The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	0	10923	3870945	transposase	Escherichia_phage(66.67%)	10	NA	NA
WP_000991897.1|1916_2780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135195.1|2912_3425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033718.1|3424_3709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582283.1|3701_4124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698342.1|4177_4954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067790.1|5986_6691_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_001089072.1|6794_8000_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|8081_8705_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_000512977.1|8682_9087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067790.1|10218_10923_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
>prophage 2
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	14102	15733	3870945	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_000613548.1|14102_14642_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	48.9	8.9e-38
WP_001067790.1|15028_15733_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
>prophage 3
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	27597	36974	3870945		Staphylococcus_phage(33.33%)	8	NA	NA
WP_000853309.1|27597_29241_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	37.7	4.6e-77
WP_000083689.1|29285_29864_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000137910.1|30033_30810_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_083043931.1|30868_32167_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.1	5.8e-107
WP_000338779.1|32182_32563_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000993407.1|32519_32957_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000891204.1|33216_34926_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_086225868.1|34934_36974_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.5	2.1e-39
>prophage 4
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	66293	68246	3870945		Wolbachia_phage(100.0%)	1	NA	NA
WP_000129015.1|66293_68246_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	2.7e-84
>prophage 5
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	72591	74997	3870945	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000009660.1|72591_73101_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_000803936.1|73269_74997_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.5e-187
>prophage 6
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	85636	87349	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002124462.1|85636_87349_+	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.3e-77
>prophage 7
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	109475	109946	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001123841.1|109475_109946_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
>prophage 8
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	116524	118111	3870945		Hokovirus(100.0%)	1	NA	NA
WP_031958128.1|116524_118111_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	25.9	1.1e-19
>prophage 9
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	123221	125778	3870945	transposase	uncultured_virus(50.0%)	3	NA	NA
WP_000343018.1|123221_124430_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_031958813.1|124518_125043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775740.1|125058_125778_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
>prophage 10
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	137253	143661	3870945	protease	Mycobacterium_phage(50.0%)	4	NA	NA
WP_031958817.1|137253_138732_+	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	25.9	1.5e-26
WP_005119983.1|138998_140780_+	metalloendopeptidase CpaA	NA	NA	NA	NA	NA
WP_000739695.1|140802_141417_+|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_057784728.1|141540_143661_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.6	1.8e-41
>prophage 11
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	161276	206145	3870945	capsid,integrase,terminase	Acinetobacter_phage(96.43%)	65	155059:155077	175543:175561
155059:155077	attL	TATTTAATAAAATTAAAGC	NA	NA	NA	NA
WP_000773627.1|161276_162539_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
WP_000910238.1|162544_162814_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_002061752.1|162814_163072_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	90.6	7.5e-43
WP_000048750.1|163075_163360_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.7e-43
WP_000453808.1|163356_163566_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
WP_000654849.1|163568_163814_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_032015462.1|163815_164892_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	76.0	1.6e-142
WP_000215606.1|164888_165959_-	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	51.0	1.0e-48
WP_031958825.1|165970_166294_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	80.4	2.9e-44
WP_031958827.1|166286_166736_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.8e-71
WP_031958828.1|167021_167612_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	28.9	1.0e-10
WP_031958830.1|167608_168721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031958832.1|168777_168993_-	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	95.8	5.5e-31
WP_031958833.1|169052_169346_-	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	79.4	4.8e-38
WP_031958835.1|169783_170545_-	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	95.2	8.2e-138
WP_000996060.1|170653_170905_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
WP_000048916.1|170915_171236_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_024435837.1|171291_171567_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	95.6	3.2e-39
WP_001084132.1|171563_171860_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	100.0	1.6e-49
WP_046025192.1|171856_172201_+	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	98.2	9.1e-52
WP_031958838.1|172272_173166_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	99.0	1.7e-158
WP_000993074.1|173162_173933_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	99.6	1.2e-147
WP_000159939.1|173929_174058_+	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	95.2	1.5e-15
WP_031958840.1|174050_174257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017816972.1|174246_174570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958841.1|174569_174965_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	5.1e-67
WP_025469903.1|174961_175459_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	98.2	2.4e-90
WP_031958842.1|175610_176315_+	hypothetical protein	NA	NA	NA	NA	NA
175543:175561	attR	GCTTTAATTTTATTAAATA	NA	NA	NA	NA
WP_031958844.1|176405_176660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958846.1|176656_176875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958847.1|176999_177410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038350501.1|177447_177915_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	80.0	4.7e-67
WP_000372128.1|177883_178525_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.1	1.4e-125
WP_000212566.1|178582_179053_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000102078.1|179042_180470_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	95.4	1.3e-269
WP_031958849.1|180466_181912_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.0	4.0e-282
WP_000179751.1|181918_183022_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.7	7.8e-206
WP_000965231.1|183030_183459_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004365.1|183557_183794_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	94.9	4.8e-36
WP_001139861.1|184017_184209_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|184322_185090_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214189.1|185117_186074_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_004743766.1|186139_186805_+	hypothetical protein	NA	J7I4P7	Acinetobacter_phage	100.0	1.5e-114
WP_031958850.1|186809_187199_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	96.1	1.8e-64
WP_031958852.1|187200_187569_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	96.7	2.5e-63
WP_031958853.1|187606_188302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032016325.1|188403_188772_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	1.5e-60
WP_009517131.1|188773_189172_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	97.0	5.0e-70
WP_031958856.1|189240_189594_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	94.0	6.6e-58
WP_031958858.1|189593_190742_+	fibronectin type III domain-containing protein	NA	J7I0X3	Acinetobacter_phage	86.3	8.9e-152
WP_031958860.1|190794_191712_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.4	6.0e-167
WP_001185602.1|191781_192297_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	99.3	6.3e-73
WP_000838146.1|192622_192805_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_000966688.1|192897_193302_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000720074.1|193383_193761_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	94.4	2.1e-62
WP_038350500.1|193862_198791_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	86.5	0.0e+00
WP_000937385.1|198865_199618_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	35.2	1.3e-34
WP_031958903.1|199621_200014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958904.1|200078_200477_+	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	95.5	1.3e-70
WP_000368392.1|200476_200983_+	DUF1833 family protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
WP_000835157.1|200979_201342_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
WP_031958905.1|201334_204781_+	bacteriophage protein	NA	J7HXG3	Acinetobacter_phage	97.4	0.0e+00
WP_004714964.1|204849_205239_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	7.3e-66
WP_002055788.1|205281_205827_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	90.6	2.6e-93
WP_002055784.1|205827_206145_+	hypothetical protein	NA	E5KY21	Escherichia_phage	58.5	3.3e-24
>prophage 12
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	213756	215085	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_031958684.1|213756_215085_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	43.9	1.2e-99
>prophage 13
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	235061	237531	3870945		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001047541.1|235061_235373_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.7e-18
WP_000194628.1|235392_235677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859774.1|235694_236045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105718.1|236089_236458_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	6.8e-13
WP_000604790.1|236523_237531_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
>prophage 14
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	252229	252982	3870945		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000132219.1|252229_252982_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	4.3e-22
>prophage 15
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	263708	264758	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_000344169.1|263708_264758_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 16
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	273183	280848	3870945	transposase	uncultured_virus(50.0%)	6	NA	NA
WP_031958670.1|273183_274362_+	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	40.6	1.9e-32
WP_000957166.1|274408_275863_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.1	4.0e-181
WP_000332537.1|276109_276739_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	53.6	9.1e-58
WP_001032866.1|277093_278536_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000120225.1|278593_279037_-	universal stress protein	NA	NA	NA	NA	NA
WP_000343018.1|279639_280848_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 17
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	287391	290250	3870945		Hokovirus(100.0%)	1	NA	NA
WP_000880363.1|287391_290250_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.8	1.0e-15
>prophage 18
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	327411	331960	3870945	protease	uncultured_Mediterranean_phage(25.0%)	4	NA	NA
WP_001260033.1|327411_327825_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
WP_000952702.1|327834_330111_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
WP_002037052.1|330114_330477_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.6e-27
WP_031958693.1|330904_331960_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	46.1	4.7e-83
>prophage 19
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	339838	343700	3870945		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000148658.1|339838_341476_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	1.4e-150
WP_000080538.1|341507_342365_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
WP_000078452.1|342410_343700_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
>prophage 20
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	354502	355330	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_086225897.1|354502_355330_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.2	9.9e-20
>prophage 21
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	406600	407431	3870945		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000542598.1|406600_407431_+	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	29.5	1.0e-11
>prophage 22
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	423719	425360	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000166090.1|423719_425360_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	8.8e-36
>prophage 23
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	444640	450982	3870945		Bacillus_virus(50.0%)	7	NA	NA
WP_000614440.1|444640_445405_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	2.1e-16
WP_005120032.1|445401_445893_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001244457.1|445887_446676_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000965112.1|446773_447583_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001007516.1|447764_448649_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	37.9	1.3e-33
WP_000152972.1|448660_450154_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	50.9	2.7e-140
WP_000155296.1|450214_450982_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	33.0	1.9e-25
>prophage 24
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	462955	463396	3870945		Vibrio_phage(100.0%)	1	NA	NA
WP_031958159.1|462955_463396_-	HD domain-containing protein	NA	A0A2D0Z166	Vibrio_phage	35.5	2.4e-12
>prophage 25
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	482064	485434	3870945		Stenotrophomonas_phage(100.0%)	5	NA	NA
WP_000505020.1|482064_483222_-	replication initiation factor domain-containing protein	NA	Q4LAU7	Stenotrophomonas_phage	35.1	1.3e-25
WP_024432478.1|483221_483440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140850.1|483559_483751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000983197.1|483977_484274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000505020.1|484276_485434_-	replication initiation factor domain-containing protein	NA	Q4LAU7	Stenotrophomonas_phage	35.1	1.3e-25
