The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020567	Kitasatospora aureofaciens strain DM-1 chromosome, complete genome	6824334	707360	847591	6824334	tRNA,transposase,integrase	uncultured_Mediterranean_phage(14.29%)	103	743270:743329	766888:767248
WP_078958711.1|707360_708281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046385855.1|708767_710405_+	pyranose oxidase	NA	NA	NA	NA	NA
WP_030557050.1|710472_711654_+	MFS transporter	NA	NA	NA	NA	NA
WP_030557051.1|711706_712207_+	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_043389541.1|712203_713058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030557054.1|713286_714339_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_043389545.1|714905_717365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030557057.1|717420_718482_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	38.7	5.3e-42
WP_030557059.1|719224_720175_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_046385859.1|720234_721059_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_030557062.1|721120_722467_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_030557064.1|722547_724299_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_030557067.1|724509_725316_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_030557069.1|725341_726487_-	galactokinase	NA	NA	NA	NA	NA
WP_030557071.1|726736_727846_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_094743048.1|727904_728495_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_030557074.1|729320_730541_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	28.1	1.8e-33
WP_030557075.1|730878_731376_+	DinB family protein	NA	NA	NA	NA	NA
WP_141763694.1|731728_732538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141763693.1|732576_733923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030557081.1|734035_739609_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	42.9	5.5e-13
WP_141763692.1|739605_740556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030557084.1|740552_742691_-	hypothetical protein	NA	NA	NA	NA	NA
743270:743329	attL	TGAGCTTCCCCCGCTGCACGGGAGGCGTTGATTACCTGGTCAGGACGGGTGTGGGTGGTT	NA	NA	NA	NA
WP_099054196.1|743300_744122_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	42.1	2.9e-48
WP_050366506.1|744217_744529_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	50.9	1.8e-14
WP_030558091.1|744782_745988_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_030558090.1|746065_747283_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	2.9e-36
WP_030558089.1|747367_748318_+	restriction endonuclease NaeI	NA	NA	NA	NA	NA
WP_084768092.1|748320_748782_+	DNA mismatch endonuclease Vsr	NA	V5UTF4	Oenococcus_phage	37.5	6.1e-11
WP_030558086.1|748873_750151_-	DNA cytosine methyltransferase	NA	A0A1B1IRA0	uncultured_Mediterranean_phage	35.1	1.2e-16
WP_043389767.1|750505_751753_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	24.4	2.1e-13
WP_078938961.1|751914_752091_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063737831.1|752405_753383_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_141763691.1|753429_754209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558080.1|754611_755406_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_030558078.1|755715_756030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558076.1|756341_757958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050366507.1|757967_758933_+	PrgI family protein	NA	NA	NA	NA	NA
WP_046386861.1|758926_760720_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_141763690.1|761610_762642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558070.1|762906_764010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079151522.1|764294_764501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043389956.1|764491_765139_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_050366509.1|765308_765956_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_030558468.1|766124_766784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157846699.1|766918_767182_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.9	5.0e-10
WP_030599454.1|767295_768693_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	2.0e-33
766888:767248	attR	TGAGCTTCCCCCGCTGCACGGGAGGCGTTGATTACCTGGTCAGGACGGGTGTGGGTGGTTCGACGGTCACCGGTTCGGCCGTCGCCTGGTCGGCGTAGAACTTCGCCTCGTACTCGTCGGGGCTGAGCCAGCCCAGGCGCTTCTGGATGCGGCGGGTGTTGTACCAGCCGTCGATGTAGGCGAACAGGGCCAGGTCGGCGTCAGTGCGGGTCTCGAAGGTCGTGCGACGCACGCACTCGGTCTTCAGCACGCTCCAGAAGTTCTCGGCGAGGGCGTTGTCGAACGAGTCCCCCACGCTTCCCATGCTCGGCTCGATTCCCGCCTTCAGCAGTCGAGTTGTGAGCTTGATGGACGTGTATTG	NA	NA	NA	NA
WP_099054197.1|768640_769195_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	44.0	2.8e-26
WP_050366506.1|769290_769602_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	50.9	1.8e-14
WP_030558315.1|769703_770282_-	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_078938414.1|770530_772138_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_050366511.1|772330_773908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558319.1|774126_774519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558320.1|774909_775131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157846667.1|775215_775389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558321.1|775715_776255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157846699.1|776611_776875_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.9	5.0e-10
WP_030558454.1|776960_778256_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_046387049.1|778848_782403_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_141763689.1|782983_790168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141763688.1|790236_790866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157846641.1|791186_791939_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_030558027.1|792957_794232_-	MFS transporter	NA	NA	NA	NA	NA
WP_030558025.1|794413_795202_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_030290141.1|795444_796305_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_078958716.1|796362_797271_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_072654475.1|797267_797465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078938967.1|797567_798332_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GVU2	Streptomyces_phage	38.2	1.4e-28
WP_030290145.1|798927_799812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050366513.1|800015_800654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030290147.1|800880_802335_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_167344960.1|802481_803219_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_094743080.1|803323_804337_-	DUF4419 domain-containing protein	NA	A0A2I2L4E9	Orpheovirus	26.6	1.3e-21
WP_030290150.1|804532_805618_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_078958718.1|806084_808388_+	mucoidy inhibitor MuiA family protein	NA	NA	NA	NA	NA
WP_030290152.1|808392_809940_+	mucoidy inhibitor MuiA family protein	NA	NA	NA	NA	NA
WP_030558204.1|810006_810369_+	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_157846643.1|810444_811452_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_030290157.1|811675_812926_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_046386764.1|812988_813870_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	3.6e-12
WP_072654479.1|813866_814745_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_030558201.1|814873_815485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094743083.1|815481_816648_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.3	2.4e-19
WP_030290162.1|816986_818102_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_051747292.1|818363_820421_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_030290166.1|820666_821314_-	NUDIX hydrolase	NA	A0A291I9N0	Lactobacillus_phage	28.7	7.5e-07
WP_063738003.1|821414_823052_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.8	8.0e-138
WP_072656274.1|823855_825814_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_046385380.1|825815_826994_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_030290935.1|827162_828908_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_046385386.1|828984_829563_-	membrane protein	NA	NA	NA	NA	NA
