The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	123318	159903	4528215	transposase,protease	Stx2-converting_phage(64.29%)	39	NA	NA
WP_006118480.1|123318_124890_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	3.5e-175
WP_006117592.1|124909_125257_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|125253_125883_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_052310170.1|125956_127021_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_006122326.1|128274_128844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861853.1|128984_129221_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_006122325.1|129223_129538_+	CcdB family protein	NA	NA	NA	NA	NA
WP_006122323.1|129578_129743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122320.1|130288_131071_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_044243477.1|131190_131844_+	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	33.3	1.4e-21
WP_004178129.1|131884_132118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044243473.1|132155_132497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044243471.1|132557_133031_-	thermonuclease family protein	NA	A0A218ML12	uncultured_virus	34.6	2.7e-06
WP_044243468.1|133067_133823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006122301.1|138799_139786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|140173_140803_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|140799_141147_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006119980.1|141166_142738_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	7.8e-175
WP_044243452.1|142730_143753_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044243483.1|143764_144148_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_071988822.1|144151_144394_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_006122302.1|144401_145109_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_006122303.1|145126_147865_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_006122304.1|147877_148183_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_006122305.1|148179_148887_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_006122306.1|148902_149124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044243454.1|149136_149427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006122307.1|149428_149725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044243457.1|150169_150550_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167387052.1|150766_151468_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_167387053.1|151940_152654_+	RepA protein	NA	NA	NA	NA	NA
WP_006122310.1|153759_154980_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	7.0e-30
WP_006122311.1|155068_155644_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	56.8	1.2e-61
WP_006119980.1|155775_157347_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	7.8e-175
WP_006117592.1|157366_157714_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|157710_158340_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120990.1|158492_159092_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_006120991.1|159081_159252_-	YhfG family protein	NA	NA	NA	NA	NA
WP_006120992.1|159330_159903_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.2	7.6e-11
>prophage 2
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	520312	591783	4528215	tRNA,transposase,protease	Stx2-converting_phage(40.0%)	59	NA	NA
WP_006121281.1|520312_520786_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_006121282.1|520821_522201_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.7	5.0e-16
WP_006121283.1|522197_522896_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.1e-06
WP_006121284.1|523044_523554_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_006121285.1|524181_524346_+	stress-induced protein	NA	NA	NA	NA	NA
WP_006121287.1|524577_525480_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_006121288.1|525685_526648_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006121289.1|526786_527776_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006121290.1|528724_529492_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_006121292.1|529612_530203_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_006121293.1|530301_530736_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_006121294.1|530726_531473_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_006121295.1|531746_532937_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	21.6	1.8e-06
WP_006121296.1|532926_533937_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_006121297.1|534031_535543_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_006121298.1|535572_536421_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_006121300.1|536840_537080_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_006121301.1|537134_537620_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006121302.1|537780_539118_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.5	2.5e-44
WP_006121303.1|539128_539659_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_006121304.1|539747_540689_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_006121306.1|540845_541880_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_006121307.1|542044_544240_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_006121308.1|544464_544680_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006121309.1|544754_545072_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_006121311.1|545341_546502_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_006121312.1|546504_548937_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_006121313.1|549035_550607_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.9e-174
WP_006117592.1|550626_550974_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|550970_551600_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006121177.1|552098_554747_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_006121176.1|555097_556246_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_006121175.1|556414_557419_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_006121174.1|557433_558210_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_006121173.1|558234_559452_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_006121172.1|559540_560914_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_006121171.1|561266_562184_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_006121170.1|562166_563567_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_006121169.1|563760_564408_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_006121168.1|564422_564776_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_006121167.1|564810_565914_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_006121166.1|566284_568171_+	TonB-dependent vitamin B12 receptor BtuB	NA	NA	NA	NA	NA
WP_006121165.1|568115_568967_+	glutamate racemase	NA	NA	NA	NA	NA
WP_006122329.1|575307_575526_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_082999165.1|575798_576767_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.2e-170
WP_151161162.1|576811_577471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999169.1|578649_580221_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006117592.1|580240_580588_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|580584_581214_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_044241399.1|581556_582588_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052310154.1|582857_583421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006121517.1|583717_584260_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	92.2	5.6e-48
WP_006121518.1|584484_587313_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	1.4e-307
WP_006121519.1|587722_588787_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	47.0	1.4e-87
WP_006121520.1|588825_589149_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_006121521.1|589151_589568_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_006121522.1|590182_590518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242884.1|590514_590835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080577331.1|590814_591783_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
>prophage 3
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	920106	926072	4528215	transposase	Stx2-converting_phage(100.0%)	6	NA	NA
WP_006118285.1|920106_920796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	6.3e-20
WP_071988735.1|920738_921086_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	2.4e-44
WP_006121844.1|921105_922677_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	6.4e-177
WP_006117714.1|923507_925079_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006117592.1|925098_925446_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|925442_926072_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
>prophage 4
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	987163	996174	4528215	tRNA,transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_006120813.1|987163_988057_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.3	4.2e-32
WP_006120812.1|988078_988792_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006120811.1|988795_990535_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	7.3e-65
WP_100208631.1|990725_991823_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	7.0e-05
WP_006120809.1|991833_993354_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.2	2.8e-84
WP_044241253.1|993609_994239_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|994235_994583_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006119686.1|994602_996174_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
>prophage 5
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1134133	1144328	4528215	integrase	Salmonella_phage(27.27%)	19	1131980:1131994	1146161:1146175
1131980:1131994	attL	AGGGTGAATCACAGC	NA	NA	NA	NA
WP_071988716.1|1134133_1134379_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.0	2.0e-08
WP_006117551.1|1134488_1134704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241215.1|1135724_1135970_-	hypothetical protein	NA	V5URU3	Shigella_phage	65.8	1.8e-17
WP_006117554.1|1136097_1136310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241221.1|1136306_1137206_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	66.2	1.1e-112
WP_006117556.1|1137216_1138050_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	74.8	5.2e-109
WP_044241224.1|1138052_1138238_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_044241226.1|1138252_1138465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117558.1|1138461_1138815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241229.1|1138811_1139546_+	phage-like protein	NA	A0A077KCB2	Edwardsiella_phage	41.2	3.8e-39
WP_006117561.1|1139705_1139912_+	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	41.7	1.3e-05
WP_141119352.1|1140131_1140482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241235.1|1140977_1141262_+	hypothetical protein	NA	A0A141E1X7	Streptococcus_phage	52.3	1.7e-16
WP_006117564.1|1141258_1141588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241237.1|1141580_1141820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241240.1|1141870_1142080_+	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	63.6	2.3e-18
WP_052310100.1|1142076_1142619_+	hypothetical protein	NA	A0A173GC52	Salmonella_phage	36.1	8.2e-23
WP_100208596.1|1142693_1142960_+	hypothetical protein	NA	K7ZPX9	Xanthomonas_citri_phage	58.2	4.7e-24
WP_006117566.1|1143284_1144328_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	34.5	3.5e-54
1146161:1146175	attR	GCTGTGATTCACCCT	NA	NA	NA	NA
>prophage 6
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1473243	1516548	4528215	tRNA,transposase,plate	Stx2-converting_phage(25.81%)	50	NA	NA
WP_006120505.1|1473243_1473993_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_044242383.1|1473977_1475639_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_006120509.1|1475999_1476578_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	25.7	6.3e-05
WP_006120510.1|1476604_1477258_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006120511.1|1477257_1478214_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_006120512.1|1478210_1478675_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_006120514.1|1478894_1480694_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	1.4e-23
WP_006120515.1|1480703_1481678_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006120517.1|1481808_1482489_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	6.2e-20
WP_006120519.1|1482537_1483443_+	GTPase Era	NA	NA	NA	NA	NA
WP_006120522.1|1483447_1484179_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006120524.1|1484251_1484983_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_006120525.1|1484982_1485363_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_044242421.1|1485359_1485608_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.5	4.9e-15
WP_006120528.1|1485823_1487221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242384.1|1487217_1487421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044242423.1|1487417_1488842_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	75.2	3.5e-214
WP_006120531.1|1488950_1489253_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	70.8	2.1e-28
WP_044242385.1|1489236_1489479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242386.1|1489468_1489693_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044242389.1|1489708_1489921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242390.1|1489917_1490595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120533.1|1490600_1492703_-	DNA polymerase	NA	Q775A3	Bordetella_phage	66.1	1.9e-272
WP_044242398.1|1492761_1493451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120535.1|1493725_1494478_-	DUF2303 family protein	NA	A0A0A8IL76	Aurantimonas_phage	28.9	3.5e-16
WP_006119980.1|1494784_1496356_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	7.8e-175
