The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	175666	227086	3996455	tRNA,transposase,integrase	Staphylococcus_phage(16.67%)	47	212078:212092	228332:228346
WP_000216739.1|175666_176599_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|176648_177845_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908243.1|177869_179216_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942498.1|179376_179628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278225.1|179648_181502_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|181498_181762_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608730.1|181905_182826_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_000011159.1|182972_183788_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|184032_185334_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|185389_186529_+	threonine synthase	NA	NA	NA	NA	NA
WP_003384760.1|186635_187682_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|187894_188530_+	response regulator	NA	NA	NA	NA	NA
WP_002001070.1|188585_190109_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000840549.1|190133_191555_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000942504.1|191558_192743_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|192758_194306_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|194431_195502_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|195501_196602_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|196745_198194_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151592.1|198186_198594_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001988710.1|198632_199271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|199401_199620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|199679_200339_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|200381_201674_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292506.1|201670_202756_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|202771_203230_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738520.1|203387_204785_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000780326.1|204842_205181_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|205460_205688_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010465.1|205753_206611_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144971.1|206693_208481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|208863_209667_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000422633.1|210072_210852_+	aminoglycoside O-phosphotransferase APH(3')-VIb	NA	E4ZFP6	Streptococcus_phage	35.1	2.4e-31
212078:212092	attL	AAATTGATTTTTTAG	NA	NA	NA	NA
WP_000812657.1|213157_214423_-|transposase	IS4-like element ISPa12 family transposase	transposase	NA	NA	NA	NA
WP_001100753.1|214529_215456_+	inhibitor-resistant class A extended-spectrum beta-lactamase PER-1	NA	NA	NA	NA	NA
WP_001176354.1|215529_215952_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000813355.1|215940_217212_-|transposase	IS4-like element ISPa13 family transposase	transposase	NA	NA	NA	NA
WP_001082319.1|217792_218596_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|218595_219432_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|219551_219776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|219986_221480_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|221510_221762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|221655_221958_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|222044_222860_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|222952_224042_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|224464_226375_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|226375_227086_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
228332:228346	attR	AAATTGATTTTTTAG	NA	NA	NA	NA
>prophage 2
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	1644489	1690848	3996455	capsid,integrase	Acinetobacter_phage(97.87%)	52	1649550:1649565	1665302:1665317
WP_001187844.1|1644489_1645038_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1645300_1646800_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1646801_1649177_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1649183_1650167_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
1649550:1649565	attL	TGGCGAGCTGGAAAGC	NA	NA	NA	NA
WP_000066126.1|1650177_1650873_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1650882_1651689_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1651698_1652748_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1653103_1655836_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_083062490.1|1657419_1658682_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	9.5e-248
WP_000910238.1|1658687_1658957_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000005652.1|1658957_1659215_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.5	3.2e-46
WP_000048742.1|1659218_1659503_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.3e-43
WP_000566309.1|1659495_1659906_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	100.0	7.6e-13
WP_002013575.1|1659909_1660050_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.7e-20
WP_001017703.1|1660890_1661109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005050.1|1661375_1661729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152665.1|1661928_1662165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195750.1|1662825_1663281_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	96.7	7.2e-81
WP_000378511.1|1663341_1663809_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	81.9	3.6e-67
WP_000372131.1|1663777_1664419_+	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	93.9	3.6e-118
WP_000212703.1|1664478_1665036_+	DUF2280 domain-containing protein	NA	A0A0P0IKR0	Acinetobacter_phage	100.0	2.5e-83
WP_000077244.1|1665019_1666336_+	hypothetical protein	NA	A0A0N7IRE3	Acinetobacter_phage	100.0	1.6e-266
1665302:1665317	attR	TGGCGAGCTGGAAAGC	NA	NA	NA	NA
WP_000301497.1|1666375_1667722_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	100.0	6.5e-255
WP_000146969.1|1667731_1668838_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	100.0	1.2e-206
WP_000965231.1|1668846_1669275_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004361.1|1669373_1669616_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	2.1e-39
WP_001139861.1|1669833_1670025_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_001112409.1|1670132_1670888_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	100.0	1.6e-130
WP_000502917.1|1670901_1671852_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	100.0	1.1e-179
WP_000524488.1|1671896_1672232_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000008470.1|1672235_1672616_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	100.0	4.8e-62
WP_000524217.1|1672616_1672985_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	100.0	2.6e-65
WP_083062492.1|1672993_1673398_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	99.3	1.7e-70