>prophage 26
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	493851	494961	3870945		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842121.1|493851_494961_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.1	4.0e-32
>prophage 27
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	499660	500128	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001136801.1|499660_500128_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	3.8e-37
>prophage 28
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	515692	516313	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_031958180.1|515692_516313_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.1	1.1e-15
>prophage 29
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	525913	526699	3870945		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001017892.1|525913_526699_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	1.6e-11
>prophage 30
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	547645	551071	3870945		Burkholderia_virus(50.0%)	4	NA	NA
WP_000222738.1|547645_548932_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.1	9.6e-38
WP_001167099.1|548971_549253_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_000011840.1|549236_550235_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000029005.1|550231_551071_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	4.1e-37
>prophage 31
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	556424	557774	3870945		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_031958191.1|556424_557774_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	3.1e-31
>prophage 32
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	579816	580908	3870945		Pandoravirus(100.0%)	1	NA	NA
WP_000918444.1|579816_580908_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 33
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	603401	605159	3870945		Pithovirus(100.0%)	1	NA	NA
WP_000567296.1|603401_605159_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.5e-20
>prophage 34
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	613759	617363	3870945		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000572397.1|613759_614869_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	7.2e-82
WP_031958198.1|614944_615688_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_031958199.1|615794_617363_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.8	5.3e-115
>prophage 35
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	639637	645094	3870945		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000070798.1|639637_641011_+	AarF/ABC1/UbiB kinase family protein	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
WP_169538895.1|641240_642524_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001053234.1|642545_643751_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000993544.1|643870_645094_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.6	1.9e-51
>prophage 36
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	648267	648540	3870945		Burkholderia_phage(100.0%)	1	NA	NA
WP_001043034.1|648267_648540_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 37
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	651892	657005	3870945		Lake_Baikal_phage(50.0%)	6	NA	NA
WP_000331712.1|651892_652279_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
WP_000581597.1|652309_652630_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
WP_001015254.1|652715_653234_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196574.1|653272_655132_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.9	4.7e-102
WP_001137383.1|655150_655489_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001175669.1|655535_657005_-	guanylate cyclase	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
>prophage 38
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	661331	662540	3870945	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_000343018.1|661331_662540_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 39
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	667054	673702	3870945		uncultured_virus(33.33%)	5	NA	NA
WP_002036323.1|667054_667789_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
WP_000892962.1|667821_669555_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-18
WP_000953847.1|669567_670710_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000881922.1|670717_671656_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086225881.1|671668_673702_-	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.8	7.0e-75
>prophage 40
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	678105	680805	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000731501.1|678105_680805_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.7	1.9e-40
>prophage 41
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	692389	692692	3870945		Burkholderia_phage(100.0%)	1	NA	NA
WP_000205997.1|692389_692692_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 42
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	695833	698178	3870945	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000033177.1|695833_696337_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
WP_001983908.1|696343_697468_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_001177527.1|697464_698178_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.2	1.4e-51
>prophage 43
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	706214	710734	3870945		Bacillus_phage(33.33%)	5	NA	NA
WP_001070729.1|706214_707942_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.4	8.6e-58
WP_000669683.1|707938_708367_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_000264035.1|708382_709018_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000023429.1|709067_709955_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
WP_000057212.1|709951_710734_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	5.7e-17
>prophage 44
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	727103	733637	3870945		Bacillus_phage(33.33%)	6	NA	NA
WP_000922246.1|727103_728951_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	6.9e-29
WP_000966086.1|728950_729391_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_031958451.1|729499_730525_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001016343.1|730563_730938_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_031958449.1|731040_731739_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.6	1.3e-33
WP_000119795.1|732146_733637_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
>prophage 45
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	745666	746833	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001209544.1|745666_746833_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 46
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	768201	769434	3870945	integrase	Moraxella_phage(100.0%)	1	761451:761465	769866:769880
761451:761465	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_005120070.1|768201_769434_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.8	3.2e-83
WP_005120070.1|768201_769434_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.8	3.2e-83
769866:769880	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 47
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	775421	776165	3870945		Planktothrix_phage(100.0%)	1	NA	NA
WP_001132006.1|775421_776165_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 48
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	785916	786993	3870945		Planktothrix_phage(100.0%)	1	NA	NA
WP_085941321.1|785916_786993_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
>prophage 49
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	799744	800230	3870945		Fowlpox_virus(100.0%)	1	NA	NA
WP_000066032.1|799744_800230_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 50
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	806055	809619	3870945		Streptomyces_phage(100.0%)	1	NA	NA
WP_001160984.1|806055_809619_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	4.0e-174
>prophage 51
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	814502	816068	3870945		Lactococcus_phage(100.0%)	1	NA	NA
WP_000886807.1|814502_816068_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.3e-25
>prophage 52
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	819556	820399	3870945		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000610147.1|819556_819886_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
WP_000138011.1|819970_820399_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.6	6.9e-41
>prophage 53
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	829657	830452	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_000114459.1|829657_830452_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	5.7e-33
>prophage 54
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	852166	853657	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000113418.1|852166_853657_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.0	9.5e-21
>prophage 55
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	861222	864091	3870945		Tupanvirus(50.0%)	2	NA	NA
WP_001107594.1|861222_862155_+	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
WP_000211583.1|862129_864091_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	1.6e-92
>prophage 56
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	868126	875309	3870945		Planktothrix_phage(50.0%)	7	NA	NA
WP_001130364.1|868126_868858_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	1.3e-34
WP_000418066.1|868860_869526_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_086225844.1|869515_870151_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002017921.1|870239_870353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025680.1|870460_870745_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000107122.1|870888_871848_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_031958735.1|871844_875309_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.2	8.6e-33
>prophage 57
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	878471	888951	3870945		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
WP_001124837.1|878471_879083_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.4	4.9e-48
WP_000795915.1|879365_879602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161794718.1|879662_880835_-	stress-induced protein	NA	NA	NA	NA	NA
WP_000983633.1|881385_881799_+	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_000432325.1|881940_882819_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.8	2.9e-54
WP_086225855.1|882873_885018_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.3	1.8e-137
WP_001145679.1|885072_886482_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_000482091.1|886795_887275_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	50.3	1.8e-34
WP_000108365.1|887559_887781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132045.1|887886_888204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498477.1|888288_888510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031958335.1|888597_888951_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.2	9.4e-20
>prophage 58
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	895254	904336	3870945		Staphylococcus_phage(33.33%)	7	NA	NA
WP_001183735.1|895254_896949_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.2	3.8e-26
WP_001985858.1|897060_897654_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053635.1|897822_898995_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001072776.1|899019_900621_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
WP_000121724.1|900630_901434_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000461812.1|901445_903437_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_001288908.1|903433_904336_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	40.0	2.1e-47
>prophage 59
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	920438	921200	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_000101926.1|920438_921200_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	42.5	1.0e-07
>prophage 60
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	938582	939785	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_001166807.1|938582_939785_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	2.5e-27
>prophage 61
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	989831	990785	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_002037029.1|989831_990785_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
>prophage 62
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	994730	997412	3870945		Salicola_phage(100.0%)	1	NA	NA
WP_086225856.1|994730_997412_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.0	1.3e-81
>prophage 63
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1013246	1018345	3870945		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_005120102.1|1013246_1015877_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	54.7	1.5e-279
WP_000043351.1|1016022_1016424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542529.1|1016519_1017464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001000083.1|1017463_1018345_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	1.7e-38
>prophage 64
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1028956	1036275	3870945	transposase	Synechococcus_phage(33.33%)	7	NA	NA
WP_001202397.1|1028956_1030120_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
WP_000921222.1|1030372_1030804_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001133101.1|1030864_1031425_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000343018.1|1032086_1033295_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_000792047.1|1033392_1033977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465117.1|1034038_1034947_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000698627.1|1035054_1036275_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.7	1.2e-32
>prophage 65
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1046804	1047263	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001127331.1|1046804_1047263_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
>prophage 66
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1054668	1055601	3870945		Morganella_phage(100.0%)	1	NA	NA
WP_031958640.1|1054668_1055601_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 67
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1059311	1099825	3870945	tRNA,transposase,capsid	Acinetobacter_phage(36.84%)	45	NA	NA
WP_001083258.1|1059311_1061957_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
WP_049081181.1|1062021_1062552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000144889.1|1062897_1063221_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000232555.1|1063401_1064073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186835.1|1064212_1064881_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