WP_006117592.1|1496375_1496723_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|1496719_1497349_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120480.1|1497640_1498582_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	78.9	6.0e-146
WP_082999176.1|1498643_1499084_+	DUF1737 domain-containing protein	NA	V5K2Z7	Pseudomonas_phage	59.4	5.8e-11
WP_006120478.1|1499115_1499481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242382.1|1499446_1499854_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	78.5	6.1e-55
WP_044241399.1|1500140_1501172_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006118375.1|1501539_1501929_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	80.6	3.8e-54
WP_006118374.1|1501903_1502482_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	65.3	9.8e-67
WP_006118373.1|1502485_1503964_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	53.0	5.1e-136
WP_006118372.1|1503973_1504414_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	79.5	3.0e-60
WP_006118371.1|1504417_1504825_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	58.9	9.1e-35
WP_006118369.1|1504860_1505013_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	79.2	1.1e-14
WP_080577339.1|1505071_1507021_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	52.9	3.7e-182
WP_006118367.1|1507020_1507599_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	64.2	4.7e-61
WP_044241633.1|1507588_1507888_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	45.5	5.7e-18
WP_006118365.1|1507921_1508902_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	48.7	1.5e-96
WP_006117601.1|1509037_1510609_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	9.2e-176
WP_006117592.1|1510628_1510976_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|1510972_1511602_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006119131.1|1511675_1512344_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.2	3.1e-64
WP_141119373.1|1512728_1513364_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.9	9.3e-18
WP_006119137.1|1513360_1513708_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	69.2	1.5e-41
WP_006120658.1|1515357_1516548_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	55.2	1.4e-115
>prophage 7
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1745313	1825034	4528215	transposase,holin,capsid,tRNA,tail,plate	Burkholderia_virus(27.91%)	82	NA	NA
WP_006118051.1|1745313_1746885_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_006117592.1|1746904_1747252_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|1747248_1747878_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006118487.1|1748178_1749231_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	1.2e-81
WP_006118488.1|1749291_1750044_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006118489.1|1750192_1751227_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_006118490.1|1751220_1752369_-	galactokinase	NA	NA	NA	NA	NA
WP_006118491.1|1752365_1753412_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_006118492.1|1753632_1755105_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.4	4.4e-10
WP_006118493.1|1755181_1755964_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_006118494.1|1756105_1756261_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_006118495.1|1756396_1757170_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006118496.1|1757166_1757862_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006118497.1|1757855_1758917_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.2	4.7e-22
WP_006118498.1|1758951_1759770_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_006118499.1|1759925_1760924_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_006118500.1|1760973_1761450_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_006118501.1|1761523_1762816_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.7	6.7e-15
WP_006118502.1|1762901_1763933_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_006118503.1|1763932_1765084_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006118504.1|1765067_1765823_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_006118505.1|1765819_1766491_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_033737785.1|1766491_1767214_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	24.0	2.1e-10
WP_006118507.1|1768095_1770117_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006118508.1|1770118_1771024_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.0	6.6e-25
WP_006118509.1|1771350_1772337_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_006118510.1|1772351_1772867_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_006118511.1|1772869_1773355_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_006118512.1|1773347_1773593_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_006118513.1|1773593_1774046_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_006118514.1|1774042_1774828_-	OBAP family protein	NA	NA	NA	NA	NA
WP_006118515.1|1774934_1776026_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_006118516.1|1776124_1776832_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_006118518.1|1777835_1779080_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_006118519.1|1779076_1779838_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_006118520.1|1780015_1780408_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_006118521.1|1780632_1781982_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	8.5e-53
WP_006118522.1|1781984_1782974_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_006118523.1|1783001_1783919_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_006118524.1|1783933_1785538_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_006122429.1|1787307_1788879_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	6.0e-175
WP_006117592.1|1788898_1789246_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|1789242_1789872_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006118563.1|1790951_1792091_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_006118564.1|1792286_1794101_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_006118565.1|1794678_1795260_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	5.8e-67
WP_044243662.1|1795689_1796133_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	49.3	2.9e-34
WP_044241727.1|1796104_1796527_-|tail	tail assembly chaperone	tail	A0A0M4S6V4	Salmonella_phage	54.7	2.4e-14
WP_006122458.1|1797382_1797961_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	2.6e-67
WP_006122457.1|1797953_1799057_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	7.1e-106
WP_006122456.1|1799047_1799395_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_006122455.1|1799449_1799962_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_006122454.1|1799961_1801131_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.9	5.4e-88
WP_044243652.1|1801118_1801334_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	2.0e-17
WP_006122452.1|1801330_1802215_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	47.9	4.0e-51
WP_006122451.1|1802214_1804680_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	1.7e-171
WP_000084225.1|1804875_1805190_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_006122449.1|1806593_1806875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006122448.1|1806864_1807158_-	hypothetical protein	NA	A0A1B1PEE7	Pectobacterium_phage	43.5	1.5e-10
WP_167387063.1|1807159_1807684_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	3.1e-67
WP_006122446.1|1807680_1809108_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.0	4.9e-216
WP_042836908.1|1809097_1809352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006122444.1|1809348_1809813_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	1.1e-39
WP_006122443.1|1809812_1810259_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	7.9e-32
WP_006122442.1|1810260_1810617_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_006122441.1|1810627_1811581_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.3	1.3e-63
WP_044243657.1|1811594_1812692_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	50.1	4.6e-97
WP_006122439.1|1812906_1813365_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	4.9e-29
WP_044243645.1|1813367_1814189_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	60.8	2.9e-96
WP_006122435.1|1815653_1817177_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	4.4e-183
WP_006122434.1|1817173_1817719_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.0	2.7e-58
WP_006122433.1|1817718_1818030_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000175096.1|1818022_1818355_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122432.1|1818351_1819005_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	30.2	1.8e-08
WP_006122431.1|1818994_1819717_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.8	2.6e-64
WP_006118559.1|1819719_1820070_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	1.5e-22
WP_006122430.1|1820163_1820421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118561.1|1820447_1822019_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.1e-175
WP_006117592.1|1822038_1822386_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|1822382_1823012_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_085980085.1|1823212_1823773_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_044241399.1|1824002_1825034_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1852780	1862157	4528215	integrase,transposase	Burkholderia_virus(33.33%)	16	1856192:1856207	1861920:1861935
WP_006118589.1|1852780_1853113_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	53.1	5.0e-23
WP_044241748.1|1853109_1853538_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	6.2e-26
WP_006118591.1|1853527_1853743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118592.1|1853739_1854429_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.8	1.1e-24
WP_006118593.1|1854415_1854712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118594.1|1854708_1854897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118595.1|1854975_1855587_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	1.2e-75
WP_000835317.1|1855604_1855874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118596.1|1855876_1857043_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.2	1.2e-119
1856192:1856207	attL	TTTGTCCGCCAGTTCA	NA	NA	NA	NA
WP_006118597.1|1857053_1858823_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.0	1.8e-228
WP_006118598.1|1858826_1859735_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	1.1e-75
WP_006118599.1|1859744_1860050_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	57.0	2.7e-23
WP_001041677.1|1860046_1860271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241752.1|1860359_1860770_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044241754.1|1860805_1861339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118601.1|1861386_1862157_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.1	6.9e-100
1861920:1861935	attR	TGAACTGGCGGACAAA	NA	NA	NA	NA
>prophage 9
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1905975	1914481	4528215	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_033737667.1|1905975_1906239_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	62.8	2.7e-24
WP_082999199.1|1906475_1906730_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_082999200.1|1906746_1907469_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_082999201.1|1907491_1908394_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SYT2	Cyanophage	31.9	2.3e-38
WP_033737663.1|1908480_1908960_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_082999202.1|1909173_1910745_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	6.6e-174
WP_006122358.1|1910764_1911112_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	2.7e-43
WP_044241253.1|1911108_1911738_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_033737662.1|1912127_1913237_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_033737661.1|1913347_1914481_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
>prophage 10
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	1946726	1956607	4528215	tRNA,transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_006118614.1|1946726_1948019_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	8.3e-98
WP_006118615.1|1948335_1949490_+	MFS transporter	NA	NA	NA	NA	NA
WP_006118616.1|1949596_1950337_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	8.9e-20
WP_006118617.1|1950490_1952773_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	9.3e-161
WP_006118618.1|1952845_1953706_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_044241253.1|1954042_1954672_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|1954668_1955016_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118619.1|1955035_1956607_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.9e-173
>prophage 11
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	2025241	2089223	4528215	head,tail,integrase,terminase,plate,protease	Salmonella_phage(28.07%)	95	2019759:2019776	2071252:2071269
2019759:2019776	attL	CTGGCCGCTGCCGATCAG	NA	NA	NA	NA
WP_006118679.1|2025241_2025898_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.1	1.1e-48
WP_044241764.1|2026610_2028221_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_006118681.1|2028287_2029661_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006118682.1|2029715_2029946_-	YccJ family protein	NA	NA	NA	NA	NA
WP_006118683.1|2029966_2030566_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_006118686.1|2032075_2032585_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_006118687.1|2032605_2033898_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	65.3	8.4e-175
WP_044241767.1|2033953_2034187_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	77.6	6.0e-31
WP_100208605.1|2034190_2034562_-	LexA family transcriptional regulator	NA	A0A2H4JG58	uncultured_Caudovirales_phage	38.5	3.6e-06
WP_052310115.1|2034545_2034929_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	42.9	7.6e-15