WP_002055488.1|1673369_1673738_+	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	99.1	5.0e-56
WP_001251850.1|1673739_1674138_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	100.0	2.2e-73
WP_001277687.1|1674139_1674358_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	100.0	2.4e-34
WP_000064599.1|1674451_1674805_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	100.0	1.2e-59
WP_000002422.1|1674804_1676040_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	80.1	2.8e-188
WP_057694252.1|1676092_1677010_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	94.8	1.1e-163
WP_001185585.1|1677079_1677595_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|1678097_1678397_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1678405_1678864_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|1678968_1679649_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|1679650_1679914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|1680041_1684352_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|1684442_1685030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|1685122_1685521_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|1685520_1686027_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|1686023_1686386_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000598554.1|1686378_1689804_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000433907.1|1689871_1690261_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|1690302_1690848_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 3
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	1696463	1781025	3996455	capsid,terminase,transposase,tail,head,protease,integrase	Acinetobacter_phage(55.77%)	99	1692141:1692156	1775040:1775055
1692141:1692156	attL	AAAAACATATATAAAT	NA	NA	NA	NA
WP_000046989.1|1696463_1697837_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
WP_000826302.1|1698255_1698534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001293231.1|1698536_1698887_-	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	3.4e-62
WP_083062560.1|1698883_1699273_-	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	97.7	6.4e-70
WP_000654847.1|1699275_1699521_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_001061230.1|1699522_1700482_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	100.0	2.5e-176
WP_001207477.1|1700478_1701600_-	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	100.0	2.6e-212
WP_031986108.1|1701611_1701935_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	94.4	2.2e-52
WP_031986106.1|1701937_1702378_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	95.2	7.7e-72
WP_002132479.1|1702577_1702940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002132644.1|1702950_1703430_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_003113565.1|1703426_1703930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370480.1|1704174_1704351_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	1.2e-23
WP_001093662.1|1704365_1705130_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	98.8	1.6e-144
WP_000996060.1|1705238_1705490_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
WP_000041063.1|1705499_1705856_+	hypothetical protein	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
WP_002054973.1|1705911_1706187_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	97.8	2.2e-40
WP_083062493.1|1706183_1706480_+	hypothetical protein	NA	A0A0D4DCL5	Acinetobacter_phage	100.0	1.1e-48
WP_001268069.1|1706476_1706833_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	100.0	1.1e-57
WP_059273143.1|1706891_1707785_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	98.3	1.4e-157
WP_002053037.1|1707781_1708552_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	100.0	4.0e-148
WP_000159938.1|1708548_1708683_+	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	100.0	5.6e-18
WP_000648413.1|1708669_1709092_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_114220156.1|1709141_1709504_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	98.3	2.1e-67
WP_001288609.1|1709496_1709781_+	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	63.8	3.5e-33
WP_083062495.1|1709782_1710163_+	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	43.7	2.3e-16
WP_001003589.1|1710159_1710330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|1710329_1710827_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_000780217.1|1711206_1711482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238616.1|1712191_1712410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856318.1|1712485_1712884_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_000433065.1|1712899_1713430_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
WP_000063945.1|1713419_1713602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079329.1|1713607_1713901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776297.1|1713830_1714130_+	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
WP_000202128.1|1714174_1714399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171263704.1|1714398_1714554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219090.1|1714544_1715027_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
WP_001191044.1|1715046_1715238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125540.1|1715409_1717104_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
WP_000375469.1|1718318_1718981_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000137059.1|1718973_1720146_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
WP_000666093.1|1720193_1720370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631202.1|1720366_1720654_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
WP_001139340.1|1720655_1721012_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000235306.1|1721015_1721501_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
WP_000598741.1|1721500_1721875_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
WP_001062223.1|1721946_1722423_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
WP_001074127.1|1722424_1722940_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_000498808.1|1722975_1723191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031955.1|1723267_1723600_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
WP_000882463.1|1727270_1727732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587324.1|1727734_1728244_+	DUF1833 family protein	NA	NA	NA	NA	NA
WP_001026372.1|1728240_1728636_+	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000078482.1|1728586_1731421_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_002018761.1|1731474_1733511_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
WP_001104854.1|1733512_1733737_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_000774828.1|1733811_1734078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095892.1|1734061_1734571_+	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000265243.1|1734570_1734939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002018743.1|1734907_1735078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186629.1|1735172_1735367_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	2.7e-13