WP_001082436.1|1064997_1065840_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_000132355.1|1065995_1066607_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_000885988.1|1066599_1067199_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000003555.1|1067291_1068482_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_031958638.1|1068478_1070620_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_001183458.1|1072341_1073088_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_000554244.1|1073087_1073636_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_000381220.1|1073619_1074168_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000179337.1|1074205_1074745_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_001133556.1|1074748_1075726_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	5.6e-38
WP_001182268.1|1075939_1077361_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.9e-55
WP_001171621.1|1077625_1077763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248355.1|1078033_1078663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644333.1|1079046_1079640_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_000157562.1|1080179_1080368_-	peptidoglycan-binding protein	NA	A0A0B5L5G0	Acinetobacter_phage	92.9	1.1e-14
WP_001210985.1|1080381_1080711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024023.1|1080797_1081244_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648030.1|1081355_1082570_+	MFS transporter	NA	NA	NA	NA	NA
WP_000790413.1|1082564_1083671_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	65.7	1.2e-142
WP_001004673.1|1083768_1084113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|1084405_1084864_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_001982898.1|1085350_1085470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171072896.1|1085625_1086171_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002058540.1|1086190_1086442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350300.1|1086721_1086946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072673.1|1087148_1087364_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000015967.1|1087882_1088500_+	LysE family translocator	NA	NA	NA	NA	NA
WP_001019684.1|1088566_1089112_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	6.0e-74
WP_000427180.1|1089149_1089539_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	74.4	4.8e-49
WP_001185369.1|1090138_1090810_+	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_000636785.1|1090961_1091195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001283244.1|1091700_1092963_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.4	1.9e-14
WP_000998195.1|1092955_1093150_+	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
WP_000825870.1|1093374_1093599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031958635.1|1093649_1094243_-	LysE family transporter	NA	NA	NA	NA	NA
WP_000980492.1|1094682_1095012_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	1.2e-32
WP_001088965.1|1095491_1095848_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000331654.1|1096441_1096849_-	GFA family protein	NA	NA	NA	NA	NA
WP_001020650.1|1096876_1097278_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_031958633.1|1097353_1099825_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.7	4.6e-97
>prophage 68
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1110942	1118858	3870945		Catovirus(50.0%)	6	NA	NA
WP_031958631.1|1110942_1114800_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.9	1.9e-44
WP_001987180.1|1115140_1115716_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000024050.1|1115908_1116124_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001133993.1|1116188_1116776_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_000058246.1|1116812_1117031_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_170358002.1|1117271_1118858_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.5	6.1e-26
>prophage 69
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1138797	1143029	3870945		uncultured_virus(33.33%)	3	NA	NA
WP_000941311.1|1138797_1139286_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|1139342_1141922_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237343.1|1142222_1143029_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
>prophage 70
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1147716	1198453	3870945	tRNA,transposase,integrase,terminase	Acinetobacter_phage(65.12%)	58	1154539:1154559	1192308:1192328
WP_000517792.1|1147716_1149036_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|1149100_1150267_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188828.1|1150542_1151568_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000199466.1|1151837_1154474_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.4e-75
1154539:1154559	attL	TATGGCATTAATCGTTCAAAA	NA	NA	NA	NA
WP_031958620.1|1154760_1155963_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PHZ3	Moraxella_phage	50.4	2.7e-103
WP_000849926.1|1156218_1156926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958618.1|1157021_1157666_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	48.3	4.3e-55
WP_031958617.1|1157781_1158276_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.7	5.9e-44
WP_031958615.1|1158279_1159578_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.6	3.7e-154
WP_002045795.1|1159655_1160402_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	1.8e-12
WP_002045824.1|1160539_1161703_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.5	5.5e-08
WP_031958610.1|1162144_1162537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958609.1|1162673_1163219_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	93.4	4.7e-95
WP_000433907.1|1163260_1163650_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_031958608.1|1163718_1167165_-	bacteriophage protein	NA	A0A0P0HSH9	Acinetobacter_phage	96.7	0.0e+00
WP_000835166.1|1167157_1167520_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	100.0	3.4e-65
WP_000368364.1|1167516_1168023_-	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	97.6	1.0e-91
WP_031958607.1|1168022_1168421_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.0	3.5e-71
WP_000369030.1|1168482_1168869_-	hypothetical protein	NA	J7I476	Acinetobacter_phage	100.0	3.3e-66
WP_002067608.1|1168861_1169620_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	99.6	7.9e-141
WP_078190277.1|1169777_1172540_-	transglycosylase SLT domain-containing protein	NA	A0A0D4DC37	Acinetobacter_phage	54.8	4.4e-197
WP_031958584.1|1173514_1174861_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	99.3	3.0e-252
WP_031958582.1|1174900_1176193_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	85.8	2.7e-213
WP_031958580.1|1176152_1176674_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	64.2	9.8e-58
WP_005123832.1|1176732_1177374_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	99.5	6.1e-126
WP_015451458.1|1177342_1177777_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.1	5.1e-76
WP_000134355.1|1177789_1177981_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	87.3	8.9e-25
WP_000898317.1|1178037_1178283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031958579.1|1178791_1179004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992308.1|1179151_1179565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203142.1|1179567_1179972_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.9	5.2e-22
WP_029749821.1|1179968_1180187_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	90.7	1.7e-19
WP_000778994.1|1180282_1180690_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.8	3.8e-25
WP_000017854.1|1180686_1181094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137332.1|1181090_1181891_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	93.6	7.6e-142
WP_031958576.1|1181893_1182775_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	92.8	2.9e-134
WP_031958574.1|1182771_1183059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049332.1|1183114_1183435_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	88.7	3.2e-43
WP_000996059.1|1183445_1183697_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.1	7.1e-38
WP_001093647.1|1183805_1184498_+	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	44.2	1.7e-33
WP_031958571.1|1184557_1185526_+	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	28.7	2.1e-08
WP_000273035.1|1185553_1188076_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_031958569.1|1188229_1188418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031958567.1|1188420_1188750_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	66.7	2.2e-31
WP_031958565.1|1188761_1189883_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.6e-212
WP_031958564.1|1189879_1190881_+	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	97.3	1.0e-183
WP_000654849.1|1190882_1191128_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_000453808.1|1191130_1191340_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
WP_031958426.1|1191336_1191621_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	95.7	7.5e-44
WP_031958424.1|1191624_1191882_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.4	9.4e-46
WP_000362184.1|1191883_1192099_+	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_001185176.1|1192308_1193589_+	aspartate kinase	NA	NA	NA	NA	NA
1192308:1192328	attR	TATGGCATTAATCGTTCAAAA	NA	NA	NA	NA
WP_000906487.1|1193835_1194090_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495834.1|1194159_1194726_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
WP_000735756.1|1194791_1195181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111768.1|1195421_1195979_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077411.1|1196023_1197022_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|1197133_1198453_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
>prophage 71
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1253845	1255081	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_005120336.1|1253845_1255081_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-23
>prophage 72
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1267734	1268943	3870945	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_000343018.1|1267734_1268943_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 73
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1276854	1280049	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000482878.1|1276854_1280049_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	52.0	1.2e-278
>prophage 74
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1286094	1287180	3870945		Escherichia_phage(100.0%)	1	NA	NA
WP_000622036.1|1286094_1287180_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	41.5	8.4e-19
>prophage 75
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1297560	1300028	3870945		Bacillus_virus(50.0%)	3	NA	NA
WP_000529369.1|1297560_1298625_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	36.4	5.1e-45
WP_000607011.1|1298740_1298974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233587.1|1298990_1300028_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.1	2.7e-59
>prophage 76
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1303785	1304688	3870945		Moraxella_phage(100.0%)	1	NA	NA
WP_031958393.1|1303785_1304688_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	40.4	1.7e-57
>prophage 77
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1313059	1321418	3870945	integrase	Stenotrophomonas_phage(33.33%)	6	1312615:1312629	1323469:1323483
1312615:1312629	attL	AATACTTTGCAAAAA	NA	NA	NA	NA
WP_025466770.1|1313059_1314268_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.5	1.2e-61
WP_000205099.1|1314611_1316642_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001986427.1|1316907_1318266_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000013369.1|1318324_1319587_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001084867.1|1319736_1320771_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001982681.1|1320755_1321418_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
1323469:1323483	attR	AATACTTTGCAAAAA	NA	NA	NA	NA
>prophage 78
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1325298	1326888	3870945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000550799.1|1325298_1326888_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	4.2e-19
>prophage 79
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1330808	1335636	3870945		Lactobacillus_phage(50.0%)	2	NA	NA
WP_000277812.1|1330808_1334024_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.8	3.4e-15
WP_002036374.1|1334256_1335636_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
>prophage 80
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1340427	1341264	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_001275992.1|1340427_1341264_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	5.3e-45
>prophage 81
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1353101	1355531	3870945		Moraxella_phage(100.0%)	1	NA	NA
WP_001292274.1|1353101_1355531_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 82
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1382340	1388483	3870945	tRNA	Hokovirus(50.0%)	5	NA	NA
WP_000019509.1|1382340_1383954_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
WP_000140408.1|1383984_1384893_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_002011285.1|1384885_1385017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000479766.1|1385273_1386731_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_001128173.1|1386920_1388483_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	5.5e-88
>prophage 83
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1400568	1401261	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_001136091.1|1400568_1401261_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	7.0e-11
>prophage 84
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1417635	1422876	3870945		Dickeya_phage(50.0%)	2	NA	NA
WP_000105327.1|1417635_1421322_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
WP_000350748.1|1421367_1422876_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	26.7	1.1e-32
>prophage 85
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1428896	1437927	3870945		Synechococcus_phage(25.0%)	8	NA	NA
WP_000117817.1|1428896_1429379_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.9e-19
WP_000371873.1|1429613_1430912_+	MFS transporter	NA	NA	NA	NA	NA
WP_086225840.1|1430974_1432150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140236.1|1432326_1433967_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.9	9.1e-25
WP_001040550.1|1434005_1435472_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000735779.1|1435485_1436277_-	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_000009973.1|1436292_1437087_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000988617.1|1437102_1437927_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.7	6.2e-14
>prophage 86
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1445876	1446458	3870945		Raoultella_phage(100.0%)	1	NA	NA
WP_000074694.1|1445876_1446458_-	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	29.1	8.0e-08
>prophage 87
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1457257	1465172	3870945	holin	Vibrio_phage(66.67%)	5	NA	NA