WP_006118690.1|2034915_2035260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118691.1|2035256_2035655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118692.1|2035651_2035873_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	48.6	3.4e-12
WP_006118693.1|2035869_2035995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118694.1|2035991_2036573_-	KilA-N domain-containing protein	NA	Q71TC0	Escherichia_phage	43.7	9.7e-22
WP_044241815.1|2036569_2037133_-	bacteriophage protein	NA	A0A088C4R7	Shewanella_sp._phage	35.7	5.9e-24
WP_006118696.1|2037137_2037419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118697.1|2037429_2037816_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	38.3	1.9e-10
WP_006118698.1|2038033_2038378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100208606.1|2038374_2038563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118700.1|2038656_2038896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118701.1|2038941_2039139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118702.1|2039206_2039410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241773.1|2039412_2039604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241774.1|2039735_2040407_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	63.7	1.6e-81
WP_071988744.1|2040507_2040717_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	72.6	3.2e-20
WP_006118703.1|2040706_2041048_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	49.0	2.0e-19
WP_100208609.1|2041291_2042011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118705.1|2042091_2043597_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	65.3	5.1e-200
WP_006118706.1|2043596_2044580_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	58.4	5.0e-111
WP_006118707.1|2044576_2045359_+	molecular chaperone	NA	F1C595	Cronobacter_phage	42.9	2.7e-59
WP_006118708.1|2045613_2046042_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	89.5	1.4e-62
WP_044241776.1|2046041_2046200_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	60.4	1.8e-07
WP_141119364.1|2046634_2046934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241780.1|2046936_2047476_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	82.0	5.9e-82
WP_156879132.1|2047472_2047874_+	hypothetical protein	NA	S5FKR3	Shigella_phage	30.4	2.2e-09
WP_044241783.1|2048018_2048423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118713.1|2048455_2048713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118714.1|2048763_2048937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118715.1|2049000_2049186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118716.1|2049187_2049913_+|terminase	terminase small subunit	terminase	A0A1I9KFG9	Aeromonas_phage	59.6	1.4e-09
WP_006118717.1|2049999_2051220_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J196	uncultured_Caudovirales_phage	61.4	2.9e-145
WP_006118718.1|2051437_2052907_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	77.2	1.7e-216
WP_006118719.1|2053022_2054267_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	32.4	4.0e-57
WP_006118720.1|2054445_2054664_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_006118721.1|2054663_2055413_+	ash family protein	NA	NA	NA	NA	NA
WP_006118722.1|2055405_2056284_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006118723.1|2056276_2056501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241786.1|2056497_2056719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241788.1|2056722_2056950_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_006118724.1|2056939_2059258_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	38.2	2.4e-132
WP_044241790.1|2059532_2059913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118725.1|2060152_2060716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118726.1|2060712_2060880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118727.1|2060903_2061098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118729.1|2061112_2061715_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	56.6	1.9e-49
WP_006118731.1|2061724_2062795_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.3	3.4e-105
WP_044241792.1|2062796_2063141_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	53.9	8.6e-18
WP_052310117.1|2063151_2063847_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	54.5	3.3e-61
WP_006118733.1|2063877_2064474_+|terminase	terminase small subunit	terminase	I3PUX8	Vibrio_phage	45.0	1.1e-36
WP_044241794.1|2064521_2065049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141119365.1|2065984_2066467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118735.1|2066568_2067297_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	69.6	4.0e-73
WP_044241253.1|2067383_2068013_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|2068009_2068357_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118737.1|2070249_2071473_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	62.9	1.3e-132
2071252:2071269	attR	CTGGCCGCTGCCGATCAG	NA	NA	NA	NA
WP_006118738.1|2071476_2072001_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	56.1	5.3e-43
WP_044241835.1|2072019_2072970_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	66.5	5.5e-123
WP_006118740.1|2073008_2073416_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	79.3	1.2e-55
WP_006118741.1|2073412_2074042_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.6	1.3e-27
WP_006118742.1|2074028_2074418_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	77.5	6.6e-51
WP_006118743.1|2074407_2074956_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	56.1	2.2e-55
WP_006118744.1|2074959_2076105_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	68.5	7.7e-148
WP_006118745.1|2076117_2076561_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	86.0	9.8e-67
WP_006118746.1|2076564_2076774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118747.1|2076784_2077207_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	73.8	3.7e-47
WP_006118748.1|2077251_2077404_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.8e-12
WP_006118749.1|2077393_2079436_+	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	64.9	4.1e-160
WP_006118750.1|2079435_2080044_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.7	7.7e-70
WP_006118751.1|2080043_2080346_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	54.0	1.2e-28
WP_006118752.1|2080348_2081416_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	61.3	4.3e-124
WP_044241798.1|2081420_2081762_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.7	2.5e-25
WP_006118754.1|2081763_2081976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118755.1|2082035_2082449_-	hypothetical protein	NA	K7P7K4	Enterobacteria_phage	58.8	1.9e-40
WP_006118756.1|2082566_2083223_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	58.0	2.5e-74
WP_006118757.1|2083219_2083573_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	82.9	1.6e-51
WP_006118758.1|2083572_2084772_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	73.4	1.9e-160
WP_006118759.1|2084768_2085449_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	76.6	1.3e-97
WP_006118761.1|2085448_2086240_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	56.8	3.5e-38
WP_044241800.1|2086239_2086668_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.6	1.7e-39
WP_100208608.1|2087166_2087631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241803.1|2087620_2088046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118764.1|2088095_2088308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118765.1|2088511_2088760_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	54.9	4.3e-19
WP_006118766.1|2088857_2089223_+	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	47.0	3.0e-21
>prophage 12
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	2199664	2302047	4528215	transposase,holin,tail,integrase,terminase,plate	Escherichia_phage(48.28%)	113	2194063:2194079	2227380:2227396
2194063:2194079	attL	CTGCCAGAGCAGCTTGC	NA	NA	NA	NA
WP_006118866.1|2199664_2200915_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_006118867.1|2201037_2202171_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	69.4	1.9e-146
WP_044241870.1|2202145_2202397_-	excisionase	NA	NA	NA	NA	NA
WP_100208610.1|2202463_2203978_-	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	54.3	1.3e-150
WP_167387064.1|2204106_2204580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241872.1|2204590_2204824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241876.1|2204826_2205129_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	3.4e-34
WP_006118872.1|2205125_2205458_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	48.1	8.5e-23
WP_006118873.1|2205454_2205703_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	87.7	4.4e-32
WP_044241877.1|2205699_2205912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118874.1|2206177_2206393_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	53.5	8.0e-14
WP_156879133.1|2206389_2206563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118876.1|2206604_2207168_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	41.1	2.8e-26
WP_006118877.1|2207164_2209420_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	33.2	1.4e-100
WP_006118878.1|2209412_2209676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241882.1|2209757_2210045_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.4	1.5e-12
WP_044241885.1|2210244_2210436_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_006118880.1|2210432_2210597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044243758.1|2210839_2211244_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	47.4	4.5e-26
WP_044243761.1|2211323_2211554_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_044243763.1|2211531_2212005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122503.1|2212046_2212916_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	58.6	2.6e-31
WP_006122504.1|2212918_2213665_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	72.3	8.7e-100
WP_082999211.1|2213684_2214509_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	70.7	9.0e-98
WP_082999268.1|2214749_2214905_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_016192912.1|2215248_2215446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119778.1|2215503_2216103_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	75.4	1.9e-81
WP_006119777.1|2216099_2216753_+	phage N-6-adenine-methyltransferase	NA	S5M7S1	Escherichia_phage	64.3	1.4e-77
WP_044242157.1|2217126_2217423_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	67.7	1.1e-34
WP_006119775.1|2217422_2218121_+	antitermination protein	NA	NA	NA	NA	NA
WP_006119774.1|2218254_2218458_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_044242156.1|2218666_2219071_+	hypothetical protein	NA	S4TRS4	Salmonella_phage	39.8	1.7e-12
WP_044242155.1|2219054_2219351_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006119772.1|2219364_2219976_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	62.7	2.0e-65
WP_006119771.1|2219972_2220512_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_044242154.1|2220501_2220903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242152.1|2220963_2221545_+	pmgO	NA	B5WZS6	Pseudomonas_phage	49.4	3.4e-43
WP_006119768.1|2221501_2222410_+	heptosyltransferase	NA	NA	NA	NA	NA
WP_006119767.1|2222406_2223024_+	methyltransferase domain-containing protein	NA	B5WZS8	Pseudomonas_phage	47.5	6.0e-46
WP_052310128.1|2223146_2223779_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.0	6.2e-38
WP_006119764.1|2223768_2224635_+	hypothetical protein	NA	A0A1B1ITF1	uncultured_Mediterranean_phage	57.8	4.4e-95
WP_006119763.1|2224643_2224901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242150.1|2224900_2225929_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	42.1	1.5e-46
WP_085980092.1|2225938_2227264_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	75.6	2.4e-201
WP_006119759.1|2227279_2228710_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	76.1	1.4e-210
2227380:2227396	attR	GCAAGCTGCTCTGGCAG	NA	NA	NA	NA
WP_099707314.1|2228780_2229500_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	79.5	4.3e-112
WP_044242147.1|2229480_2230761_+	NUDIX hydrolase	NA	A0A0U2QW61	Escherichia_phage	75.5	4.6e-149
WP_006119756.1|2230753_2231371_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	71.7	4.0e-82
WP_006119754.1|2231381_2232410_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	79.5	1.4e-156
WP_006119752.1|2232475_2232946_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	73.7	3.7e-64
WP_006119750.1|2232945_2233386_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	64.4	5.4e-49
WP_006119748.1|2233382_2233811_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	58.9	7.6e-40
WP_006119747.1|2233797_2234745_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	66.3	3.4e-117
WP_006119743.1|2234744_2236073_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	75.1	8.0e-189
WP_044242145.1|2236098_2236527_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	84.5	4.0e-65
WP_006119739.1|2236526_2237144_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	65.7	1.2e-73
WP_006119737.1|2237208_2239062_+	lytic transglycosylase domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	51.8	1.3e-176
WP_044242144.1|2239062_2239725_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	75.5	2.0e-92
WP_006119735.1|2239721_2239985_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	60.7	1.1e-25
WP_006119734.1|2239984_2240989_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	50.0	1.7e-90
WP_044242143.1|2240985_2241702_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	57.6	1.3e-73
WP_006119732.1|2241704_2242052_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	82.6	3.8e-50
WP_044242142.1|2242056_2242740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241399.1|2242955_2243987_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006119731.1|2244056_2245142_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	65.8	6.0e-134