WP_000115731.1|1735350_1736715_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	42.7	2.9e-85
WP_000003720.1|1737151_1737436_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000893185.1|1737432_1737993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001150150.1|1738057_1738687_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_000775459.1|1738754_1740077_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_001187364.1|1740108_1741317_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000005670.1|1741313_1742546_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000129799.1|1742755_1743007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058923.1|1743061_1743463_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000896577.1|1743528_1744170_+	cation transporter	NA	NA	NA	NA	NA
WP_000950251.1|1744228_1744831_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000887365.1|1744938_1745829_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_000140381.1|1745831_1746218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275986.1|1746311_1747148_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
WP_000959396.1|1747341_1747743_+	YraN family protein	NA	NA	NA	NA	NA
WP_000919363.1|1747823_1748531_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_001048900.1|1748534_1749398_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001292948.1|1749420_1750164_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_001289239.1|1750163_1751807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084042.1|1751941_1753321_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_000277826.1|1753553_1756769_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
WP_085916950.1|1756907_1758620_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000536107.1|1758649_1759702_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000008523.1|1759701_1760712_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000550783.1|1760689_1762279_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
WP_000077974.1|1762464_1763709_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_000364465.1|1763767_1765882_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001982681.1|1766159_1766822_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|1766806_1767841_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013374.1|1767990_1769253_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_014462718.1|1769311_1770670_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000205078.1|1770935_1772966_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000213120.1|1773309_1774524_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.0	6.9e-62
WP_001091151.1|1775555_1776485_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
1775040:1775055	attR	AAAAACATATATAAAT	NA	NA	NA	NA
WP_001046004.1|1777847_1778669_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085940648.1|1778767_1779857_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_076611834.1|1780230_1781025_+|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	2372652	2438291	3996455	transposase	Enterobacteria_phage(27.27%)	56	NA	NA
WP_000753551.1|2372652_2374212_+|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_001989376.1|2374313_2374868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424150.1|2375078_2375378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180995.1|2375445_2375637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000110646.1|2375645_2375999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344757.1|2376218_2376488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370160.1|2377195_2377903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2378293_2379223_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_000312355.1|2379912_2380161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000675786.1|2380171_2380516_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	39.3	2.0e-14
WP_000959831.1|2381070_2382423_-	methylenetetrahydrofolate reductase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000155202.1|2382538_2383306_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.2	1.5e-25
WP_000152964.1|2383366_2384860_-	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	51.1	6.3e-142
WP_001007527.1|2384871_2385756_-	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	39.0	1.2e-34
WP_000965123.1|2385937_2386747_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001244448.1|2386845_2387634_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000177605.1|2387628_2388117_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000614432.1|2388119_2388884_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.2e-16
WP_002001037.1|2388880_2389891_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000770288.1|2389893_2390913_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000206303.1|2391343_2392396_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
WP_001181580.1|2392451_2393090_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001989396.1|2393202_2393697_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000013631.1|2393905_2394790_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000090987.1|2394885_2395758_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076611834.1|2396023_2396818_+|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_069597335.1|2397388_2397865_+	AAC(3)-I family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_001101630.1|2399909_2400881_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000774594.1|2401091_2402027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001011888.1|2402138_2403314_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000999650.1|2403401_2405189_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_000152484.1|2405205_2406783_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_001278392.1|2406861_2407482_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001026282.1|2407648_2409226_+	MFS transporter	NA	NA	NA	NA	NA
WP_000105392.1|2409222_2410311_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_083062506.1|2410391_2415770_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_000435195.1|2416045_2416234_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001989592.1|2416295_2417528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974231.1|2417720_2418398_-	RraA family protein	NA	NA	NA	NA	NA
WP_000824433.1|2418608_2419586_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	31.2	1.2e-29
WP_083062507.1|2419657_2420953_+	MFS transporter	NA	NA	NA	NA	NA