WP_000179784.1|1457257_1459324_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
WP_000243381.1|1459441_1461064_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
WP_001985959.1|1461317_1461953_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001286311.1|1461945_1463418_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001021935.1|1463513_1465172_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.5e-56
>prophage 88
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1488829	1493475	3870945		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_020752882.1|1488829_1490680_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	4.0e-29
WP_050680762.1|1490697_1491612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031958372.1|1491761_1492274_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031958373.1|1492266_1493475_-	5-aminolevulinate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.7	2.4e-38
>prophage 89
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1501540	1508208	3870945	integrase	Pseudomonas_phage(33.33%)	9	1492411:1492428	1510366:1510383
1492411:1492428	attL	TTGAATATAAATATTATG	NA	NA	NA	NA
WP_001022395.1|1501540_1504006_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	27.4	5.0e-51
WP_001064707.1|1504018_1504297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787150.1|1504411_1504726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046481.1|1504735_1505104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988245.1|1505096_1505651_-	hypothetical protein	NA	A0A0R6PGW1	Moraxella_phage	52.0	1.4e-25
WP_001016479.1|1505647_1505857_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000153154.1|1505859_1506075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151566.1|1506202_1506829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831317.1|1506978_1508208_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	39.7	6.7e-73
1510366:1510383	attR	CATAATATTTATATTCAA	NA	NA	NA	NA
>prophage 90
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1512805	1542163	3870945		Acinetobacter_phage(40.0%)	25	NA	NA
WP_000766534.1|1512805_1513576_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	100.0	1.4e-153
WP_001279704.1|1513572_1513860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|1513981_1514200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627457.1|1514192_1514891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030339.1|1514890_1515685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594623.1|1515772_1516021_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000067916.1|1516222_1517122_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	48.9	1.1e-40
WP_000373973.1|1517280_1517994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067934.1|1518209_1519289_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
WP_000951724.1|1519285_1519915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209670.1|1520065_1521517_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	45.4	1.9e-82
WP_002096209.1|1521516_1523469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863709.1|1523542_1524196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098517.1|1524195_1525731_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	3.6e-31
WP_000852568.1|1525889_1526084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852825.1|1526111_1526882_-	hypothetical protein	NA	G4WT79	Acinetobacter_phage	80.0	6.5e-82
WP_000190166.1|1526881_1527280_-	hypothetical protein	NA	G4WT78	Acinetobacter_phage	69.7	7.8e-47
WP_070419664.1|1527280_1537636_-	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	26.9	1.5e-80
WP_001167468.1|1537645_1538539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240941.1|1538538_1538988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187723.1|1538987_1539632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119670.1|1539758_1540025_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.2	5.2e-15
WP_001015563.1|1539987_1540263_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000229653.1|1540808_1541060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210192.1|1541266_1542163_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	46.2	5.6e-45
>prophage 91
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1547278	1558380	3870945	transposase,tail,terminase	Escherichia_phage(40.0%)	14	NA	NA
WP_000343018.1|1547278_1548487_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_000959490.1|1549006_1549252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121108.1|1549297_1549600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000934747.1|1549599_1550145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272161.1|1550134_1551265_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
WP_001243271.1|1551266_1551545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996674.1|1551559_1553098_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001162227.1|1553170_1555162_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014220.1|1555181_1555694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130712.1|1555705_1555906_-	TraR/DksA C4-type zinc finger protein	NA	A0A0U4IIN4	Pseudomonas_phage	43.5	4.8e-05
WP_070419663.1|1555898_1556702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157185.1|1556704_1557610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237356.1|1557682_1557910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|1557921_1558380_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
>prophage 92
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1563351	1565257	3870945		Enterobacteria_phage(50.0%)	2	NA	NA
WP_001259761.1|1563351_1564251_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	41.5	3.2e-40
WP_000801066.1|1564315_1565257_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	29.6	4.2e-06
>prophage 93
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1572596	1591513	3870945	integrase	Acinetobacter_phage(43.75%)	30	1566119:1566132	1594580:1594593
1566119:1566132	attL	TGTTTTTGCTATTT	NA	NA	NA	NA
WP_001136753.1|1572596_1573052_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_000990950.1|1573507_1574041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994866.1|1574037_1574802_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_031944289.1|1574798_1575842_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_002052057.1|1575918_1576989_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
WP_095357150.1|1577060_1577423_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_000648413.1|1577472_1577895_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_001031749.1|1577881_1578016_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000544506.1|1578012_1578762_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001110396.1|1578754_1579705_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_020752534.1|1579701_1580748_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
WP_001092750.1|1580744_1582415_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	46.2	2.4e-153
WP_001205618.1|1582420_1583059_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_000575725.1|1583055_1583511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|1583507_1583693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|1583689_1583890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|1583923_1584298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335919.1|1584330_1584564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000550612.1|1584690_1585380_+	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
WP_000922095.1|1585391_1585667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105905.1|1585882_1586215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290757.1|1586254_1587058_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	32.9	9.0e-26
WP_000369787.1|1587143_1587404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072363.1|1587462_1587792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260061.1|1587788_1588160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070419661.1|1588330_1589011_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000805206.1|1589023_1589386_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_000119263.1|1589512_1589683_+	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	71.4	1.2e-12
WP_000240808.1|1589693_1590377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947476.1|1590361_1591513_-|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.8	8.4e-134
1594580:1594593	attR	AAATAGCAAAAACA	NA	NA	NA	NA
>prophage 94
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1604426	1608023	3870945		Lactobacillus_virus(100.0%)	1	NA	NA
WP_083043943.1|1604426_1608023_+	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	5.8e-08
>prophage 95
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1617332	1621467	3870945		Bacillus_phage(66.67%)	3	NA	NA
WP_001102846.1|1617332_1618751_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	1.3e-40
WP_000868152.1|1618950_1619403_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
WP_000093035.1|1619427_1621467_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
>prophage 96
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1627730	1631983	3870945		Mycobacterium_phage(50.0%)	2	NA	NA
WP_000127816.1|1627730_1630766_-	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
WP_031958383.1|1631035_1631983_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	1.8e-62
>prophage 97
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1636474	1639898	3870945		Cedratvirus(50.0%)	2	NA	NA
WP_001029610.1|1636474_1637665_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
WP_000113824.1|1637759_1639898_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
>prophage 98
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1646670	1648296	3870945		Agrobacterium_phage(100.0%)	1	NA	NA
WP_020752858.1|1646670_1648296_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.1	2.9e-92
>prophage 99
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1653272	1655911	3870945		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_031958746.1|1653272_1654247_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.3	6.2e-29
WP_002036843.1|1654258_1655911_-	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.7	4.1e-09
>prophage 100
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1660037	1661406	3870945		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001979799.1|1660037_1660301_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
WP_000047853.1|1660302_1660794_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001029798.1|1660929_1661406_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
>prophage 101
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1665407	1667273	3870945		Caulobacter_phage(100.0%)	1	NA	NA
WP_001007234.1|1665407_1667273_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	9.3e-58
>prophage 102
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1672259	1673210	3870945		Tupanvirus(100.0%)	1	NA	NA
WP_001133287.1|1672259_1673210_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 103
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1677533	1681563	3870945		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000096537.1|1677533_1678193_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	1.6e-41
WP_000985172.1|1678258_1678933_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_001247940.1|1679030_1679798_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000522216.1|1679843_1680317_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_001279871.1|1680507_1680744_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
WP_000191300.1|1680828_1681563_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
>prophage 104
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1686001	1691458	3870945		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_000093856.1|1686001_1686598_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
WP_001291249.1|1686639_1687563_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000016594.1|1687615_1688272_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000055871.1|1688272_1689022_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000054313.1|1689018_1690176_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.8	1.6e-31
WP_000131438.1|1690177_1691458_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	9.9e-19
>prophage 105
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1697182	1699219	3870945		Ralstonia_phage(100.0%)	1	NA	NA
WP_001018835.1|1697182_1699219_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	4.6e-119
>prophage 106
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1718771	1719341	3870945		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000985728.1|1718771_1719341_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 107
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1754754	1764021	3870945		Bacillus_phage(40.0%)	8	NA	NA
WP_001147032.1|1754754_1756176_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
WP_011858483.1|1756322_1756622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226703.1|1756644_1758237_-	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	7.0e-06
WP_000076440.1|1758326_1759043_-	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000143214.1|1759039_1759246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111540.1|1759575_1762410_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000465010.1|1762465_1762600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025826.1|1762737_1764021_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
>prophage 108
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1790078	1791389	3870945		Burkholderia_virus(100.0%)	1	NA	NA
WP_000383643.1|1790078_1791389_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.4	6.5e-58
>prophage 109
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1807465	1807945	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000927482.1|1807465_1807945_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 110
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1814714	1814987	3870945		uncultured_virus(100.0%)	1	NA	NA
WP_000843449.1|1814714_1814987_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	44.2	8.3e-08
>prophage 111
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1821693	1823049	3870945		Pandoravirus(100.0%)	1	NA	NA
WP_031945325.1|1821693_1823049_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.9	2.3e-26
>prophage 112
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1847362	1850134	3870945		uncultured_virus(100.0%)	1	NA	NA
WP_001134667.1|1847362_1850134_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.7	1.8e-65
>prophage 113
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1855573	1864292	3870945	tRNA	Streptomyces_phage(25.0%)	10	NA	NA
WP_001276874.1|1855573_1855900_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.2	5.3e-17