WP_046385379.1|829843_831364_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_030290941.1|831385_832294_-	NAD kinase	NA	NA	NA	NA	NA
WP_030290943.1|832385_833192_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_033355582.1|833228_833435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050366517.1|833418_834273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030290947.1|834430_834778_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_030290949.1|834794_835835_-	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_078657233.1|835891_836485_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_078867775.1|836577_837948_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_030290952.1|838019_838907_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157881745.1|838843_840376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030554564.1|846319_847591_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.2	5.0e-71
>prophage 2
NZ_CP020567	Kitasatospora aureofaciens strain DM-1 chromosome, complete genome	6824334	5961164	6040013	6824334	transposase	Staphylococcus_phage(20.0%)	60	NA	NA
WP_167344954.1|5961164_5962304_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_141763822.1|5962649_5963387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021825.1|5963902_5964433_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_030555887.1|5964727_5967157_-	glycoside hydrolase family 27 protein	NA	NA	NA	NA	NA
WP_030555889.1|5967262_5968303_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_030555892.1|5968299_5969895_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.7e-13
WP_094743029.1|5969900_5970950_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_030555896.1|5971138_5971906_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_043389150.1|5971988_5972684_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_030555900.1|5972680_5973826_+	galactonate dehydratase	NA	NA	NA	NA	NA
WP_030555902.1|5973819_5974653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030555904.1|5974671_5975295_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_030555906.1|5975291_5976257_+	sugar kinase	NA	NA	NA	NA	NA
WP_030555908.1|5976274_5977159_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_030555911.1|5978206_5978647_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_043389147.1|5978758_5979421_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_030555915.1|5979877_5980414_+	hypothetical protein	NA	A0A0E3JJC9	Streptomyces_phage	34.3	7.3e-08
WP_030555918.1|5981084_5981546_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_030555920.1|5981637_5982564_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_030555925.1|5983725_5984199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030555927.1|5984195_5984690_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157846611.1|5984901_5985468_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_167344952.1|5985521_5985683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043389144.1|5986358_5987927_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	27.8	3.4e-37
WP_050366136.1|5988375_5988588_-	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	60.3	1.3e-16
WP_030555929.1|5988788_5989832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030555933.1|5990609_5991035_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_030555939.1|5994798_5995614_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030555941.1|5995845_5996913_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030555943.1|5996947_5997142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030555947.1|5997588_5999217_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030555949.1|5999430_6000264_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030555950.1|6000400_6000835_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_030555951.1|6000917_6001193_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_030555953.1|6001223_6003941_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_030555955.1|6004636_6005563_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030555958.1|6006563_6007406_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052405418.1|6007528_6008704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030555962.1|6008715_6009963_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_030598543.1|6010337_6010697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030598530.1|6010823_6011042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157846608.1|6011128_6011290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141763821.1|6011290_6012034_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_052743428.1|6012384_6013842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030555968.1|6014177_6014465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167344953.1|6014523_6014685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052743427.1|6015507_6016008_+	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_078939066.1|6016159_6016561_-	IPT/TIG domain-containing protein	NA	A0A222ZEQ0	Arthrobacter_phage	51.7	6.9e-11
WP_030558379.1|6018950_6019700_-	cell surface protein	NA	NA	NA	NA	NA
WP_063737937.1|6020881_6022186_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107050829.1|6022883_6023198_+	phosphotransferase	NA	NA	NA	NA	NA
WP_043389906.1|6023328_6023727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078938714.1|6023960_6025196_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_030558454.1|6025280_6026576_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_141763820.1|6027510_6028074_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_141763819.1|6028288_6028537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558279.1|6033980_6034286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558280.1|6034304_6034865_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_084768301.1|6036330_6037887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050366295.1|6039413_6040013_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020568	Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence	252068	217935	245694	252068	transposase	Mycobacterium_phage(33.33%)	25	NA	NA
WP_167745253.1|217935_218732_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	3.5e-22
WP_157881831.1|218921_219074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558346.1|219540_220044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050366201.1|220603_222124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050366202.1|222259_223924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141763665.1|224970_226038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141763666.1|226197_226413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558340.1|226623_227829_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_030558339.1|228199_228412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030558337.1|229151_229376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558336.1|229378_230107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_030558334.1|230196_230514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084768413.1|230510_231425_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.6	1.7e-36
WP_084768414.1|231439_231850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046386176.1|232239_233133_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_084768415.1|233113_233617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050366191.1|233740_234595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050366190.1|234584_235265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030558327.1|235320_235650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046386402.1|235669_236362_+	class I SAM-dependent methyltransferase	NA	A0A1B1ISU4	uncultured_Mediterranean_phage	31.9	3.4e-05
WP_030558324.1|236747_237698_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_141763891.1|238572_239037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158876681.1|242809_242962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050366196.1|243230_244634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078939115.1|244977_245694_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