WP_076611834.1|2420904_2421700_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_000238907.1|2421919_2422618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000153881.1|2422821_2423280_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001166494.1|2423289_2423724_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000366420.1|2423823_2424756_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000053782.1|2424856_2426200_-	MFS transporter	NA	NA	NA	NA	NA
WP_000404178.1|2426496_2427375_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000883486.1|2427467_2428199_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126044.1|2428310_2429600_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000995633.1|2429607_2430420_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_000786788.1|2430429_2431770_+	MFS transporter	NA	NA	NA	NA	NA
WP_000770266.1|2431965_2432106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000605047.1|2432499_2432961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2433619_2434549_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_001091151.1|2437361_2438291_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
>prophage 5
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	2688699	2736510	3996455	capsid,terminase,transposase,tail,integrase	Acinetobacter_phage(98.41%)	66	2688413:2688427	2736849:2736863
2688413:2688427	attL	GTAATTCTATCATTT	NA	NA	NA	NA
WP_085942227.1|2688699_2689864_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_000151893.1|2690110_2690704_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_001109862.1|2690710_2691358_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_070469551.1|2691368_2692049_-	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	99.6	1.0e-115
WP_001019391.1|2692237_2692783_-	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	96.1	4.1e-99
WP_001100986.1|2692844_2693024_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|2693049_2693592_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_070469553.1|2693703_2694093_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	9.5e-66
WP_000590506.1|2694160_2697607_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.9	0.0e+00
WP_000835168.1|2697599_2697962_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000368375.1|2697958_2698465_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000277443.1|2698464_2698863_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000246069.1|2698927_2699320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2699833_2700763_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_016062491.1|2701182_2706078_-	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	100.0	0.0e+00
WP_016062490.1|2706178_2706556_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	100.0	7.1e-66
WP_000910437.1|2706621_2707383_-	hypothetical protein	NA	A0A0D4DCQ9	Acinetobacter_phage	100.0	7.0e-137
WP_000102495.1|2707462_2708008_-	GNAT family N-acetyltransferase	NA	J7I473	Acinetobacter_phage	100.0	6.6e-97
WP_002036269.1|2708023_2708173_-	hypothetical protein	NA	J7HXF6	Acinetobacter_phage	100.0	4.8e-18
WP_016062489.1|2708731_2709247_-	hypothetical protein	NA	J7I4Q2	Acinetobacter_phage	100.0	2.8e-73
WP_000094278.1|2709316_2710234_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_070469557.1|2710286_2711642_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	97.3	6.5e-202
WP_000064593.1|2711641_2711995_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2712091_2712613_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2712721_2712940_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_002016455.1|2712941_2713385_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
WP_000539748.1|2713341_2713710_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_000247952.1|2713681_2714086_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000524213.1|2714094_2714463_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000008496.1|2714464_2714854_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000692540.1|2714858_2715524_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|2715589_2716546_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|2716573_2717341_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|2717454_2717646_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|2717863_2718106_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_000965231.1|2718204_2718633_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000179763.1|2718641_2719745_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286355.1|2719746_2721198_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_017725554.1|2721194_2722622_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	99.3	6.5e-269
WP_000212566.1|2722611_2723082_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_017725555.1|2723140_2723782_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	100.0	9.4e-127
WP_000371306.1|2723750_2724185_-	hypothetical protein	NA	J7HXN1	Acinetobacter_phage	95.1	1.5e-75
WP_000134359.1|2724199_2724391_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	100.0	1.0e-28
WP_000432381.1|2724512_2724809_-	hypothetical protein	NA	J7I457	Acinetobacter_phage	100.0	5.6e-58
WP_000959671.1|2724931_2725666_-	hypothetical protein	NA	J7HXD9	Acinetobacter_phage	100.0	5.1e-137
WP_000100186.1|2725676_2726078_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
WP_001288422.1|2726077_2726302_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_124224346.1|2726294_2726657_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	8.6e-69
WP_000648413.1|2726706_2727129_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_001031749.1|2727115_2727250_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_001003675.1|2727246_2728047_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	100.0	2.0e-150
WP_083062515.1|2728049_2728931_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	99.7	2.2e-142
WP_002037796.1|2728923_2729148_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
WP_002053102.1|2729219_2729495_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	97.8	1.3e-40
WP_083062516.1|2729550_2729871_-	helix-turn-helix transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	97.2	7.4e-48
WP_016653763.1|2729881_2730112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058222079.1|2730239_2730911_+	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.1	9.7e-66
WP_083062564.1|2731127_2731568_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	1.1e-73
WP_033107678.1|2731570_2731894_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	96.3	1.3e-55
WP_004793763.1|2731905_2733027_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
WP_083062517.1|2733023_2733983_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	98.1	1.2e-173
WP_000654847.1|2733984_2734230_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_070423401.1|2734232_2734622_+	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	96.9	3.2e-69
WP_016062494.1|2734618_2734972_+	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	1.2e-62
WP_000910238.1|2734972_2735242_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000773626.1|2735247_2736510_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.0	3.6e-247