WP_001054522.1|1856220_1857489_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002127429.1|1857682_1857808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002156455.1|1857902_1858148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126166.1|1858318_1858615_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_000703071.1|1858611_1860993_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000050952.1|1861026_1862007_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.2e-35
WP_001207239.1|1862164_1863166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803548.1|1863172_1863676_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002036717.1|1863734_1864292_-	NADAR family protein	NA	A0A1S6UAJ7	Serratia_phage	44.7	1.4e-33
>prophage 114
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1867794	1872314	3870945	tRNA	Agrobacterium_phage(33.33%)	3	NA	NA
WP_012297364.1|1867794_1868346_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
WP_001121792.1|1868351_1870274_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	9.1e-125
WP_000253053.1|1870685_1872314_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.0e-28
>prophage 115
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1876239	1877673	3870945		unidentified_phage(100.0%)	1	NA	NA
WP_169518021.1|1876239_1877673_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	3.5e-20
>prophage 116
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1882279	1888416	3870945		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_000813055.1|1882279_1883671_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.8	3.4e-28
WP_001212165.1|1883680_1884499_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_002000561.1|1884521_1885445_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
WP_000064534.1|1885608_1888416_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
>prophage 117
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1900284	1905480	3870945		uncultured_Caudovirales_phage(83.33%)	7	NA	NA
WP_000080830.1|1900284_1901352_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.2	7.8e-94
WP_001191833.1|1901457_1902411_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	7.8e-61
WP_031958017.1|1902429_1903134_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.1	1.8e-91
WP_000068659.1|1903138_1904179_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000670222.1|1904186_1904660_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	2.1e-35
WP_000373081.1|1904666_1904990_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	7.0e-22
WP_000213576.1|1905045_1905480_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.8	1.8e-41
>prophage 118
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1918354	1926838	3870945	integrase	Bacillus_phage(33.33%)	8	1908610:1908623	1929876:1929889
1908610:1908623	attL	TTATTTTAATTTTA	NA	NA	NA	NA
WP_001221580.1|1918354_1919038_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	1.0e-30
WP_031980636.1|1919027_1920404_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_031958012.1|1920481_1922821_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.3	2.5e-92
WP_031958011.1|1923102_1923483_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_000611873.1|1923549_1924431_+	CopD family protein	NA	NA	NA	NA	NA
WP_078190241.1|1924695_1924914_-	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_000538010.1|1925433_1925706_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_000534872.1|1925689_1926838_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.7	6.5e-94
1929876:1929889	attR	TTATTTTAATTTTA	NA	NA	NA	NA
>prophage 119
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1930023	1930785	3870945	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_000130927.1|1930023_1930785_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	2.0e-14
>prophage 120
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1936753	1938343	3870945		Tupanvirus(100.0%)	1	NA	NA
WP_000471554.1|1936753_1938343_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 121
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1949295	1950408	3870945		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842149.1|1949295_1950408_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	1.2e-33
>prophage 122
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1961608	1975899	3870945	tRNA	Bacillus_phage(20.0%)	10	NA	NA
WP_031958001.1|1961608_1963663_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
WP_001165444.1|1963992_1965009_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_001215920.1|1965041_1965533_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000422094.1|1965532_1967257_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
WP_001054465.1|1967761_1968097_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_000155772.1|1968283_1970908_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.5	1.8e-176
WP_000549819.1|1970935_1971445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762834.1|1971464_1972454_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001124209.1|1972561_1973902_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
WP_000165901.1|1973904_1975899_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.6e-36
>prophage 123
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1979212	1981746	3870945		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_000099436.1|1979212_1979779_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
WP_001173998.1|1979904_1980963_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000443006.1|1981060_1981477_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000729828.1|1981488_1981746_+	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
>prophage 124
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	1991921	1996963	3870945		Powai_lake_megavirus(50.0%)	5	NA	NA
WP_000963851.1|1991921_1992353_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
WP_000524329.1|1992466_1992667_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000669568.1|1992766_1993318_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_086225874.1|1993342_1994641_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000776302.1|1994779_1996963_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	48.7	2.0e-184
>prophage 125
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2001009	2002275	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_001154159.1|2001009_2002275_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 126
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2016251	2018272	3870945	protease	Bacillus_virus(50.0%)	2	NA	NA
WP_001289250.1|2016251_2017565_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
WP_000289452.1|2017666_2018272_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
>prophage 127
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2022598	2023291	3870945		Cyanophage(100.0%)	1	NA	NA
WP_086225876.1|2022598_2023291_+	Fe2+-dependent dioxygenase	NA	A0A127KMW2	Cyanophage	28.0	1.3e-20
>prophage 128
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2028615	2029239	3870945		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000106720.1|2028615_2029239_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	31.2	2.3e-13
>prophage 129
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2039459	2040856	3870945		Geobacillus_virus(50.0%)	2	NA	NA
WP_001203170.1|2039459_2040302_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	7.1e-98
WP_000312546.1|2040346_2040856_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	45.0	2.4e-24
>prophage 130
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2052139	2064614	3870945		Bacillus_phage(25.0%)	11	NA	NA
WP_000050357.1|2052139_2054119_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.7	3.5e-63
WP_000859452.1|2054235_2054808_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000265768.1|2054945_2055704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024261.1|2055791_2058428_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
WP_000368720.1|2058463_2058913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029767.1|2059060_2059435_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648656.1|2059534_2060545_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000165735.1|2060592_2060838_-	SlyX family protein	NA	NA	NA	NA	NA
WP_000323462.1|2060870_2062781_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	2.2e-46
WP_000886297.1|2062926_2063559_+	LysE family translocator	NA	NA	NA	NA	NA
WP_000078881.1|2063678_2064614_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.0	1.4e-41
>prophage 131
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2085441	2087736	3870945		Hokovirus(100.0%)	1	NA	NA
WP_000069129.1|2085441_2087736_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 132
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2111499	2118028	3870945		Ostreococcus_lucimarinus_virus(33.33%)	9	NA	NA
WP_001096918.1|2111499_2112798_+	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
WP_001224256.1|2112899_2113154_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000046495.1|2113406_2113739_+	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_000291735.1|2114167_2114548_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	1.4e-24
WP_000075983.1|2114783_2115194_-	GFA family protein	NA	NA	NA	NA	NA
WP_000066785.1|2115271_2116477_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_014466029.1|2116466_2117105_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001138289.1|2117192_2117387_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_000942273.1|2117383_2118028_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
>prophage 133
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2136281	2137238	3870945		Megavirus(100.0%)	1	NA	NA
WP_001107916.1|2136281_2137238_+	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	50.6	1.4e-12
>prophage 134
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2143963	2149504	3870945		Brevibacillus_phage(50.0%)	2	NA	NA
WP_031957990.1|2143963_2145715_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	23.7	2.0e-17
WP_086225880.1|2145823_2149504_-	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	21.7	9.9e-11
>prophage 135
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2157983	2163479	3870945		Ostreococcus_mediterraneus_virus(50.0%)	4	NA	NA
WP_000612218.1|2157983_2159603_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.7	1.6e-29
WP_000856570.1|2159726_2161040_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_001066569.1|2161193_2161967_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000065138.1|2161976_2163479_+	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
>prophage 136
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2171901	2174601	3870945		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000130326.1|2171901_2174601_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 137
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2195033	2195888	3870945		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001178152.1|2195033_2195888_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	3.6e-17
>prophage 138
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2200267	2201182	3870945		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000598899.1|2200267_2201182_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 139
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2211809	2215283	3870945	transposase	uncultured_virus(50.0%)	2	NA	NA
WP_000343018.1|2211809_2213018_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_001294946.1|2213363_2215283_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.4	4.4e-119
>prophage 140
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2218374	2229367	3870945		uncultured_virus(33.33%)	6	NA	NA
WP_160948595.1|2218374_2219253_-	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	32.0	2.1e-07
WP_000996189.1|2219370_2219868_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001034851.1|2219896_2220253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738603.1|2220466_2220832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000653927.1|2220998_2225192_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
WP_000331899.1|2225278_2229367_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
>prophage 141
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2233341	2240492	3870945		Cedratvirus(33.33%)	5	NA	NA
WP_001029610.1|2233341_2234532_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
WP_000209085.1|2235209_2236703_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	1.0e-35
WP_000109463.1|2236811_2237480_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000219964.1|2237545_2238175_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_001196433.1|2238215_2240492_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	35.2	2.0e-30
>prophage 142
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2266786	2267707	3870945		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000608735.1|2266786_2267707_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
>prophage 143
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2273467	2277625	3870945		Hokovirus(50.0%)	3	NA	NA
WP_002037247.1|2273467_2274991_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	1.8e-06
WP_000840547.1|2275015_2276437_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000939107.1|2276440_2277625_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
>prophage 144
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2281627	2289667	3870945		Staphylococcus_phage(40.0%)	9	NA	NA
WP_000673452.1|2281627_2283076_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151591.1|2283068_2283476_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002037252.1|2283514_2284153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|2284283_2284502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|2284560_2285220_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|2285262_2286555_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292519.1|2286551_2287637_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|2287652_2288111_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738519.1|2288269_2289667_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.4	4.1e-34
>prophage 145
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2298349	2300680	3870945		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_001277980.1|2298349_2299816_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_000034564.1|2299828_2300680_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
>prophage 146
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2307269	2307980	3870945	transposase	Vibriophage(100.0%)	1	NA	NA
WP_000736399.1|2307269_2307980_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 147
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2315186	2326294	3870945		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_000122444.1|2315186_2315714_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
WP_001985514.1|2315841_2316252_-	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_001187001.1|2316346_2316730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411991.1|2316770_2318450_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_000202252.1|2318747_2320967_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000366685.1|2321120_2322440_-	MFS transporter	NA	NA	NA	NA	NA
