WP_023093573.1|4859703_4859862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033997113.1|4859858_4860497_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	67.0	6.6e-80
WP_083144789.1|4860481_4861084_-	hypothetical protein	NA	A0A2H4JA27	uncultured_Caudovirales_phage	71.8	5.6e-73
WP_033959090.1|4861080_4861314_-	hypothetical protein	NA	A0A0S2SYK5	Pseudomonas_phage	98.7	3.6e-36
WP_153562489.1|4861310_4861469_-	hypothetical protein	NA	A0A0S2SYG6	Pseudomonas_phage	63.5	1.6e-11
WP_086937300.1|4861513_4862676_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
WP_083144791.1|4862725_4862974_-	hypothetical protein	NA	B5WZY5	Pseudomonas_phage	94.9	1.1e-38
WP_031688190.1|4862970_4863306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031688191.1|4863302_4863719_-	hypothetical protein	NA	B5WZY4	Pseudomonas_phage	99.3	2.2e-76
WP_071537982.1|4863718_4864243_-	HNH endonuclease	NA	W6MVN6	Pseudomonas_phage	99.4	6.3e-97
WP_034005929.1|4864235_4864451_-	hypothetical protein	NA	W6MW49	Pseudomonas_phage	95.8	2.4e-34
WP_083144793.1|4864566_4866396_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	92.3	0.0e+00
WP_023098744.1|4866392_4867241_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	37.6	1.1e-05
WP_023098745.1|4867237_4867660_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_023098746.1|4867659_4867845_-	hypothetical protein	NA	A0A0U4IIX2	Pseudomonas_phage	91.8	2.3e-25
WP_003140700.1|4868041_4868506_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	99.4	1.9e-81
WP_083144797.1|4868842_4869187_-	hypothetical protein	NA	A0A0U4JVL6	Pseudomonas_phage	98.2	2.3e-55
WP_023082532.1|4869219_4869399_-	hypothetical protein	NA	A0A0S2SYB8	Pseudomonas_phage	100.0	4.9e-25
WP_058164245.1|4869488_4870322_+	Cro/Cl family transcriptional regulator	NA	A0A0S2SYF7	Pseudomonas_phage	99.6	4.6e-158
WP_044288621.1|4870420_4870744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015648586.1|4870832_4871069_+	hypothetical protein	NA	A0A127KNL7	Pseudomonas_phage	68.4	3.3e-21
WP_033945903.1|4871451_4872030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083144799.1|4872082_4872409_-	DUF1654 domain-containing protein	NA	A0A0S2SYC9	Pseudomonas_phage	98.1	2.9e-52
WP_021205581.1|4872859_4873189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082537.1|4873281_4873560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082538.1|4873556_4873730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034068438.1|4873797_4873983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083144801.1|4874097_4875339_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	64.9	2.3e-65
WP_023098760.1|4875571_4875712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906742.1|4875717_4876050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098761.1|4876084_4876324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098762.1|4876541_4876766_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_023098763.1|4876762_4877128_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	90.1	3.3e-60
WP_010792309.1|4877162_4878308_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.1	5.9e-164
WP_023657541.1|4878438_4878951_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	52.3	6.1e-44
WP_023657542.1|4880377_4880683_+	hypothetical protein	NA	A0A2H4JCG5	uncultured_Caudovirales_phage	56.2	2.9e-25
WP_083144805.1|4881850_4882546_+	phage recombination protein Bet	NA	A0A0S2SY88	Pseudomonas_phage	99.1	4.4e-130
WP_023127369.1|4882529_4883156_+	hypothetical protein	NA	A0A0S2SY31	Pseudomonas_phage	97.1	2.0e-113
WP_023106481.1|4883152_4883488_+	LytTR family transcriptional regulator	NA	Q9MC72	Pseudomonas_phage	91.0	2.0e-51
WP_023098774.1|4885208_4885652_+	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	45.0	2.1e-16
WP_023098775.1|4885644_4885941_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	71.4	4.6e-28
WP_031630072.1|4886253_4886703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098777.1|4886695_4886977_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	69.1	6.3e-27
WP_023098778.1|4887169_4887826_+	hypothetical protein	NA	A0A218L3S6	Pseudomonas_phage	91.5	3.2e-37
WP_023098779.1|4887822_4888158_+	hypothetical protein	NA	J7HXK7	Pseudomonas_phage	50.4	1.2e-19
WP_031630076.1|4888648_4889623_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	99.1	6.1e-178
WP_003086275.1|4889915_4890626_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	1.1e-40
4889732:4889795	attR	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAATCCGT	NA	NA	NA	NA
>prophage 13
NZ_CP020603	Pseudomonas aeruginosa strain E6130952 chromosome, complete genome	7040952	5108977	5200487	7040952	capsid,lysis,integrase,portal,terminase,tRNA,head,tail,holin,protease	Pseudomonas_phage(70.91%)	105	5109117:5109134	5206536:5206553
WP_003085891.1|5108977_5109391_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
5109117:5109134	attL	GCCAGGCGCTCCAGGGCA	NA	NA	NA	NA
WP_003085889.1|5109512_5109896_-	lysozyme inhibitor	NA	NA	NA	NA	NA
WP_003085884.1|5110048_5111467_-	amino acid permease	NA	NA	NA	NA	NA
WP_023657684.1|5111764_5112838_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_003085876.1|5113159_5113948_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003085873.1|5114031_5114205_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_003085871.1|5114230_5115190_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003085869.1|5115240_5116023_-	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003134291.1|5116097_5118554_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.3	5.9e-20
WP_003085865.1|5118848_5120639_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	4.3e-36
WP_003145641.1|5120631_5121234_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003085861.1|5121273_5122212_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003085859.1|5122376_5122682_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_003120754.1|5122695_5123244_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_003085857.1|5123411_5124431_+	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_003085854.1|5124559_5125954_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003085852.1|5125946_5126570_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003085850.1|5126849_5128019_+	chitin-binding protein CbpD	NA	NA	NA	NA	NA
WP_003085848.1|5128195_5129158_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_003085846.1|5129168_5129588_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_003085844.1|5129841_5130792_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.1	4.9e-55
WP_003085842.1|5130925_5131525_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_083144810.1|5131457_5133665_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	35.1	3.2e-09
WP_003085838.1|5133749_5134490_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_014603629.1|5134867_5136880_+	neutral/alkaline ceramidase	NA	NA	NA	NA	NA