2736849:2736863	attR	GTAATTCTATCATTT	NA	NA	NA	NA
>prophage 6
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	3189951	3252746	3996455	capsid,terminase,transposase,plate,integrase	Acinetobacter_phage(95.45%)	94	3193589:3193605	3234003:3234019
WP_000872622.1|3189951_3191493_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
WP_000999148.1|3191489_3193292_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
3193589:3193605	attL	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_000947611.1|3193779_3194976_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
WP_000098296.1|3194972_3195167_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_001019392.1|3195600_3196143_-	N-acetylmuramidase	NA	A0A0D4DCJ5	Acinetobacter_phage	100.0	1.7e-100
WP_001100986.1|3196204_3196384_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|3196409_3196952_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_000433897.1|3197063_3197453_-	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	100.0	6.0e-68
WP_001104857.1|3197530_3197758_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	100.0	3.0e-35
WP_000359223.1|3199876_3200485_-	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	100.0	6.2e-112
WP_001192560.1|3200477_3201068_-	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	92.9	3.5e-104
WP_001229408.1|3201067_3202252_-|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	100.0	7.1e-221
WP_001270576.1|3202254_3202608_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	100.0	1.4e-63
WP_001218525.1|3202642_3203305_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	100.0	5.1e-128
WP_083062530.1|3203307_3204267_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	98.7	1.1e-179
WP_083062531.1|3204263_3204560_-	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	98.0	8.1e-49
WP_001018608.1|3204562_3205159_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
WP_001051325.1|3205518_3205746_+	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
WP_000821707.1|3205745_3206102_+	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	100.0	4.5e-62
WP_083062532.1|3206098_3208123_-	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	99.9	0.0e+00
WP_001165481.1|3208318_3208783_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	66.2	4.2e-52
WP_054465374.1|3208782_3209226_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	98.0	1.4e-76
WP_000174797.1|3209240_3210716_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
WP_000502801.1|3210719_3211259_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
WP_000057776.1|3211261_3211630_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
WP_000094501.1|3211616_3212177_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	94.6	4.2e-91
WP_000622628.1|3212173_3212560_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	98.4	1.9e-66
WP_000039661.1|3212563_3212974_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	42.7	1.1e-19
WP_000040099.1|3212987_3214013_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	73.8	1.2e-147
WP_000063383.1|3214076_3214565_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	67.3	2.1e-54
WP_083062533.1|3214570_3215899_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	65.3	2.8e-133
WP_083062534.1|3215919_3216237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083062535.1|3216237_3216828_-|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	94.3	8.1e-101
WP_083062536.1|3216898_3218314_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	78.8	7.4e-209
WP_083062537.1|3218324_3219983_-|terminase	terminase	terminase	A0A0P0IVT4	Acinetobacter_phage	98.7	0.0e+00
WP_063099400.1|3219979_3220486_-	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	66.7	1.9e-53
WP_083062538.1|3220545_3221187_-	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	89.2	3.1e-114
WP_083062539.1|3221155_3221590_-	hypothetical protein	NA	J7HXN1	Acinetobacter_phage	96.5	1.3e-76
WP_000134359.1|3221604_3221796_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	100.0	1.0e-28
WP_000432381.1|3221917_3222214_-	hypothetical protein	NA	J7I457	Acinetobacter_phage	100.0	5.6e-58
WP_000959671.1|3222336_3223071_-	hypothetical protein	NA	J7HXD9	Acinetobacter_phage	100.0	5.1e-137
WP_000100186.1|3223081_3223483_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
WP_001288422.1|3223482_3223707_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_095357150.1|3223699_3224062_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_083062540.1|3224111_3224504_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	67.6	4.2e-21
WP_156890213.1|3224500_3224611_-	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	91.4	2.3e-09
WP_083062541.1|3224607_3224937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083062542.1|3224933_3225683_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	94.4	3.3e-131
WP_032060906.1|3225675_3226605_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	98.4	1.0e-169
WP_083062543.1|3226597_3227443_-	DNA adenine methylase	NA	R4JMC6	Burkholderia_phage	48.2	5.3e-69
WP_083062544.1|3227439_3227733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083062545.1|3227788_3228145_-	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	99.2	1.4e-60
WP_001050157.1|3228155_3228371_-	helix-turn-helix domain-containing protein	NA	A0A0P0IY81	Acinetobacter_phage	100.0	1.3e-35
WP_083062546.1|3228471_3229227_+	helix-turn-helix transcriptional regulator	NA	A0A0P0I8E0	Acinetobacter_phage	99.2	1.3e-143
WP_001101440.1|3229422_3229863_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	100.0	2.3e-76
WP_000656412.1|3229862_3230153_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	100.0	5.5e-50
WP_000064475.1|3230145_3230469_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	100.0	5.1e-57
WP_070423370.1|3230480_3231602_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	9.7e-212
WP_001061230.1|3231598_3232558_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	100.0	2.5e-176
WP_000654847.1|3232559_3232805_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_014462820.1|3232807_3233209_+	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	100.0	6.0e-71
WP_001286975.1|3233205_3233430_+	hypothetical protein	NA	A0A0D4DCJ9	Acinetobacter_phage	100.0	8.0e-33
WP_000096319.1|3233426_3233618_+	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	100.0	5.4e-30
WP_000529848.1|3233618_3233888_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000566784.1|3234011_3234587_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
3234003:3234019	attR	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_156890214.1|3236563_3237728_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
WP_083062547.1|3237974_3238571_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	7.0e-100
WP_083062520.1|3238606_3239536_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.6	2.7e-50