WP_000927792.1|2322522_2323167_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000194008.1|2323212_2323680_-	YchJ family protein	NA	NA	NA	NA	NA
WP_000575777.1|2323751_2325344_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_086225853.1|2325688_2326294_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
>prophage 148
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2331409	2333788	3870945		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000102049.1|2331409_2333788_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 149
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2337933	2338860	3870945		Lactococcus_phage(100.0%)	1	NA	NA
WP_162520283.1|2337933_2338860_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.4	9.6e-72
>prophage 150
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2350563	2354142	3870945		Synechococcus_phage(33.33%)	4	NA	NA
WP_001196539.1|2350563_2351094_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
WP_020752706.1|2351216_2352371_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_031945334.1|2352391_2353522_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.5	7.4e-26
WP_000633612.1|2353572_2354142_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
>prophage 151
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2369213	2370002	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001112013.1|2369213_2370002_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 152
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2375541	2377332	3870945	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001090283.1|2375541_2377332_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.0e-16
>prophage 153
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2382409	2383978	3870945		Hokovirus(100.0%)	1	NA	NA
WP_000210750.1|2382409_2383978_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 154
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2388124	2388967	3870945		Lactococcus_phage(100.0%)	1	NA	NA
WP_000957995.1|2388124_2388967_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-08
>prophage 155
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2394076	2395726	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005120653.1|2394076_2395726_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	1.1e-81
>prophage 156
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2415418	2418232	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_005120663.1|2415418_2418232_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	51.1	7.0e-275
>prophage 157
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2423566	2423785	3870945		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000350168.1|2423566_2423785_-	hypothetical protein	NA	A0A0H4TFE5	Erysipelothrix_phage	42.9	2.5e-07
>prophage 158
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2438650	2439667	3870945		Tupanvirus(100.0%)	1	NA	NA
WP_005120673.1|2438650_2439667_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	44.9	4.7e-80
>prophage 159
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2442706	2443582	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_005120675.1|2442706_2443582_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.9	9.4e-61
>prophage 160
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2447808	2451098	3870945		Klosneuvirus(100.0%)	3	NA	NA
WP_002063362.1|2447808_2448939_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	49.7	6.5e-107
WP_002063346.1|2448951_2450061_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002063348.1|2450063_2451098_-	polysaccharide biosynthesis protein	NA	A0A1V0SJP4	Klosneuvirus	33.4	3.2e-36
>prophage 161
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2458879	2459974	3870945		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002063388.1|2458879_2459974_-	N-acetylneuraminate synthase family protein	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	28.9	1.7e-22
>prophage 162
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2466646	2468830	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_002063377.1|2466646_2468830_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	1.2e-19
>prophage 163
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2491550	2492351	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_000183283.1|2491550_2492351_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 164
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2496319	2499157	3870945	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_005120704.1|2496319_2499157_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.0	4.2e-78
>prophage 165
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2511056	2511392	3870945		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000993572.1|2511056_2511392_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 166
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2515387	2526457	3870945		Tupanvirus(20.0%)	10	NA	NA
WP_031958788.1|2515387_2517313_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	4.3e-66
WP_001009202.1|2517564_2518122_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_000987632.1|2518207_2518600_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000093729.1|2518637_2521106_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_000550807.1|2521158_2522241_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_170318963.1|2522255_2523005_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.9	1.1e-30
WP_000964768.1|2523501_2524899_-	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_000831329.1|2525569_2525704_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_001240377.1|2525733_2526126_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000251652.1|2526136_2526457_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
>prophage 167
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2532272	2538435	3870945		uncultured_virus(33.33%)	6	NA	NA
WP_000214980.1|2532272_2532800_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
WP_005120734.1|2533014_2534340_-	guanine deaminase	NA	NA	NA	NA	NA
WP_005120733.1|2534396_2535452_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000823189.1|2535742_2536903_-	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	45.0	1.4e-96
WP_005120731.1|2536924_2537290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005120728.1|2537478_2538435_-	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	33.6	9.0e-33
>prophage 168
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2542849	2543362	3870945		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000994663.1|2542849_2543362_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 169
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2549286	2551227	3870945		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001062605.1|2549286_2551227_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
>prophage 170
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2555298	2557070	3870945		Tupanvirus(50.0%)	2	NA	NA
WP_000123589.1|2555298_2556369_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
WP_014538288.1|2556584_2557070_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
>prophage 171
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2567892	2568855	3870945	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000691195.1|2567892_2568855_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 172
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2574424	2575720	3870945		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002057504.1|2574424_2575720_-	pyrimidine permease RutG	NA	Q9KX94	Enterobacteria_phage	65.1	3.2e-150
>prophage 173
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2584497	2585610	3870945		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001119029.1|2584497_2585610_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 174
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2589019	2593750	3870945		Indivirus(50.0%)	6	NA	NA
WP_020753566.1|2589019_2589823_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.9	6.6e-37
WP_000843068.1|2589943_2590846_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000770103.1|2590829_2591204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074162454.1|2591136_2591334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753565.1|2591294_2592719_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000069845.1|2592721_2593750_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
>prophage 175
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2597850	2606094	3870945		Moraxella_phage(20.0%)	10	NA	NA
WP_000490267.1|2597850_2598009_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
WP_000102817.1|2598203_2598662_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_160948598.1|2598822_2599944_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001285409.1|2600049_2601315_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.5e-80
WP_000349492.1|2601330_2602170_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	1.3e-40
WP_000418559.1|2602455_2602659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917863.1|2602851_2603571_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
WP_001177091.1|2603608_2604211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193600.1|2604226_2605120_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002036303.1|2605449_2606094_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	1.9e-26
>prophage 176
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2618349	2619462	3870945		Gordonia_phage(100.0%)	1	NA	NA
WP_001246952.1|2618349_2619462_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.9	2.8e-09
>prophage 177
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2623154	2624693	3870945		Catovirus(100.0%)	1	NA	NA
WP_000421600.1|2623154_2624693_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 178
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2632086	2638801	3870945		Staphylococcus_phage(50.0%)	7	NA	NA
WP_000334178.1|2632086_2633925_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.3	1.4e-127
WP_005119227.1|2633937_2635302_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.1	2.9e-32
WP_000380675.1|2635318_2635834_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000807395.1|2635811_2636729_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_031958224.1|2636744_2637194_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001007829.1|2637197_2637668_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_001131392.1|2637679_2638801_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.9	1.9e-53
>prophage 179
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2643760	2644975	3870945		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000074561.1|2643760_2644975_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	5.7e-48
>prophage 180
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2648308	2650387	3870945		Bacillus_phage(100.0%)	2	NA	NA
WP_000273189.1|2648308_2649667_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.0e-30
WP_000650776.1|2649676_2650387_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
>prophage 181
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2659946	2663303	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_086225930.1|2659946_2663303_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	75.4	0.0e+00
>prophage 182
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2673722	2675606	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_000195974.1|2673722_2675606_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.7e-99
>prophage 183
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2681496	2682753	3870945		Nostoc_phage(100.0%)	1	NA	NA
WP_031958244.1|2681496_2682753_+	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	29.6	8.5e-23
>prophage 184
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2699308	2701586	3870945		Bacillus_phage(50.0%)	2	NA	NA
WP_042782585.1|2699308_2700391_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.6e-22
WP_001025110.1|2700674_2701586_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.2	1.9e-08
>prophage 185
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2717869	2718562	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_000557460.1|2717869_2718562_+	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 186
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2728575	2736198	3870945		Klosneuvirus(33.33%)	6	NA	NA
WP_000956023.1|2728575_2730042_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
WP_000119870.1|2730191_2731529_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014462864.1|2731530_2732196_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000161610.1|2732196_2733897_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	2.7e-64
WP_000731728.1|2733943_2734711_-	putative porin	NA	NA	NA	NA	NA
WP_096640204.1|2735103_2736198_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
>prophage 187
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2741895	2743845	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031958257.1|2741895_2743845_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	1.1e-93
>prophage 188
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2749170	2752668	3870945		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001089744.1|2749170_2752668_-	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 189
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2755928	2764428	3870945	holin	Vibrio_phage(33.33%)	4	NA	NA
WP_001139468.1|2755928_2757896_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-26
WP_000733007.1|2757954_2758860_-	porin Omp33-36	NA	NA	NA	NA	NA
WP_000016106.1|2759852_2761559_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	2.9e-13
WP_000083359.1|2761593_2764428_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
>prophage 190
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2768107	2771334	3870945		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000680213.1|2768107_2769190_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.3	2.4e-90
WP_000980460.1|2769336_2770701_+	MFS transporter	NA	NA	NA	NA	NA
WP_001215080.1|2770752_2771334_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
>prophage 191
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2774815	2777764	3870945		Streptococcus_phage(50.0%)	2	NA	NA
WP_002036231.1|2774815_2776360_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
WP_000380899.1|2776471_2777764_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
>prophage 192
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2801720	2805432	3870945		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001181667.1|2801720_2803598_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
WP_000581862.1|2803653_2804097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005119254.1|2804328_2805432_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	38.9	1.3e-27
>prophage 193
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2814200	2815892	3870945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000670489.1|2814200_2815892_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	23.9	2.2e-10
>prophage 194