WP_044242141.1|2245125_2245749_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	65.7	1.9e-79
WP_044242140.1|2247030_2247606_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	56.5	2.0e-51
WP_006119728.1|2247773_2247926_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.0	2.4e-17
WP_006119727.1|2248334_2248640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033737525.1|2249848_2250115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119724.1|2250229_2251429_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044241253.1|2251894_2252524_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117600.1|2252520_2252868_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	1.6e-43
WP_006119686.1|2252887_2254459_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006119722.1|2254662_2255835_+	MFS transporter	NA	NA	NA	NA	NA
WP_006119721.1|2255869_2256118_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_006119720.1|2256346_2256913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119719.1|2256978_2257308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119718.1|2257516_2257696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119715.1|2258296_2258713_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006119714.1|2258704_2259370_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006119713.1|2259392_2260316_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_006119712.1|2260471_2261104_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_006119711.1|2261149_2262097_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006119710.1|2262407_2263238_+	transketolase	NA	NA	NA	NA	NA
WP_006119709.1|2263230_2264175_+	transketolase	NA	NA	NA	NA	NA
WP_006119708.1|2264177_2265665_+	glycerol kinase	NA	NA	NA	NA	NA
WP_006119707.1|2265714_2266848_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_006119706.1|2266945_2267680_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_044242136.1|2267891_2268107_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_080577331.1|2268108_2269077_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
WP_006119705.1|2269281_2270967_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_006119704.1|2271183_2272125_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	30.6	1.1e-06
WP_006119703.1|2272162_2272900_+	phosphatase	NA	NA	NA	NA	NA
WP_006119701.1|2273885_2274455_+	molecular chaperone	NA	NA	NA	NA	NA
WP_006119700.1|2274456_2275818_-	CoA transferase	NA	NA	NA	NA	NA
WP_006119699.1|2275865_2276750_-	EamA family transporter	NA	NA	NA	NA	NA
WP_006119698.1|2276926_2277649_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_006119697.1|2277636_2278200_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006119696.1|2278434_2279955_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006119695.1|2280129_2280318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119693.1|2282773_2283724_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006119692.1|2283851_2285324_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_006119691.1|2285334_2287182_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_044242135.1|2287305_2288133_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_006119690.1|2290113_2290689_+	histidine phosphatase family protein	NA	M1HFB0	Paramecium_bursaria_Chlorella_virus	43.5	7.1e-33
WP_100208616.1|2290841_2292386_-	resolvase	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	4.4e-13
WP_006119688.1|2292776_2293964_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	59.7	3.4e-130
WP_006119687.1|2294377_2295622_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006119686.1|2295843_2297415_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006117600.1|2297434_2297782_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	1.6e-43
WP_044241253.1|2297778_2298408_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117937.1|2301015_2302047_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	2411759	2483258	4528215	tail,holin,transposase,plate	Salmonella_phage(14.89%)	94	NA	NA
WP_006119560.1|2411759_2413043_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	48.3	2.2e-114
WP_044242113.1|2413074_2413323_-	excisionase family protein	NA	S4TND0	Salmonella_phage	56.9	1.0e-17
WP_141119376.1|2413432_2413780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119558.1|2413787_2414381_-	adenine methylase	NA	T1SA14	Salmonella_phage	73.7	5.9e-83
WP_052310126.1|2414427_2414868_-	hypothetical protein	NA	A0A2H5BPP8	Salmonella_phage	52.3	9.6e-06
WP_006117561.1|2415338_2415545_-	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	41.7	1.3e-05
WP_044241229.1|2415704_2416439_-	phage-like protein	NA	A0A077KCB2	Edwardsiella_phage	41.2	3.8e-39
WP_006119555.1|2416435_2416789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242111.1|2416785_2416998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119553.1|2417012_2417327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242110.1|2417348_2417831_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	90.7	5.0e-56
WP_006119551.1|2417830_2418703_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	50.0	1.0e-59
WP_156879134.1|2418863_2419025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119548.1|2419351_2419498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156879135.1|2419517_2419664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242109.1|2419900_2420179_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	A9YWZ2	Burkholderia_phage	32.1	3.2e-07
WP_156879136.1|2420168_2420342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119547.1|2420651_2421470_-	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	65.5	4.4e-04
WP_006119546.1|2421621_2422215_-	hypothetical protein	NA	V5URU3	Shigella_phage	43.0	3.3e-41
WP_044242108.1|2422228_2422570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242107.1|2422910_2423117_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	47.7	8.2e-08
WP_006119545.1|2423164_2424082_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	77.4	2.0e-146
WP_044242129.1|2424232_2424931_-	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	78.0	3.0e-102
WP_044242106.1|2425039_2425270_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	82.9	8.5e-30
WP_044242105.1|2425381_2425672_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	77.1	1.2e-33
WP_044242104.1|2425692_2425974_+	hypothetical protein	NA	G9L679	Escherichia_phage	52.3	2.4e-18
WP_006119543.1|2425970_2426936_+	hypothetical protein	NA	G9L680	Escherichia_phage	48.1	7.0e-25
WP_006119542.1|2426937_2428305_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.2	3.1e-79
WP_044242102.1|2428297_2428627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119540.1|2428628_2428904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242100.1|2428891_2429101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242098.1|2429097_2429319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242096.1|2429315_2429498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119539.1|2429469_2429931_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	56.9	3.9e-42
WP_044242095.1|2429927_2430209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242093.1|2430205_2430433_+	protein ninH	NA	A0A088CC23	Shigella_phage	64.9	1.6e-12
WP_044242090.1|2430610_2430898_+	hypothetical protein	NA	S5MLS6	Pseudoalteromonas_phage	58.1	3.0e-24
WP_167387058.1|2430996_2431170_+	NinF family protein	NA	NA	NA	NA	NA
WP_006119536.1|2431162_2431453_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	90.6	1.6e-46
WP_006119535.1|2431449_2431812_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	90.8	7.5e-57
WP_006119534.1|2431927_2432749_+	antitermination protein	NA	E5AGG3	Erwinia_phage	58.5	2.3e-85
WP_052310127.1|2433285_2433573_+|holin	phage holin family protein	holin	F1C5D1	Cronobacter_phage	69.0	1.8e-29
WP_044242128.1|2433565_2434198_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	75.4	4.4e-84
WP_006119531.1|2434185_2434602_+	hypothetical protein	NA	F1C5D3	Cronobacter_phage	51.5	5.1e-25
WP_044242088.1|2434907_2435495_+	Rha family transcriptional regulator	NA	Q9B021	Phage_GMSE-1	82.7	1.2e-27
WP_006119528.1|2435491_2435701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242086.1|2435879_2436500_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	72.1	3.9e-85
WP_044242085.1|2436531_2437011_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	87.4	4.5e-73
WP_006119525.1|2436997_2438470_+	hypothetical protein	NA	G0ZND4	Cronobacter_phage	87.2	3.8e-248
WP_006119524.1|2438542_2439880_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	41.8	2.1e-88
WP_006119523.1|2440000_2440753_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	48.8	6.8e-60
WP_006119522.1|2440766_2441891_+	hypothetical protein	NA	W6EBZ8	Rhizobium_phage	53.3	4.1e-93
WP_044242083.1|2441934_2442120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119520.1|2442119_2442512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119519.1|2442513_2443155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242082.1|2443156_2443972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119517.1|2443976_2444171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119516.1|2444233_2445796_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	42.0	6.3e-84
WP_006119515.1|2445843_2446275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119514.1|2446278_2446665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119513.1|2446700_2446850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119512.1|2446846_2447287_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_006119510.1|2447845_2448019_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	89.3	1.3e-19
WP_044242079.1|2448764_2449556_+	Bro-N domain-containing protein	NA	A0A2L1IV39	Escherichia_phage	57.0	4.0e-79
WP_044242124.1|2449714_2450059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119507.1|2450118_2452470_+	hypothetical protein	NA	K4NZX3	Burkholderia_phage	25.7	2.2e-27
WP_044242077.1|2452481_2453501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119505.1|2453502_2454621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119504.1|2454617_2455217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119503.1|2455226_2455592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119502.1|2455594_2456719_+|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	43.1	1.9e-50
WP_044242076.1|2456728_2457403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119501.1|2457457_2458855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242075.1|2458854_2459283_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.9	4.9e-39
WP_085980087.1|2459601_2460174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119499.1|2460191_2461412_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044242072.1|2461423_2462014_-	protein kinase	NA	NA	NA	NA	NA
WP_006119497.1|2462173_2462383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119496.1|2462414_2462738_+	hypothetical protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	47.6	9.2e-22
WP_006119494.1|2464216_2464414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119493.1|2464663_2464930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119492.1|2464967_2465207_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	60.8	8.0e-23
WP_006119490.1|2465382_2465679_+	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_006119488.1|2465809_2466133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119487.1|2466374_2466833_+	lipoprotein	NA	NA	NA	NA	NA
WP_006119486.1|2468423_2468783_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_006119484.1|2468782_2469193_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_006119483.1|2469207_2470605_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_006119482.1|2470857_2471787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119481.1|2471973_2475666_+	glycosyltransferase	NA	A0A291LAC8	Escherichia_phage	27.2	2.0e-11
WP_006119480.1|2475796_2479270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|2480693_2481323_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|2481319_2481667_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118098.1|2481686_2483258_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.5e-173
>prophage 14
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	2569660	2646702	4528215	tRNA,transposase	Stx2-converting_phage(21.43%)	64	NA	NA
WP_006118953.1|2569660_2571589_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	1.4e-125
WP_006118954.1|2571592_2572144_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.2	8.3e-15
WP_006118955.1|2572244_2572442_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006118956.1|2572486_2572843_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006118957.1|2572892_2574080_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	59.9	4.7e-132
WP_106120997.1|2574268_2574313_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006118958.1|2574460_2575444_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_006118959.1|2575458_2577846_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	2.3e-08
WP_006118960.1|2577850_2578153_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_006118961.1|2578252_2579260_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_006118962.1|2579805_2580555_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	1.1e-09
WP_006118963.1|2580621_2581080_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	36.6	4.6e-11
WP_006118964.1|2581371_2582106_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006118965.1|2583817_2584864_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	50.0	1.3e-85
WP_006118966.1|2585015_2585843_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_033741141.1|2586283_2588668_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.0	2.0e-166
WP_006118968.1|2589228_2590323_-	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_006118969.1|2590530_2593584_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_006118970.1|2593614_2594019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118971.1|2594410_2594785_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	37.7	3.9e-16