WP_001017713.1|3239708_3239927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861102.1|3240172_3240427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001277128.1|3240398_3240875_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|3240871_3241273_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|3241272_3241665_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|3241657_3241996_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|3241992_3242793_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|3242795_3243677_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|3243669_3243894_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|3243965_3244238_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|3244299_3244620_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|3244630_3244819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|3244923_3245676_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|3245690_3245906_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|3245957_3246965_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|3246966_3247470_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|3247608_3247812_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|3247818_3248061_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|3248254_3248698_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|3248697_3248988_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|3248980_3249304_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|3249315_3250437_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|3250433_3251366_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|3251367_3251619_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|3251619_3252027_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|3252023_3252746_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 7
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	3472655	3495945	3996455	integrase	Acinetobacter_phage(55.0%)	38	3488693:3488707	3500605:3500619
WP_001136753.1|3472655_3473111_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_000990950.1|3473566_3474100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994866.1|3474096_3474861_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_000124473.1|3474857_3475901_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_002052057.1|3475977_3477048_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
WP_095357150.1|3477119_3477482_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_000648413.1|3477531_3477954_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_001031749.1|3477940_3478075_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000544506.1|3478071_3478821_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001110396.1|3478813_3479764_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_020752534.1|3479760_3480807_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
WP_020752533.1|3480803_3482474_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	45.9	1.8e-153
WP_001205618.1|3482479_3483118_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_000575725.1|3483114_3483570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|3483566_3483752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|3483748_3483949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|3483982_3484357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335919.1|3484389_3484623_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000550612.1|3484749_3485439_+	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
WP_000922095.1|3485450_3485726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105905.1|3485941_3486274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290754.1|3486314_3487118_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_000350171.1|3487203_3487464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072368.1|3487522_3487852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260065.1|3487848_3488220_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.6	1.4e-10
WP_000643997.1|3488390_3489071_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
3488693:3488707	attL	AATTAAGGCAAAGGC	NA	NA	NA	NA
WP_000805204.1|3489083_3490112_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000986115.1|3490252_3490543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|3490543_3490723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609004.1|3490715_3491252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578497.1|3491248_3491758_+	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
WP_000028957.1|3491754_3491964_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_001292077.1|3491960_3492176_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_000119264.1|3492176_3492347_+	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_000527288.1|3492353_3493346_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000549863.1|3493460_3493916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076477.1|3493906_3494791_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000947475.1|3494787_3495945_-|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
3500605:3500619	attR	AATTAAGGCAAAGGC	NA	NA	NA	NA
>prophage 8
NZ_CP020586	Acinetobacter baumannii strain CBA7 chromosome, complete genome	3996455	3629736	3699453	3996455	tRNA,transposase,integrase	Enterobacteria_phage(45.45%)	57	3672284:3672343	3699448:3700472
WP_001226777.1|3629736_3631800_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001261036.1|3631929_3632058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000463103.1|3632280_3632904_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000044601.1|3633082_3633652_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000047785.1|3633648_3635292_+	MFS transporter	NA	NA	NA	NA	NA
WP_001278637.1|3635332_3636466_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000459527.1|3636532_3637414_+	1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000071502.1|3637531_3638731_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000742883.1|3638743_3638914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001669.1|3639042_3640719_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_000543705.1|3640946_3641174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002000170.1|3641466_3641886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021170.1|3641933_3642695_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_001242992.1|3642781_3643669_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000806838.1|3643688_3643982_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_001007343.1|3644098_3644734_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001011955.1|3644834_3646331_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_000429844.1|3646333_3647932_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_000121137.1|3647933_3649823_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_000529822.1|3649819_3650128_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_014205902.1|3650127_3650646_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_000276693.1|3650645_3651188_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_001070989.1|3651206_3652223_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_000190953.1|3652226_3654911_-	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_001091095.1|3654922_3656254_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_000973142.1|3656250_3656760_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_000852150.1|3656773_3658561_-	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_000878003.1|3658645_3659323_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_002000166.1|3659329_3659809_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_001147032.1|3660308_3661730_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