WP_003085833.1|5137221_5139414_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_009315289.1|5139431_5140055_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_003085828.1|5140142_5141363_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003085826.1|5141366_5142326_-	DegV family protein	NA	NA	NA	NA	NA
WP_003085824.1|5142516_5143629_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003085819.1|5143669_5144260_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085818.1|5144412_5144895_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003085816.1|5145100_5145586_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003109430.1|5145554_5145893_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_003085814.1|5145892_5147077_+	acetate kinase	NA	NA	NA	NA	NA
WP_003085813.1|5147139_5149254_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003085811.1|5149380_5150295_+	acyltransferase	NA	NA	NA	NA	NA
WP_003085808.1|5150364_5151078_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003085806.1|5151183_5151825_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003085802.1|5151926_5152946_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085801.1|5153070_5153904_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003085798.1|5154037_5154979_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
WP_003085795.1|5155087_5155771_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085791.1|5155858_5156737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031632464.1|5157341_5158067_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	58.9	1.2e-56
WP_014603627.1|5159426_5162879_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	83.0	0.0e+00
WP_022580264.1|5162935_5163508_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	63.6	1.3e-58
WP_015649318.1|5163556_5163973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649319.1|5163969_5164212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085782.1|5164258_5165017_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	75.7	2.1e-117
WP_014603625.1|5165019_5165766_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.5	5.1e-116
WP_003085778.1|5165762_5166101_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	49.1	1.1e-28
WP_003085775.1|5166100_5169358_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	35.9	4.0e-80
WP_003085773.1|5169398_5169626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085771.1|5169622_5169967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085769.1|5170011_5170512_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	79.3	2.8e-70
WP_003085767.1|5170544_5170931_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	63.8	4.9e-38
WP_023103986.1|5170923_5171496_-	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	48.9	1.3e-39
WP_003085763.1|5171499_5171694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580265.1|5171699_5172026_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_003085762.1|5172025_5172349_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_003085760.1|5172348_5172552_-	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_003085757.1|5172603_5173818_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.3	4.1e-155
WP_003085756.1|5173814_5174459_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_023103987.1|5174442_5175660_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.2	1.5e-170
WP_022580266.1|5175662_5177342_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.8	2.8e-194
WP_003085748.1|5177345_5177837_-	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_023103989.1|5178251_5178581_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_003085741.1|5178580_5179054_-|lysis	lysis protein Rz	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	3.3e-68
WP_003085739.1|5179060_5179291_-	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	60.6	4.1e-16
WP_003085737.1|5179304_5179916_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.1	4.0e-103
WP_004353177.1|5179912_5180245_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085732.1|5180330_5180861_-	hypothetical protein	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_003085729.1|5181389_5181947_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	97.1	1.2e-74
WP_003085726.1|5181943_5182228_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.6	4.5e-41
WP_003085724.1|5182224_5183622_-	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	1.5e-265
WP_003085722.1|5183618_5184239_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.5	2.9e-109
WP_023086959.1|5184414_5185254_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	96.1	7.9e-150
WP_003085718.1|5185250_5185481_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	100.0	4.1e-40
WP_003085716.1|5185477_5186242_-	hypothetical protein	NA	A0A1W6JTB2	Pseudomonas_phage	97.2	5.9e-136
WP_003085714.1|5186238_5186472_-	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	96.1	6.4e-33
WP_023103745.1|5186464_5186743_-	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	79.3	7.1e-31
WP_083144812.1|5186739_5187048_-	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	92.2	1.6e-44
WP_003085707.1|5187044_5187245_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	76.9	2.5e-17
WP_023103992.1|5187319_5187670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085704.1|5187975_5188368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023465045.1|5188364_5188703_-	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.4	7.9e-08
WP_014603618.1|5188791_5189583_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	81.2	2.5e-76
WP_019396631.1|5189695_5189989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085700.1|5190006_5190345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236447.1|5190397_5190475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083144814.1|5190665_5191052_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	95.7	2.4e-53
WP_014603617.1|5191054_5191288_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_003085694.1|5191387_5191642_+	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_003085692.1|5191638_5192475_+	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	100.0	1.0e-128
WP_003085689.1|5192516_5192747_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	89.5	2.9e-30
WP_003085687.1|5192749_5193085_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	99.1	1.2e-53
WP_003085685.1|5193081_5193897_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	87.7	5.7e-60
WP_003085682.1|5194015_5194207_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_023103993.1|5194914_5195244_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	99.1	1.8e-57
WP_023103994.1|5195386_5196574_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	98.5	3.3e-226
WP_071534837.1|5196554_5197004_-	hypothetical protein	NA	A0A1W6JT96	Pseudomonas_phage	98.4	2.5e-62
WP_124186856.1|5197000_5197414_-	hypothetical protein	NA	A0A1W6JT99	Pseudomonas_phage	100.0	9.8e-69
WP_003085674.1|5197805_5199515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085672.1|5199500_5200487_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	49.8	2.2e-90
5206536:5206553	attR	TGCCCTGGAGCGCCTGGC	NA	NA	NA	NA