WP_006118972.1|2594792_2596286_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_006118973.1|2596332_2597079_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.7	4.9e-10
WP_006118974.1|2597053_2598331_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_006118975.1|2598330_2599554_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.7	9.9e-93
WP_006118976.1|2599575_2599992_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_006118977.1|2601254_2601491_-	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_006118978.1|2601797_2603210_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_006118979.1|2603950_2605324_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_006118980.1|2605517_2606186_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	2.0e-23
WP_006118981.1|2607805_2609008_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.1e-14
WP_006118982.1|2609116_2610022_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006118983.1|2610018_2611044_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.8	2.4e-31
WP_100208612.1|2611326_2611416_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_006118984.1|2611651_2612470_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	40.7	4.5e-17
WP_006118985.1|2612837_2613170_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006118986.1|2613208_2613880_-	ribonuclease T	NA	NA	NA	NA	NA
WP_006118987.1|2614002_2614410_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_006118988.1|2614523_2615621_-	alkene reductase	NA	NA	NA	NA	NA
WP_006118989.1|2615667_2616270_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006118990.1|2616445_2616685_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_080577363.1|2617463_2618432_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	90.7	3.6e-170
WP_006118994.1|2618794_2619313_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.7	2.9e-54
WP_006118995.1|2619455_2619869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241942.1|2621943_2622663_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_044241253.1|2622717_2623347_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|2623343_2623691_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118051.1|2623710_2625282_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_006118996.1|2625493_2625736_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_006118997.1|2625879_2626317_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_006118998.1|2626363_2626831_-	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
WP_006118999.1|2627113_2628235_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_006119000.1|2628284_2628518_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_006119001.1|2628928_2630140_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_044241399.1|2630858_2631890_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044241253.1|2632146_2632776_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|2632772_2633120_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006119002.1|2633139_2634711_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	2.7e-175
WP_006119003.1|2634728_2634959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119004.1|2635130_2635895_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	5.5e-17
WP_006119005.1|2636033_2638106_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_006119006.1|2638165_2640697_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_006119007.1|2640693_2642481_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_006119008.1|2642946_2645211_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.2	9.6e-142
WP_080577331.1|2645733_2646702_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
>prophage 15
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3035771	3045068	4528215	transposase,protease	Stx2-converting_phage(85.71%)	8	NA	NA
WP_006118619.1|3035771_3037343_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.9e-173
WP_006117592.1|3037362_3037710_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3037706_3038336_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006118051.1|3038841_3040413_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_006117592.1|3040432_3040780_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3040776_3041406_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120311.1|3041895_3042777_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006120310.1|3043022_3045068_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.0e-85
>prophage 16
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3151962	3173309	4528215	tail,integrase,transposase,plate	Stx2-converting_phage(31.58%)	30	3167920:3167979	3178340:3178513
WP_006120212.1|3151962_3153534_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.9e-173
WP_006117592.1|3153553_3153901_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3153897_3154527_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006119780.1|3154712_3155339_+	LysE family translocator	NA	NA	NA	NA	NA
WP_006119781.1|3155486_3156134_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006119782.1|3156198_3157581_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_100208617.1|3158063_3158495_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	50.7	1.8e-36
WP_141119378.1|3158491_3159199_-	hypothetical protein	NA	O22004	Shigella_phage	34.6	6.7e-17
WP_006119785.1|3159140_3159710_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	36.8	7.3e-22
WP_006119786.1|3159706_3160768_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.8	4.0e-74
WP_052310130.1|3160767_3160965_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_044241253.1|3161038_3161668_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|3161664_3162012_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006119788.1|3162031_3163603_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.5e-173
WP_080577405.1|3163629_3163767_-	DUF1018 domain-containing protein	NA	A0A2D1GNN4	Pseudomonas_phage	62.8	3.2e-08
WP_044241399.1|3163851_3164883_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006119789.1|3164946_3165135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119790.1|3165134_3165683_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	59.9	7.2e-51
WP_006119791.1|3165679_3165898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119792.1|3165894_3166314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119793.1|3166342_3167062_-	DUF2786 domain-containing protein	NA	J9SVL0	Pseudomonas_phage	30.0	5.8e-16
WP_006119794.1|3167143_3167335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242188.1|3167321_3167558_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
3167920:3167979	attL	GGGCTTTGTTGAATAATAGGTAATCATTCTGTTTTGTCTGCACTGTTTTGGTAGAAAACG	NA	NA	NA	NA
WP_100208619.1|3167942_3168380_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	56.8	8.6e-23
WP_006119796.1|3168576_3168861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119797.1|3168860_3169139_-	hypothetical protein	NA	A0A125RNA1	Pseudomonas_phage	52.2	1.5e-12
WP_006119798.1|3169149_3170043_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	61.5	9.4e-101
WP_044242189.1|3170054_3172118_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.3	5.3e-163
WP_044242190.1|3172123_3172387_-	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	64.2	4.7e-24
WP_044242191.1|3172574_3173309_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	30.0	7.0e-17
3178340:3178513	attR	CGTTTTCTACCAAAACAGTGCAGACAAAACAGAATGATTACCTATTATTCAACAAAGCCCCGCAGATCGTTAAAACTCACTTTCCCCGCGCCACCACCGCCGCCAACAGCCATATTGCAGGGTTGTGAAGCCCCCCACTCAAATGAGAGTACGTCGGTCCATCCTTTATGTTTA	NA	NA	NA	NA
>prophage 17
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3232145	3306706	4528215	lysis,tRNA,transposase	Escherichia_phage(14.29%)	50	NA	NA
WP_085980086.1|3232145_3232840_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	84.8	2.4e-115
WP_044241399.1|3233474_3234506_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006119856.1|3235707_3236721_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.0	4.5e-75
WP_006119858.1|3236770_3237667_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.5	2.3e-46
WP_006119861.1|3237935_3239276_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_006119862.1|3239272_3240496_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_006119863.1|3240500_3241763_-	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_006119865.1|3241913_3244124_-	amylovoran biosynthesis protein AmsF	NA	W8CZM5	Erwinia_phage	40.3	6.3e-122
WP_006119866.1|3244212_3245247_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_006119867.1|3245293_3246046_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.9	3.5e-08
WP_006119868.1|3246127_3247045_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_006119869.1|3247173_3248310_-	EpsG family protein	NA	NA	NA	NA	NA
WP_006119870.1|3248556_3250734_-	tyrosine-protein kinase Wzc	NA	NA	NA	NA	NA
WP_006119871.1|3250746_3251181_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_006119873.1|3251190_3252330_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_006119874.1|3252786_3254220_-	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_006119875.1|3254997_3256569_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.0	4.3e-32
WP_006119877.1|3256593_3258402_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_006119878.1|3258416_3258998_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.4	5.7e-30
WP_006119880.1|3259082_3259724_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	8.4e-35
WP_006119881.1|3260002_3260614_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_006119882.1|3260781_3264117_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_006119883.1|3266444_3267674_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006119884.1|3267673_3270796_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_006119885.1|3270792_3273870_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_006119886.1|3273882_3275283_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_006119887.1|3275279_3276668_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.8e-29
WP_006119888.1|3276674_3277382_+	two-component system response regulator BaeR	NA	A0A1J0GWE0	Alteromonas_phage	26.4	4.1e-06
WP_033740520.1|3277498_3278875_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	76.7	3.6e-168
WP_006119890.1|3279105_3280005_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.1	6.1e-15
WP_044242198.1|3280160_3281621_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	1.0e-43
WP_006119893.1|3281671_3282358_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006119895.1|3282386_3283187_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_006119896.1|3283183_3283972_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_167387059.1|3285016_3285688_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_044241253.1|3285718_3286348_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|3286344_3286692_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006119898.1|3286711_3288283_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	2.1e-175
WP_141119381.1|3290666_3291122_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	46.6	5.6e-33
WP_044242200.1|3291593_3292169_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	38.3	2.5e-22
WP_085980093.1|3292424_3293119_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	84.4	3.4e-114
WP_006119907.1|3296750_3296948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119908.1|3297039_3297999_+	AEC family transporter	NA	NA	NA	NA	NA
WP_006119910.1|3298046_3299615_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	31.2	3.3e-40
WP_006119912.1|3299687_3300251_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_006119917.1|3301039_3302152_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_006119919.1|3302325_3304359_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	6.1e-55
WP_044241399.1|3304589_3305621_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044242201.1|3305601_3306021_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_006119921.1|3306013_3306706_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 18
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3330334	3410675	4528215	head,transposase,portal,holin,capsid,tail,integrase,terminase,protease	Enterobacterial_phage(17.86%)	90	3377552:3377569	3413886:3413903
WP_006119951.1|3330334_3331264_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	3.3e-64
WP_006119952.1|3331504_3332347_+	deoxyribonuclease IV	NA	A0A2R8FEV6	Brazilian_cedratvirus	27.0	1.0e-08
WP_006119954.1|3332383_3334081_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_006119955.1|3334097_3335036_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_006119956.1|3335032_3336163_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_006119957.1|3336653_3336908_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006119958.1|3337179_3337752_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_006119959.1|3337830_3338808_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_006119960.1|3338850_3339558_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_006119961.1|3340067_3340634_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	38.3	1.6e-13
WP_006119965.1|3342446_3344255_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006119967.1|3344264_3345359_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_006119968.1|3345358_3346381_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006119969.1|3346381_3347986_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.7	2.3e-17
WP_006119970.1|3347972_3348293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119971.1|3348546_3349743_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	6.0e-26
WP_006119972.1|3349754_3350474_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_006119973.1|3350629_3352384_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	5.1e-98