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2822721	2824961	3870945		Bacillus_phage(100.0%)	2	NA	NA
WP_000051217.1|2822721_2824179_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
WP_000060753.1|2824196_2824961_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
>prophage 195
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2831688	2834925	3870945		Pandoravirus(50.0%)	2	NA	NA
WP_005119257.1|2831688_2832966_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	3.1e-12
WP_000090019.1|2833263_2834925_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	2.0e-43
>prophage 196
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2878662	2879253	3870945		Lactococcus_phage(100.0%)	1	NA	NA
WP_000846931.1|2878662_2879253_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 197
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2886472	2889767	3870945		Salmonella_phage(50.0%)	3	NA	NA
WP_020753492.1|2886472_2888578_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
WP_000135049.1|2888786_2889065_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000015936.1|2889137_2889767_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
>prophage 198
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2907557	2908790	3870945		Catovirus(100.0%)	1	NA	NA
WP_000077814.1|2907557_2908790_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 199
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2912963	2917149	3870945		Salmonella_phage(100.0%)	3	NA	NA
WP_083043947.1|2912963_2914193_+	MFS transporter	NA	S4TR35	Salmonella_phage	22.3	1.3e-12
WP_001061831.1|2914230_2916381_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001143890.1|2916573_2917149_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.4	9.2e-41
>prophage 200
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2927574	2928789	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_000437494.1|2927574_2928789_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.0e-25
>prophage 201
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2941038	2942247	3870945	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_000343018.1|2941038_2942247_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 202
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2958631	2959234	3870945		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001121174.1|2958631_2959234_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 203
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2962804	2965874	3870945		Catovirus(50.0%)	3	NA	NA
WP_000047395.1|2962804_2964652_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.9e-45
WP_000471151.1|2964743_2964929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005119280.1|2965055_2965874_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	8.6e-24
>prophage 204
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2969534	2970116	3870945		Orpheovirus(100.0%)	1	NA	NA
WP_001084310.1|2969534_2970116_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 205
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	2983682	2985230	3870945		Klebsiella_phage(100.0%)	1	NA	NA
WP_000537116.1|2983682_2985230_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	40.4	1.0e-73
>prophage 206
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3010629	3015250	3870945		Klosneuvirus(50.0%)	2	NA	NA
WP_000266475.1|3010629_3012684_-	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.8	7.4e-32
WP_005119285.1|3012817_3015250_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.5	2.1e-70
>prophage 207
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3029784	3034594	3870945	tRNA	Pseudomonas_phage(50.0%)	3	NA	NA
WP_086225928.1|3029784_3030828_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
WP_000218141.1|3030910_3032362_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000792526.1|3032650_3034594_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
>prophage 208
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3052323	3052752	3870945	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000003709.1|3052323_3052752_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 209
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3064541	3065642	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_000451187.1|3064541_3065642_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	1.8e-13
>prophage 210
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3075904	3077239	3870945		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000543478.1|3075904_3076801_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
WP_000587649.1|3076801_3077239_+	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	9.9e-11
>prophage 211
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3085205	3091012	3870945	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000006960.1|3085205_3086459_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	2.9e-39
WP_001984787.1|3086523_3087489_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_001270222.1|3087497_3089399_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000051669.1|3089450_3089780_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000667231.1|3089878_3091012_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
>prophage 212
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3095891	3097160	3870945		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_000194116.1|3095891_3097160_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	25.2	4.6e-08
>prophage 213
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3107401	3111498	3870945	tRNA	Catovirus(50.0%)	4	NA	NA
WP_000598629.1|3107401_3108529_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.0	3.2e-29
WP_001985908.1|3108530_3109304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251490.1|3109364_3109580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986451.1|3109719_3111498_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 214
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3124361	3127840	3870945		Bacillus_phage(33.33%)	3	NA	NA
WP_000680577.1|3124361_3125048_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_001160208.1|3125111_3126554_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
WP_031958775.1|3126667_3127840_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
>prophage 215
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3165549	3165903	3870945		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000457785.1|3165549_3165903_+	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	58.9	1.8e-26
>prophage 216
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3170052	3182738	3870945		Bordetella_phage(20.0%)	11	NA	NA
WP_000512701.1|3170052_3171258_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	6.1e-127
WP_000004971.1|3171534_3172995_-	amino acid permease	NA	NA	NA	NA	NA
WP_000371526.1|3173016_3174030_-	methyltransferase	NA	NA	NA	NA	NA
WP_000070858.1|3174092_3175451_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
WP_001280092.1|3175629_3177465_+	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
WP_000022555.1|3177719_3178151_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_001072494.1|3178293_3178647_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001192455.1|3178657_3178948_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001114566.1|3178967_3179792_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	1.9e-26
WP_001280163.1|3179867_3180434_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_160948602.1|3180608_3182738_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	47.2	2.9e-87
>prophage 217
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3191434	3204806	3870945		Leptospira_phage(20.0%)	8	NA	NA
WP_005119699.1|3191434_3194533_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.7	2.2e-96
WP_001260821.1|3194548_3195667_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001981151.1|3195726_3196326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389061.1|3196647_3197031_+	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
WP_000101096.1|3197054_3197417_+	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
WP_000729762.1|3197477_3198014_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000505932.1|3198060_3200139_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
WP_031980609.1|3200285_3204806_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	39.3	4.3e-16
>prophage 218
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3216512	3217727	3870945		Salmonella_phage(100.0%)	1	NA	NA
WP_000003701.1|3216512_3217727_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	1.3e-28
>prophage 219
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3221275	3222211	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_002027092.1|3221275_3222211_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.5e-08
>prophage 220
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3225342	3227391	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_031958472.1|3225342_3227391_+	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	29.7	6.3e-92
>prophage 221
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3260794	3261649	3870945		Pandoravirus(100.0%)	1	NA	NA
WP_001143942.1|3260794_3261649_-	SPFH/Band 7/PHB domain protein	NA	S4VT23	Pandoravirus	29.3	1.4e-08
>prophage 222
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3271802	3272990	3870945		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002001094.1|3271802_3272990_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	4.9e-44
>prophage 223
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3277093	3279973	3870945	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000128716.1|3277093_3279973_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	3.7e-146
>prophage 224
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3295849	3297121	3870945	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000566834.1|3295849_3297121_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	2.0e-96
>prophage 225
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3304933	3306820	3870945		Vibrio_phage(100.0%)	1	NA	NA
WP_001281941.1|3304933_3306820_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 226
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3319945	3323598	3870945		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_000082610.1|3319945_3321379_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
WP_001048573.1|3321526_3322693_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000114637.1|3322707_3323598_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
>prophage 227
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3327323	3328826	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000526259.1|3327323_3328826_+	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 228
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3337289	3337922	3870945		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000818514.1|3337289_3337922_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 229
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3346218	3348899	3870945		Marsac_virus(50.0%)	2	NA	NA
WP_000235573.1|3346218_3346869_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
WP_001286662.1|3347003_3348899_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
>prophage 230
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3353221	3356869	3870945		Enterococcus_phage(50.0%)	4	NA	NA
WP_001229846.1|3353221_3354070_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.6e-25
WP_001278012.1|3354310_3354979_+	methyltransferase	NA	NA	NA	NA	NA
WP_031958052.1|3354998_3355421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001984607.1|3355537_3356869_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
>prophage 231
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3364550	3366534	3870945		uncultured_virus(100.0%)	2	NA	NA
WP_000065579.1|3364550_3364841_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
WP_001274623.1|3364899_3366534_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
>prophage 232
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3374559	3376832	3870945	tRNA	Geobacillus_virus(50.0%)	2	NA	NA
WP_160948605.1|3374559_3375336_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.6	2.4e-36
WP_000271249.1|3375926_3376832_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
>prophage 233
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3380890	3384889	3870945		Tupanvirus(100.0%)	1	NA	NA
WP_031958046.1|3380890_3384889_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.1	3.9e-69
>prophage 234
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3390055	3391213	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869483.1|3390055_3391213_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.0	9.2e-40
>prophage 235
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3395502	3397541	3870945		Streptococcus_phage(50.0%)	2	NA	NA
WP_000706076.1|3395502_3396570_+	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.8	4.5e-17
WP_000059548.1|3396566_3397541_+	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	28.4	1.7e-26
>prophage 236
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3407639	3416809	3870945		Escherichia_phage(33.33%)	7	NA	NA
WP_000266278.1|3407639_3408527_+	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	32.4	2.7e-15
WP_000646179.1|3408962_3409712_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_000025985.1|3409729_3410662_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_031958045.1|3411027_3413742_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	1.9e-96
WP_001188112.1|3413792_3415439_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_000457363.1|3415448_3415829_-	GtrA family protein	NA	NA	NA	NA	NA
WP_001022408.1|3415828_3416809_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	45.9	1.2e-67
>prophage 237
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3423087	3424167	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_001203181.1|3423087_3424167_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.0	1.1e-90
>prophage 238
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3428482	3429169	3870945		Planktothrix_phage(100.0%)	1	NA	NA
WP_000049406.1|3428482_3429169_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.2	3.4e-34
>prophage 239
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3432757	3436362	3870945		Salinibacter_virus(33.33%)	4	NA	NA
WP_001286608.1|3432757_3433774_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	7.1e-12
WP_000114071.1|3433792_3434602_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000975530.1|3434665_3435295_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.1e-26
WP_000071984.1|3435291_3436362_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
>prophage 240
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3445426	3446398	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_002036892.1|3445426_3446398_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	5.5e-46
>prophage 241
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3456842	3468048	3870945		Burkholderia_phage(16.67%)	11	NA	NA