WP_011858483.1|3661876_3662176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226704.1|3662198_3663791_-	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	1.2e-05
WP_000076440.1|3663880_3664597_-	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000143214.1|3664593_3664800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111540.1|3665129_3667964_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000465010.1|3668019_3668154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025829.1|3668291_3669575_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
3672284:3672343	attL	GAGGCTTTGTTGCACAAATAGACGAAAGGTAGAGTTGTTCTAATCTTCAGATATTTATGC	NA	NA	NA	NA
WP_001091151.1|3672337_3673267_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_000805411.1|3673753_3675667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000134740.1|3675669_3676512_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.2	2.0e-23
WP_000038711.1|3676508_3679817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033777.1|3679809_3680754_-	DUF4007 family protein	NA	NA	NA	NA	NA
WP_000986488.1|3681082_3681310_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001020416.1|3681517_3682219_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000154902.1|3682220_3684107_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001037101.1|3684099_3685050_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001156616.1|3685049_3687056_+	TniQ family protein	NA	NA	NA	NA	NA
WP_001090935.1|3687130_3687310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|3687563_3688493_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_001165350.1|3688665_3689178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|3690003_3690933_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_156890215.1|3691900_3692137_+	DNA polymerase III	NA	NA	NA	NA	NA
WP_001091151.1|3692170_3693100_-|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
WP_000102827.1|3693547_3695959_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_000830090.1|3696143_3696989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001083481.1|3697028_3697388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|3698523_3699453_+|transposase	IS5-like element ISAba10 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.9	7.1e-51
3699448:3700472	attR	GCATAAATATCTGAAGATTAGAACAACTCTACCTTTCGTCTATTTGTGCAACAAAGCCTCTTCGATTACTAGTATTATCCCACTTCCTGAAAATAGTAACACAAGCAGTAATTTAGGTAACGGCTCTGGTGACGGCCTACTTAATGGAATATCTTCCGGAAATGGTGAACACAACTATGGTATTGGCAATGGTATTGCGGATGACGCAAGTATTACCGCCCCAATTACCATTCCCCTCAACCTATCTGGTAACTCAATTACTCTCATAGGCAATTCATCTTCAAGTTCGGTGAATAGCTCTCCAACCACCACTTCAAATAACGTTAATGACAACGACGTAACGAATAATGGTAACGGCTCCACCATTGGTAGTGGTACAGGCAATGGCTCTGGTGACGGGCTTTTAAATGGCGCCGCTTCTGGTAATGGTGAACACAACTATGGAATCGGTAATGGTATTGCCGATGACGCAAGCATTACTGCCCCACTTTCAATTCCAATTAACCTTGCGGGTAACTCTATTACCCTAATTGGTGACTCATCTTCTAGTTCGGTCAACAACTCTGCAACCAATACATCAAATACCGTGAATGATAACGACACCACCTATAACGGCAATGGCTCAGGTGCTGGTAATGGTTCGGGCGATGGCTTGTTAAATGGAATTGGCTCTGGCAATGGCGAGCAAAACTACGGTATCGGAAATGGGATTGCGGATGACGCAAGTATTACAGCCCCAATTACGCTTCCTATTAACTTGTCTGGTAACTCAATTACTCTAATTGGCAATTCATCTGCAAGTTCTGTTAATTCCTCGCCAACTACAACGTCAAATACTGTGAATGACAACGACACCACCTATAACGGCAATGGTACTGGTGATAGCGGCGTGAACGCTCTGGGCGGTTCCGGCAATGGTTCAGGTGATGGCGCAGGTAATGGTATCGCTTCTGGCAATGGTGAACATAACTATGGTATTGGCAATGGTAACGGCGACGATGTTGATATTACTGCTCCGATCACTG	NA	NA	NA	NA
>prophage 1
NZ_CP020585	Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence	111999	0	49601	111999	transposase,terminase,portal,tail	Salmonella_phage(28.0%)	56	NA	NA
WP_000567460.1|450_1200_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	40.5	7.8e-48
WP_000504046.1|1196_1892_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	48.0	2.8e-60
WP_000394499.1|1891_2218_-|tail	phage tail protein	tail	D6PGG4	uncultured_phage	31.1	9.0e-09
WP_000896671.1|2290_7879_-|tail	tail length tape measure protein	tail	NA	NA	NA	NA
WP_000119495.1|7881_8178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000771531.1|8234_8588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002670.1|8682_9228_-	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	52.2	6.3e-39
WP_000101578.1|9312_9810_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_001068664.1|9809_10196_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
WP_000494965.1|10192_10543_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	2.5e-09
WP_002027131.1|10529_11225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110365.1|11226_11997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769019.1|12003_12498_-	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
WP_001130341.1|12636_13539_-	hypothetical protein	NA	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
WP_001131896.1|13674_14553_-	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
WP_000206083.1|14596_16267_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	51.7	5.3e-145
WP_000764108.1|16312_17557_-|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
WP_000134192.1|17566_18172_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
WP_000084570.1|18324_18726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002027127.1|18837_19332_-	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
WP_001175928.1|19300_19624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416809.1|19614_20568_-	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
WP_000184979.1|20606_21029_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000312034.1|21025_21682_-	ATP-binding cassette domain-containing protein	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
WP_001292430.1|21681_22332_-	ParB N-terminal domain-containing protein	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
WP_000131110.1|22328_22931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000110211.1|22959_23598_-	ParB N-terminal domain-containing protein	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
WP_000521251.1|23676_25386_+	DEAD/DEAH box helicase	NA	L7TNS5	Rhizobium_phage	46.2	3.4e-131