WP_006119974.1|3352515_3352800_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_006119975.1|3352892_3353897_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.5	8.4e-90
WP_006119976.1|3354056_3354281_+	YejL family protein	NA	NA	NA	NA	NA
WP_006119977.1|3354303_3356058_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_082999216.1|3356299_3356623_-	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	46.7	2.9e-20
WP_082999217.1|3356624_3356864_-	DNA polymerase V	NA	NA	NA	NA	NA
WP_082999218.1|3356978_3358325_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	42.0	1.5e-89
WP_156879139.1|3358436_3358901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156879140.1|3358983_3360060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999220.1|3360059_3363236_-	host specificity protein J	NA	O64335	Escherichia_phage	69.3	0.0e+00
WP_082999221.1|3363323_3363911_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	67.5	3.3e-62
WP_082999222.1|3363925_3364351_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	32.2	1.6e-10
WP_082999223.1|3364410_3365121_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	74.9	3.0e-110
WP_082999224.1|3365123_3365879_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	79.3	1.9e-118
WP_082999225.1|3365875_3366214_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	74.1	4.1e-49
WP_082999226.1|3366217_3369637_-	tape measure protein	NA	K7PH87	Enterobacterial_phage	51.6	5.6e-218
WP_082999269.1|3369657_3369930_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	65.9	1.3e-24
WP_082999227.1|3369953_3370364_-|tail	phage tail protein	tail	F1C576	Cronobacter_phage	60.9	1.3e-33
WP_082999270.1|3370434_3370890_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	78.1	7.8e-59
WP_082999228.1|3370945_3371293_-	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	55.8	8.3e-29
WP_082999229.1|3371289_3371736_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	57.4	1.6e-40
WP_082999230.1|3371732_3372074_-|head	phage head closure protein	head	K7PLS1	Enterobacteria_phage	56.2	3.1e-28
WP_044241520.1|3372073_3372400_-|head,tail	phage head-tail connector protein	head,tail	K7P6N0	Enterobacteria_phage	50.9	4.3e-27
WP_082999232.1|3372439_3373597_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	87.5	1.3e-187
WP_082999233.1|3373598_3374276_-|head,protease	HK97 family phage prohead protease	head,protease	Q77W96	Enterobacteria_phage	88.0	1.0e-110
WP_082999234.1|3374293_3375565_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	83.7	2.2e-212
WP_082999235.1|3375564_3377079_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	92.9	4.4e-276
WP_082999236.1|3377085_3377571_-|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	90.1	1.2e-73
3377552:3377569	attL	CGGGTTCTTTTTTCTGCC	NA	NA	NA	NA
WP_006117824.1|3377732_3377927_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	60.9	5.0e-15
WP_044241347.1|3377926_3378268_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	83.9	9.6e-54
WP_006117826.1|3378264_3378795_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	73.6	4.2e-72
WP_006117827.1|3378935_3380393_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	76.1	3.5e-230
WP_044241349.1|3380395_3380962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117829.1|3381116_3381569_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	61.3	2.8e-45
WP_082999237.1|3381698_3382151_-	Rz lytic protein	NA	NA	NA	NA	NA
WP_082999238.1|3382165_3382582_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.1	4.3e-40
WP_082999239.1|3382565_3382919_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_082999240.1|3383316_3383718_-	antitermination protein	NA	B6SCY2	Bacteriophage	48.1	2.6e-26
WP_082999241.1|3383739_3384753_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	53.1	2.1e-96
WP_082999242.1|3384749_3385466_-	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	55.9	6.1e-58
WP_082999243.1|3385602_3385968_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	60.5	1.9e-36
WP_082999244.1|3385964_3387272_-	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	69.3	9.3e-97
WP_082999245.1|3387387_3387819_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_082999246.1|3387828_3388710_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	63.0	1.5e-37
WP_082999247.1|3388706_3388922_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_167387066.1|3388918_3389101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999248.1|3389468_3390005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999249.1|3390024_3390228_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	56.2	1.4e-12
WP_082999250.1|3390329_3390968_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	58.8	9.9e-52
WP_082999251.1|3391257_3391533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999252.1|3391817_3392615_+	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	57.0	7.2e-76
WP_058706728.1|3392614_3392773_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_082999253.1|3392784_3393426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999254.1|3393427_3393892_+	hypothetical protein	NA	G9L661	Escherichia_phage	78.1	7.6e-62
WP_082999272.1|3394196_3394562_+	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	52.7	8.5e-24
WP_082999255.1|3394561_3395044_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	6.9e-66
WP_082999256.1|3395036_3395381_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	71.4	7.2e-41
WP_082999258.1|3395641_3396820_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	29.2	7.0e-27
WP_006119978.1|3397170_3398412_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.7	6.5e-100
WP_100208620.1|3398591_3398780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242205.1|3398875_3399394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242207.1|3399588_3399798_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044241399.1|3399924_3400956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082999259.1|3401161_3402733_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	2.3e-174
WP_006117592.1|3402752_3403100_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3403096_3403726_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_082999260.1|3405585_3405810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999261.1|3406040_3407939_+	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	38.8	1.9e-66
WP_006119994.1|3408102_3408276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006119993.1|3408289_3409309_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	50.2	2.0e-91
WP_006119992.1|3409368_3409941_+	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	62.3	2.4e-33
WP_006119991.1|3409994_3410675_+	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	54.1	1.6e-63
3413886:3413903	attR	GGCAGAAAAAAGAACCCG	NA	NA	NA	NA
>prophage 19
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3533302	3657802	4528215	transposase,holin,capsid,tRNA,tail,integrase,terminase,plate	Salmonella_phage(31.68%)	151	3526149:3526167	3659994:3660012
3526149:3526167	attL	GATTACGGCATGATCGCCG	NA	NA	NA	NA
WP_006120076.1|3533302_3535315_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_006120077.1|3535343_3535628_-	YfcL family protein	NA	NA	NA	NA	NA
WP_006120078.1|3535660_3536203_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_006120080.1|3536222_3537026_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_044242302.1|3537034_3537856_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_006120082.1|3537857_3538943_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	1.3e-88
WP_006120083.1|3538989_3539922_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006120084.1|3540082_3540631_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_006120086.1|3540905_3542726_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.6	1.2e-14
WP_006120087.1|3542797_3543280_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_006120088.1|3543481_3545602_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_006120091.1|3547073_3547370_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_006120092.1|3547728_3549003_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_006120093.1|3549129_3549894_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_006120094.1|3550023_3551235_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_006120095.1|3551234_3551690_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_006120096.1|3551686_3552241_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_006120097.1|3552237_3554196_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_006120098.1|3554192_3554678_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_006120099.1|3554674_3554908_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_006120100.1|3554904_3555645_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_006120101.1|3555699_3556359_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_006120102.1|3556358_3556976_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.1e-10
WP_044242238.1|3557022_3557328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120103.1|3557401_3558334_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	74.9	3.5e-114
WP_006120105.1|3559647_3561219_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	2.7e-175
WP_006117592.1|3561238_3561586_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3561582_3562212_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120106.1|3562242_3562494_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	67.5	9.0e-09
WP_006120108.1|3564407_3564635_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_006120109.1|3564923_3565403_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	49.0	2.6e-36
WP_080577411.1|3565402_3566371_-|tail	tail fiber protein	tail	E5FJ29	Escherichia_phage	48.7	3.6e-29
WP_006120111.1|3566374_3566950_-	DUF2612 domain-containing protein	NA	NA	NA	NA	NA
WP_006120112.1|3566946_3568104_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	38.8	3.2e-64
WP_044242242.1|3568103_3568439_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	33.0	1.3e-10
WP_052310134.1|3568435_3569179_-	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	34.3	1.1e-25
WP_006120115.1|3569165_3570041_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	42.0	1.7e-62
WP_052310135.1|3570027_3570360_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	36.9	2.5e-14
WP_006120117.1|3570362_3571148_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.7	4.1e-23
WP_006120118.1|3571144_3572965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120120.1|3573319_3573610_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	53.5	2.6e-15
WP_080577417.1|3573627_3573900_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_006120123.1|3574561_3575098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120124.1|3575097_3575532_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	42.3	3.1e-25
WP_006120125.1|3575535_3576663_-	DUF3383 family protein	NA	A0A140XG63	Salmonella_phage	33.2	8.4e-46
WP_167387060.1|3576665_3577193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141119383.1|3577116_3577467_-	hypothetical protein	NA	M4T3S0	Psychrobacter_phage	32.9	1.3e-05
WP_006120128.1|3577463_3577982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120129.1|3578060_3578534_-	hypothetical protein	NA	A0A0A0RTG1	Escherichia_phage	36.3	1.3e-13
WP_006118957.1|3578648_3579836_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	59.9	4.7e-132
WP_006120130.1|3579880_3580834_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	69.9	8.2e-127
WP_006120131.1|3580847_3581630_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.7	2.4e-68
WP_006120132.1|3581775_3582828_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	43.1	1.0e-74
WP_006120133.1|3582811_3584224_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.5	4.8e-123
WP_044242319.1|3584223_3585531_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	4.1e-153
WP_141119384.1|3588018_3588318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120137.1|3588384_3589002_-	hypothetical protein	NA	B5WZS8	Pseudomonas_phage	47.0	9.2e-47
WP_044242321.1|3588985_3589825_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	45.6	5.1e-64
WP_141119388.1|3590715_3590892_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_044242246.1|3591060_3591399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242248.1|3591395_3591761_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_085980099.1|3591917_3592127_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	52.9	1.1e-07
WP_006120143.1|3592334_3592955_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	63.6	1.4e-66
WP_044242322.1|3592951_3593278_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	54.6	7.1e-22
WP_006120146.1|3593703_3594873_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	79.2	1.6e-188
WP_006120148.1|3595304_3596462_+|integrase	tyrosine-type recombinase/integrase	integrase	E7DYQ6	Enterobacteria_phage	78.1	5.6e-178
WP_044242253.1|3596525_3597116_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	54.1	2.0e-59
WP_006120150.1|3597115_3597901_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	50.5	1.0e-34
WP_006120152.1|3597900_3598581_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.0	3.2e-109
WP_044242255.1|3598577_3599777_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.2	2.6e-178
WP_006120155.1|3599777_3600131_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	1.9e-44
WP_006120157.1|3600359_3601100_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	67.7	6.9e-81
WP_141119385.1|3601133_3601571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242258.1|3601570_3601939_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	45.9	2.2e-19
WP_006120159.1|3601938_3603003_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.3	1.5e-137
WP_006120161.1|3603005_3603311_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.5	3.5e-23
WP_006120162.1|3603312_3603915_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	7.3e-65