WP_000471082.1|3456842_3460676_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.0	4.8e-109
WP_160948606.1|3460797_3461964_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	4.1e-27
WP_000916025.1|3462358_3462676_+	hypothetical protein	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	29.4	4.9e-12
WP_000175537.1|3462672_3463473_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_001991184.1|3463582_3464173_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	1.3e-21
WP_001050710.1|3464243_3464813_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_001293529.1|3464939_3465401_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_001153967.1|3465418_3466105_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_000771345.1|3466195_3466612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001984660.1|3466625_3467309_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
WP_000157724.1|3467337_3468048_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
>prophage 242
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3471077	3472139	3870945		Bacillus_virus(100.0%)	1	NA	NA
WP_000027499.1|3471077_3472139_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 243
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3477749	3486734	3870945		Streptococcus_phage(50.0%)	9	NA	NA
WP_031958039.1|3477749_3478349_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	4.3e-33
WP_000842540.1|3478487_3478904_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000367540.1|3478958_3480602_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_002000087.1|3480817_3482209_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
WP_000094834.1|3482329_3482782_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000035781.1|3482956_3484774_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
WP_000344900.1|3484844_3485672_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001224039.1|3485695_3486070_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_000160699.1|3486041_3486734_+	ribonuclease III	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
>prophage 244
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3493487	3495188	3870945		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000567435.1|3493487_3495188_+	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	34.9	1.8e-71
>prophage 245
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3500683	3504357	3870945		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000222197.1|3500683_3501475_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
WP_001004983.1|3501654_3503676_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_000885644.1|3503769_3504357_+	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
>prophage 246
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3510057	3511191	3870945		Streptococcus_phage(100.0%)	1	NA	NA
WP_000573840.1|3510057_3511191_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	2.1e-68
>prophage 247
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3517535	3518672	3870945		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_031958037.1|3517535_3518672_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.1	7.4e-26
>prophage 248
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3524475	3529344	3870945		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_000072872.1|3524475_3525918_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	33.0	8.5e-59
WP_000123995.1|3526021_3526504_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000193195.1|3526639_3527926_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000667907.1|3528024_3529344_-	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	39.1	1.7e-37
>prophage 249
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3534964	3536221	3870945		Phage_21(100.0%)	1	NA	NA
WP_038350580.1|3534964_3536221_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 250
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3542405	3545168	3870945		Tupanvirus(100.0%)	1	NA	NA
WP_000480987.1|3542405_3545168_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 251
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3552142	3554980	3870945		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000413574.1|3552142_3554980_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	4.3e-22
>prophage 252
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3561706	3563080	3870945		Klosneuvirus(100.0%)	1	NA	NA
WP_000117540.1|3561706_3563080_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 253
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3567013	3576645	3870945	protease	Bodo_saltans_virus(50.0%)	7	NA	NA
WP_000469455.1|3567013_3568735_+	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	4.6e-27
WP_000339846.1|3568875_3570255_+	amino acid permease	NA	NA	NA	NA	NA
WP_001238906.1|3570711_3571743_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	2.9e-61
WP_001050723.1|3571843_3573223_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_000372632.1|3573246_3574617_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002000060.1|3574675_3575533_+	phosphate ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	22.1	9.3e-05
WP_000897189.1|3575682_3576645_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	4.5e-24
>prophage 254
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3579864	3581253	3870945		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_031958031.1|3579864_3581253_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	2.5e-100
>prophage 255
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3584446	3588478	3870945		Stx2-converting_phage(33.33%)	5	NA	NA
WP_000197255.1|3584446_3585595_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
WP_000480885.1|3585721_3586144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846418.1|3586291_3586663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023216.1|3586765_3587533_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_000550750.1|3587647_3588478_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
>prophage 256
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3614082	3621318	3870945		Tupanvirus(33.33%)	5	NA	NA
WP_000910243.1|3614082_3615930_+	acinetobactin non-ribosomal peptide synthetase subunit BasA	NA	A0A2K9KZV5	Tupanvirus	24.1	2.0e-36
WP_000939841.1|3616000_3618031_-	acinetobactin non-ribosomal peptide synthetase subunit BasB	NA	NA	NA	NA	NA
WP_031958028.1|3618662_3619604_+	ferric acinetobactin ABC transporter permease subunit BauD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.9	1.6e-61
WP_001223271.1|3619603_3620551_+	ferric acinetobactin ABC transporter permease subunit BauC	NA	NA	NA	NA	NA
WP_000582116.1|3620547_3621318_+	ferric acinetobactin ABC transporter ATP-binding protein BauE	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.1e-17
>prophage 257
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3631870	3636470	3870945		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000603878.1|3631870_3633022_+	acinetobactin biosynthesis histidine decarboxylase BasG	NA	A7J7V4	Paramecium_bursaria_Chlorella_virus	33.4	1.8e-51
WP_001176134.1|3633119_3633275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086225835.1|3633294_3634878_+	acinetobactin export ABC transporter permease/ATP-binding subunit BarA	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.4	5.5e-11
WP_001090103.1|3634874_3636470_+	acinetobactin export ABC transporter permease/ATP-binding subunit BarB	NA	W8CYL7	Bacillus_phage	44.8	3.4e-24
>prophage 258
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3646829	3665272	3870945		Acinetobacter_phage(100.0%)	12	NA	NA
WP_001187844.1|3646829_3647378_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893694.1|3647640_3649140_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	2.1e-278
WP_001076827.1|3649141_3651517_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.9	0.0e+00
WP_001164242.1|3651523_3652507_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	96.3	2.9e-183
WP_000066126.1|3652517_3653213_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608310.1|3653222_3654029_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	3.9e-146
WP_001982145.1|3654038_3655088_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_031958068.1|3655443_3658176_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.0	0.0e+00
WP_074163530.1|3658189_3660955_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.7	0.0e+00
WP_000566785.1|3661050_3661626_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	1.2e-109
WP_000999138.1|3661931_3663734_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	98.0	0.0e+00
WP_000872622.1|3663730_3665272_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
>prophage 259
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3673606	3676069	3870945		Pithovirus(50.0%)	2	NA	NA
WP_001254964.1|3673606_3674782_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
WP_031958076.1|3674830_3676069_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	2.7e-90
>prophage 260
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3683300	3684683	3870945		Pandoravirus(100.0%)	1	NA	NA
WP_000994845.1|3683300_3684683_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	1.2e-41
>prophage 261
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3702510	3703080	3870945		Synechococcus_phage(100.0%)	1	NA	NA
WP_002000723.1|3702510_3703080_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
>prophage 262
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3706384	3718318	3870945		Vibrio_phage(20.0%)	10	NA	NA
WP_000110166.1|3706384_3707197_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
WP_001010537.1|3707193_3707967_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000128669.1|3707963_3708899_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_171264617.1|3709192_3709828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147935.1|3709972_3710659_-	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.1e-35
WP_020753345.1|3710908_3712138_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002036954.1|3712161_3712323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457893.1|3712383_3713637_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_031958089.1|3713677_3715126_-	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_001027061.1|3715138_3718318_-	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
>prophage 263
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3723234	3726278	3870945	tRNA	Bacillus_phage(33.33%)	4	NA	NA
WP_000438618.1|3723234_3724011_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.6	9.3e-12
WP_000121131.1|3724083_3724413_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_005119945.1|3724641_3724905_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.6	1.7e-18
WP_000845855.1|3724907_3726278_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	63.7	8.2e-128
>prophage 264
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3733968	3736453	3870945		Bacillus_phage(66.67%)	3	NA	NA
WP_000783086.1|3733968_3734328_+	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
WP_001221456.1|3734435_3735098_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	1.7e-22
WP_001257348.1|3735094_3736453_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	25.2	2.0e-17
>prophage 265
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3742284	3743295	3870945		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001060852.1|3742284_3743295_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	47.0	2.8e-77
>prophage 266
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3755703	3756972	3870945		Erwinia_phage(100.0%)	1	NA	NA
WP_020753339.1|3755703_3756972_-	RtcB family protein	NA	W6AR47	Erwinia_phage	60.1	1.2e-136
>prophage 267
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3763724	3766812	3870945		Salicola_phage(33.33%)	4	NA	NA
WP_001285359.1|3763724_3764591_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
WP_000108398.1|3764724_3764970_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000126912.1|3765344_3765557_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_002000703.1|3765642_3766812_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
>prophage 268
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3772983	3781730	3870945	tRNA,protease	Mollivirus(25.0%)	8	NA	NA
WP_000334674.1|3772983_3774525_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	8.7e-86
WP_000665946.1|3774603_3776493_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000580185.1|3776593_3777244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000758323.1|3777255_3778221_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.0	6.6e-15
WP_086225870.1|3778367_3779795_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000209410.1|3779885_3780332_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_001136722.1|3780358_3780574_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000636263.1|3780719_3781730_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
>prophage 269
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3785494	3786298	3870945		Iragoides_fasciata_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_000912084.1|3785494_3786298_+	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.0e-05
>prophage 270
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3812869	3815601	3870945		Bacillus_phage(50.0%)	3	NA	NA
WP_001221364.1|3812869_3813541_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	2.4e-32
WP_031958110.1|3813537_3814941_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_000770558.1|3815037_3815601_+	lipocalin family protein	NA	A0A2I2L3Y4	Orpheovirus	36.4	3.1e-17
>prophage 271
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3818760	3819960	3870945		Orpheovirus(100.0%)	1	NA	NA
WP_000598002.1|3818760_3819960_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.2	5.6e-40
>prophage 272
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3823181	3823877	3870945		Bacillus_phage(100.0%)	1	NA	NA
WP_000526530.1|3823181_3823877_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	7.0e-27
>prophage 273
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3835648	3840851	3870945		Planktothrix_phage(50.0%)	4	NA	NA
WP_000614025.1|3835648_3836674_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
WP_000733779.1|3836749_3837616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024112.1|3837864_3839151_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000153210.1|3839276_3840851_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
>prophage 274
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3852324	3853770	3870945		Escherichia_phage(100.0%)	1	NA	NA
WP_000075891.1|3852324_3853770_-	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
>prophage 275
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3861259	3863647	3870945		Hokovirus(100.0%)	1	NA	NA
WP_000853480.1|3861259_3863647_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 276
NZ_CP020598	Acinetobacter baumannii strain WKA02 chromosome, complete genome	3870945	3869803	3870508	3870945	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067790.1|3869803_3870508_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