WP_000741665.1|25511_25805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000146944.1|25868_26147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819256.1|26181_26751_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000993863.1|27144_27945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960557.1|28385_28811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121876.1|29543_29750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881636.1|31076_31412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906141.1|31475_31694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172716.1|31801_32143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401859.1|32201_32450_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	44.8	1.3e-07
WP_000075093.1|32525_33248_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.1	4.2e-14
WP_000495140.1|33263_33590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119273.1|33823_34069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001202407.1|35492_36656_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.0	2.2e-09
WP_085942965.1|37457_38621_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	79.2	8.8e-131
WP_001133624.1|38812_39088_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_000842147.1|39109_40222_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
WP_000402508.1|40450_41290_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000920558.1|41613_41916_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000931662.1|42512_43670_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000699626.1|43754_44432_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000655271.1|44632_45760_+	alkene reductase	NA	NA	NA	NA	NA
WP_001087972.1|45843_46074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804052.1|46178_46787_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002017368.1|46923_47037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017390.1|47046_47466_+	dehydrogenase	NA	NA	NA	NA	NA
WP_001040034.1|47444_48377_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.1	8.2e-63
WP_000991896.1|48737_49601_-	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	29.7	8.8e-11
>prophage 2
NZ_CP020585	Acinetobacter baumannii strain CBA7 plasmid pCBA7_1, complete sequence	111999	52828	111854	111999	transposase,integrase,tail	Pseudomonas_phage(35.71%)	55	71336:71352	92896:92912
WP_000613547.1|52828_53368_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	48.9	2.0e-37
WP_000973813.1|53692_53839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575331.1|54030_54702_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000774949.1|54698_55064_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0S0NAG1	Pseudomonas_phage	63.6	2.8e-35
WP_002017378.1|55056_55314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047654.1|55344_55572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019929.1|55571_55856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167538.1|55859_56771_-	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.4	7.7e-66
WP_023897602.1|56783_57773_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
WP_001103335.1|57870_60243_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
WP_000030999.1|60264_60645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692605.1|60718_61321_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.8	1.1e-31
WP_000192217.1|61452_62289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698012.1|62381_64322_-	AAA family ATPase	NA	L7TNH6	Rhizobium_phage	42.8	6.4e-118
WP_002017393.1|64321_65437_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	38.1	1.3e-59
WP_000234226.1|65779_66160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095727.1|66159_66621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000680035.1|66617_66977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433629.1|67064_69263_-	recombinase RecA	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
WP_000429229.1|69265_70303_-	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	8.8e-50
WP_001099771.1|70365_71226_-	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
71336:71352	attL	ATTATAGTAAGCGCTTA	NA	NA	NA	NA
WP_000034357.1|71368_72457_-	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
WP_000695256.1|72546_73812_-	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
WP_000432853.1|73808_74384_-	HNH endonuclease	NA	A0A2D1GG92	Gordonia_phage	44.4	2.1e-24
WP_000931856.1|74432_76790_-	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	43.4	4.3e-177
WP_000840050.1|76835_77516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252084.1|77566_78232_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000063932.1|78256_79501_-	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	41.7	2.4e-86
WP_001091151.1|79675_80605_-|transposase	IS5-like element ISAba10 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	41.0	1.2e-58
WP_001005716.1|80677_82600_-	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	43.9	3.9e-75
WP_000047261.1|82840_83035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833465.1|83456_83876_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000124736.1|84215_84800_+|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	4.0e-07
WP_001180910.1|84804_85212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770709.1|85414_86092_+	AAA family ATPase	NA	E5FFJ3	Burkholderia_phage	26.8	2.8e-12
WP_000016664.1|86088_86517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925127.1|86504_87125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497826.1|87197_87770_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	7.1e-09
WP_001083510.1|87809_89513_-	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.2	2.3e-87
WP_000063348.1|89525_90035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256859.1|90031_90640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082443.1|90633_91125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000053683.1|91124_91679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283392.1|91742_92837_-	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.7	1.1e-87
WP_000102028.1|92924_94328_-	DNA helicase	NA	L7TS87	Rhizobium_phage	38.8	4.3e-84
92896:92912	attR	TAAGCGCTTACTATAAT	NA	NA	NA	NA
WP_000005905.1|94364_94796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084436.1|94883_95615_-	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.6	1.7e-15
WP_000818857.1|95731_96853_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000097415.1|97856_98495_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	65.0	2.0e-68
WP_000138816.1|98494_98887_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	56.2	9.7e-34
WP_001185526.1|99010_99214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281052.1|99346_99598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121317.1|99607_100342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001262280.1|100355_100670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992032.1|100670_111854_-|tail	tail protein	tail	A4JX16	Burkholderia_virus	36.4	7.6e-155