WP_006120164.1|3603914_3605996_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	56.6	1.5e-205
WP_006120165.1|3606173_3606599_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	1.0e-36
WP_000257257.1|3606602_3607043_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_006120166.1|3607053_3608214_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.1	1.4e-157
WP_044242260.1|3608217_3608781_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.5	1.9e-83
WP_006120168.1|3608755_3609145_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.9	2.3e-67
WP_044242261.1|3609131_3609686_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	91.8	1.5e-88
WP_001125673.1|3609682_3610090_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	100.0	3.8e-73
WP_006120171.1|3610055_3610445_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	58.1	2.9e-30
WP_006120172.1|3610486_3611428_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.5	8.8e-174
WP_006120173.1|3611439_3611943_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	4.2e-74
WP_006120174.1|3611947_3613180_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	95.9	3.1e-219
WP_141119386.1|3613194_3613932_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.0	3.0e-108
WP_006120176.1|3613816_3615286_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	95.7	3.5e-270
WP_006120177.1|3615285_3616908_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.7	9.0e-312
WP_006120178.1|3616910_3617384_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	1.4e-50
WP_044242271.1|3617415_3618036_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	1.3e-88
WP_006120181.1|3618090_3618276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120183.1|3618419_3618812_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	75.8	1.5e-47
WP_044242272.1|3618808_3619423_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	90.7	5.5e-100
WP_044242274.1|3619419_3619752_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	55.7	1.9e-22
WP_044242275.1|3619826_3620441_-	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	49.2	7.5e-49
WP_006120186.1|3620346_3621288_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	49.5	3.2e-75
WP_044242277.1|3621281_3621833_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	48.0	2.9e-44
WP_052310139.1|3621975_3622485_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.8	2.3e-27
WP_044242279.1|3622655_3623015_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	76.3	5.7e-49
WP_085980096.1|3623011_3623302_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	85.4	1.4e-42
WP_052310137.1|3623294_3623876_-	HNH endonuclease	NA	A8YQN4	Lactobacillus_phage	35.8	1.4e-25
WP_044242283.1|3623868_3624300_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	43.7	4.1e-25
WP_006120192.1|3624536_3624875_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.7	2.2e-50
WP_052310138.1|3624994_3625738_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	50.7	1.6e-53
WP_006120194.1|3625734_3626442_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	33.2	1.5e-24
WP_006120195.1|3626438_3626606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120196.1|3626602_3626893_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	64.1	1.4e-29
WP_006120197.1|3626892_3628290_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	64.2	7.9e-171
WP_006120198.1|3628286_3629174_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	45.2	4.3e-53
WP_156879141.1|3629166_3629496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426372.1|3629643_3629964_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	88.7	2.9e-44
WP_044242285.1|3630001_3630229_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	68.1	1.9e-18
WP_044242286.1|3630349_3631063_+	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	81.9	9.5e-112
WP_044242287.1|3631091_3631289_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	52.3	1.1e-09
WP_141119387.1|3631503_3631704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044242289.1|3631703_3631895_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_006120205.1|3631906_3632497_+	hypothetical protein	NA	A0A291AXG3	Shigella_phage	32.1	1.3e-10
WP_156879142.1|3632520_3632745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120206.1|3632731_3633403_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.6	1.2e-15
WP_016243544.1|3633399_3634071_+	AAA family ATPase	NA	G9L667	Escherichia_phage	46.6	8.8e-51
WP_006120207.1|3634087_3634819_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	37.9	1.4e-25
WP_044242326.1|3634951_3635803_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	86.4	1.1e-138
WP_044242291.1|3635805_3636045_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	86.1	3.6e-31
WP_071988765.1|3636107_3636308_+	excisionase	NA	K7P7V0	Enterobacteria_phage	74.2	1.3e-23
WP_006120210.1|3636580_3637870_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.4	7.1e-73
WP_080577415.1|3638027_3638675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241399.1|3638686_3639718_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006120211.1|3640000_3641131_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.7	1.9e-69
WP_044241253.1|3641395_3642025_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|3642021_3642369_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_082999262.1|3642388_3643960_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	7.8e-175
WP_052310140.1|3644530_3645007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242359.1|3645252_3645963_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	58.2	1.1e-59
WP_044242352.1|3646033_3646267_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	60.5	6.0e-23
WP_071988771.1|3646553_3646733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120325.1|3646801_3648022_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.3	1.4e-126
WP_044242354.1|3649793_3650156_+	hypothetical protein	NA	B2ZY70	Ralstonia_phage	44.0	2.3e-13
WP_006120330.1|3650510_3650783_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_006120331.1|3650782_3651544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120333.1|3651944_3654617_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_006120334.1|3654613_3654997_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_006120335.1|3654993_3655278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120336.1|3655309_3655669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120337.1|3655661_3655838_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_014071213.1|3655969_3656149_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	4.4e-10
WP_071988772.1|3656198_3656411_-	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	49.2	9.0e-10
WP_044241399.1|3656770_3657802_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3659994:3660012	attR	CGGCGATCATGCCGTAATC	NA	NA	NA	NA
>prophage 20
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3691766	3748145	4528215	head,transposase,portal,holin,capsid,tRNA,tail,terminase,protease	Escherichia_phage(19.35%)	55	NA	NA
WP_082999263.1|3691766_3693338_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	4.6e-175
WP_006122427.1|3694478_3694805_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_080577331.1|3695524_3696493_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
WP_006120379.1|3697553_3698342_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_006120380.1|3698453_3698807_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_082999264.1|3698935_3700354_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006117791.1|3701618_3701972_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_006117792.1|3701968_3702889_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	1.2e-10
WP_006117793.1|3702984_3703992_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_006117794.1|3704035_3704254_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_006117795.1|3704255_3706274_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.0	1.2e-143
WP_006117796.1|3706341_3707340_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_006117797.1|3707558_3708326_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_006117798.1|3708467_3709436_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	48.4	3.3e-67
WP_003848868.1|3709826_3710084_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_006117799.1|3710243_3711971_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	7.9e-19
WP_006117800.1|3712013_3712514_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_006117801.1|3712564_3713914_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.8	4.5e-22
WP_006117802.1|3713910_3714591_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006117803.1|3714756_3715638_-	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	37.1	9.8e-50
WP_006117804.1|3715753_3716842_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	37.7	4.8e-30
WP_006117805.1|3716831_3717707_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_006117806.1|3717706_3718540_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_006117807.1|3718539_3719556_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006117808.1|3719763_3720384_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_006117809.1|3720447_3720909_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_006117810.1|3720898_3721324_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_006117812.1|3721533_3722379_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	M4ZRP4	Bacillus_phage	31.2	1.4e-13
WP_006117813.1|3722427_3723342_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_006117814.1|3725981_3726932_+	transaldolase	NA	A0A127KMN5	Cyanophage	34.0	1.8e-12
WP_006117815.1|3726995_3728996_+	transketolase	NA	NA	NA	NA	NA
WP_006117817.1|3729826_3731227_-	2-hydroxycarboxylate transporter family protein	NA	A0A0N7KZI9	Stx2-converting_phage	56.8	8.0e-38
WP_006117818.1|3731223_3731565_-|head	phage head closure protein	head	K7PLS1	Enterobacteria_phage	52.7	1.1e-25
WP_044241520.1|3731564_3731891_-|head,tail	phage head-tail connector protein	head,tail	K7P6N0	Enterobacteria_phage	50.9	4.3e-27
WP_044241339.1|3731930_3733088_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	87.3	6.6e-187
WP_044241341.1|3733089_3733767_-|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	88.0	1.3e-110
WP_044241343.1|3733784_3735056_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	84.0	2.2e-212
WP_006117822.1|3735055_3736579_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	71.6	4.0e-216
WP_044241345.1|3736583_3737069_-	hypothetical protein	NA	Q77WA1	Escherichia_phage	86.3	6.8e-69
WP_006117824.1|3737230_3737425_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	60.9	5.0e-15
WP_044241347.1|3737424_3737766_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	83.9	9.6e-54
WP_006117826.1|3737762_3738293_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	73.6	4.2e-72
WP_006117827.1|3738433_3739891_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	76.1	3.5e-230
WP_044241349.1|3739893_3740460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117829.1|3740614_3741067_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	61.3	2.8e-45
WP_006117830.1|3741196_3741649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117831.1|3741645_3742071_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	62.1	1.7e-39
WP_044241351.1|3742057_3742405_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_044241353.1|3742793_3743207_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	50.0	3.2e-27
WP_006117833.1|3743206_3744190_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	58.3	1.9e-110
WP_044241355.1|3744189_3745695_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	65.3	1.1e-199
WP_044241357.1|3745775_3746630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117836.1|3746747_3747089_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	49.0	1.5e-19
WP_071988723.1|3747078_3747315_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	58.3	2.9e-17
WP_044241359.1|3747416_3748145_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	59.5	2.4e-78
>prophage 21
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3751452	3853488	4528215	head,transposase,portal,capsid,tRNA,tail,integrase,terminase,plate,protease	Enterobacteria_phage(34.69%)	109	3773194:3773212	3803818:3803836
WP_006119686.1|3751452_3753024_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006117592.1|3753043_3753391_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|3753387_3754017_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117843.1|3754090_3754510_+	hypothetical protein	NA	A0A286S260	Klebsiella_phage	57.3	8.8e-41
WP_044241371.1|3754509_3755151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117845.1|3755134_3755260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117847.1|3755473_3755716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117849.1|3755854_3756058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100208602.1|3756050_3756410_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006117851.1|3756832_3757336_-	DUF1198 family protein	NA	NA	NA	NA	NA
WP_006117852.1|3757510_3758377_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.3	5.0e-30
WP_006117853.1|3758376_3758589_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_006117854.1|3758615_3759722_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	56.9	2.4e-114
WP_006117855.1|3759764_3761150_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	35.4	8.7e-45
WP_006117856.1|3761365_3761860_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_006117857.1|3761859_3762576_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_006117858.1|3762889_3763399_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006117859.1|3763395_3764460_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006117860.1|3764503_3766921_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_141119360.1|3767756_3768377_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_006117862.1|3768397_3769171_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006117864.1|3769250_3770108_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_006117865.1|3770348_3771263_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_006117866.1|3771262_3771721_+	NfeD family protein	NA	NA	NA	NA	NA
WP_006117867.1|3771696_3772113_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
3773194:3773212	attL	TTGACCTTCCCCTTGATGG	NA	NA	NA	NA
WP_006117870.1|3773270_3774293_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	54.2	4.4e-94
WP_071988725.1|3774362_3774662_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	57.6	2.3e-27
WP_044241526.1|3774900_3775239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071988726.1|3775251_3775512_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.2	5.5e-09
WP_006117873.1|3775501_3775675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117874.1|3775687_3775915_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	69.3	4.3e-26
WP_141119354.1|3776026_3776392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117875.1|3776392_3776569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241384.1|3776741_3777134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117877.1|3777203_3778058_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	66.4	2.3e-104
WP_141119355.1|3778060_3778339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156879144.1|3780898_3781237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117881.1|3781433_3781655_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_006117882.1|3781651_3782035_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	54.1	1.0e-27
WP_006117883.1|3782482_3783541_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.8	2.4e-143
WP_006117884.1|3783540_3785271_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	76.0	6.6e-268
WP_006117885.1|3785430_3786267_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.0	1.4e-101
WP_006117887.1|3786290_3787340_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.7	4.4e-105
WP_006117888.1|3787385_3788243_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	61.2	1.2e-68
WP_006117889.1|3788341_3788866_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	54.1	4.8e-44
WP_006117890.1|3788865_3789066_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	75.4	3.7e-21
WP_006117891.1|3789056_3789359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241388.1|3789342_3789888_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.7	2.6e-29
WP_006117893.1|3789884_3790322_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	35.7	1.9e-06
WP_006117894.1|3790532_3791003_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	68.0	2.9e-61
WP_006117895.1|3790995_3791634_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.1	2.7e-57
WP_006117896.1|3791630_3792206_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	67.2	5.5e-70
WP_006117897.1|3792202_3792571_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	63.5	1.8e-34
WP_006117898.1|3792557_3793454_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.5	9.8e-106
WP_006117899.1|3793446_3794061_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	5.5e-68
WP_044241392.1|3795125_3795602_+|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	51.3	4.8e-43
WP_006117901.1|3795651_3796140_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	73.5	4.1e-66
WP_006117902.1|3796154_3799121_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	52.9	1.5e-259
WP_032424037.1|3799107_3799263_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_006117903.1|3799268_3799586_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	7.6e-21
WP_006117904.1|3799634_3800150_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.7e-60
WP_044241528.1|3800150_3801332_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.4	1.0e-171
WP_006117906.1|3801485_3802622_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.5	2.1e-161
WP_064767481.1|3802661_3802910_+	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_052310103.1|3802941_3803634_-	hypothetical protein	NA	Q8H9M0	Vibrio_phage	41.9	8.5e-33
WP_006117909.1|3803902_3806419_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.0	4.7e-105
3803818:3803836	attR	TTGACCTTCCCCTTGATGG	NA	NA	NA	NA
WP_006117911.1|3806486_3807290_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_006117912.1|3807474_3807954_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_006117913.1|3807950_3808820_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006117914.1|3808906_3809338_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_006117915.1|3809374_3811141_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_006117916.1|3811857_3813552_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_006117917.1|3813619_3814921_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_006117918.1|3815289_3815934_-	adenylate kinase	NA	NA	NA	NA	NA
WP_044241395.1|3816213_3818088_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	1.7e-112
WP_006117920.1|3818186_3818792_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_006117921.1|3818791_3819121_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006117922.1|3819177_3821154_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	8.9e-43
WP_006117923.1|3821312_3821864_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.7e-28
WP_006117924.1|3822008_3822398_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_006117925.1|3822455_3822986_+	primosomal replication protein	NA	NA	NA	NA	NA
WP_006117926.1|3823062_3823218_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_006117927.1|3823214_3823853_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_006117928.1|3823995_3825198_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006117929.1|3825214_3828373_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_006117930.1|3828922_3829177_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006117931.1|3829188_3829329_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006117932.1|3829386_3830265_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006117933.1|3830277_3831117_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_006117934.1|3831113_3831782_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	23.0	3.9e-06
WP_006117936.1|3832132_3832474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117937.1|3832634_3833666_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006117939.1|3833786_3834164_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_006117940.1|3834188_3834404_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_044241399.1|3835134_3836166_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006117943.1|3836331_3836889_-	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_006117944.1|3837081_3837945_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_006117945.1|3837993_3839280_-	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_003850469.1|3839313_3839652_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_006117947.1|3839909_3841685_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	8.6e-45
WP_006117948.1|3841677_3843447_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	2.6e-49
WP_006117950.1|3844231_3845266_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_006117951.1|3845374_3846070_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	69.8	3.2e-88
WP_071988727.1|3846106_3846589_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_006117954.1|3846606_3846930_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006117955.1|3847068_3848937_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006117956.1|3849187_3849460_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	58.4	1.1e-20
WP_006117957.1|3849675_3852030_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	8.5e-226
WP_006117958.1|3852216_3853488_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.0	1.2e-130
>prophage 22
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	3945726	4045701	4528215	transposase,capsid,tail,terminase,plate,protease	Pseudomonas_phage(22.22%)	95	NA	NA
WP_006118051.1|3945726_3947298_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_006118052.1|3947402_3948860_-	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_006118053.1|3949112_3949571_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006118054.1|3949686_3950940_+	esterase FrsA	NA	NA	NA	NA	NA
WP_006118055.1|3951059_3951461_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_006118056.1|3951651_3952791_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.5	1.0e-107
WP_006118057.1|3953141_3954245_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.0	1.2e-60
WP_006118058.1|3954254_3955508_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.8	1.5e-91
WP_006118059.1|3955868_3956600_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	35.6	2.5e-43
WP_006118060.1|3957019_3957298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118062.1|3957948_3958296_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	42.9	7.1e-20
WP_006118063.1|3958292_3958586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118064.1|3958785_3960534_+	virulence factor	NA	A0A1S6L3G8	Erwinia_phage	48.0	3.9e-159
WP_006118065.1|3963978_3965076_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_006118066.1|3965662_3966733_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_006118067.1|3966743_3967376_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_006118068.1|3967386_3968808_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_006118069.1|3969247_3970912_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_044241424.1|3977273_3978074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071988719.1|3978169_3979201_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_100208599.1|3980783_3984866_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_044241399.1|3984877_3985909_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044241431.1|3986594_3987098_+	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_006117937.1|3987122_3988154_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006118070.1|3988382_3988532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118071.1|3988685_3989567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006118072.1|3989667_3990456_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006118073.1|3990721_3990934_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	9.3e-23
WP_006118075.1|3991405_3992368_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.4	8.0e-29
WP_006118076.1|3992529_3992922_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_006118077.1|3992955_3994335_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.8	3.4e-57
WP_033738594.1|3994735_3994951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241546.1|3995069_3995930_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006118079.1|3996016_3997180_+	cyanate transporter	NA	NA	NA	NA	NA
WP_006118080.1|3997399_3999046_+	L-lactate permease	NA	NA	NA	NA	NA
WP_006118081.1|3999042_3999813_+	transcriptional regulator LldR	NA	NA	NA	NA	NA
WP_006118082.1|3999812_4001000_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_006118083.1|4001045_4001474_+	OsmC family protein	NA	NA	NA	NA	NA
WP_006118085.1|4001778_4002009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118086.1|4002116_4002287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118087.1|4002688_4002997_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_052310106.1|4004573_4005152_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	56.6	1.3e-39
WP_006118089.1|4005304_4005553_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	70.7	1.1e-27
WP_006118090.1|4005555_4007592_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	44.6	2.7e-159
WP_006118091.1|4007604_4008531_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	52.6	8.1e-71
WP_006118093.1|4008719_4009214_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_006118094.1|4009216_4009447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118095.1|4009731_4009962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118096.1|4009939_4010146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241439.1|4010138_4010387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118097.1|4010373_4010961_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	63.3	7.2e-65
WP_052310107.1|4011183_4011561_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044241253.1|4011591_4012221_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|4012217_4012565_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118098.1|4012584_4014156_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.5e-173
WP_006118100.1|4014752_4015067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241441.1|4015335_4015866_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_141119357.1|4015846_4016137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118103.1|4016301_4016700_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	46.1	1.0e-22
WP_006118104.1|4016699_4017146_+	hypothetical protein	NA	B7SDY2	Pseudomonas_virus	31.5	2.3e-15
WP_044241443.1|4017241_4017691_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	57.2	2.1e-40
WP_006118106.1|4017687_4017894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118107.1|4017893_4018190_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_006118108.1|4018170_4018632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141119358.1|4018639_4018828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118110.1|4018829_4019090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118111.1|4019089_4019311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118112.1|4019311_4019815_+	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	52.4	5.2e-40
WP_006118113.1|4019804_4020224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118114.1|4020261_4020771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118115.1|4020845_4022519_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	62.9	1.9e-195
WP_006118116.1|4022521_4024102_+	DUF935 domain-containing protein	NA	A0A076FX05	Pseudomonas_phage	46.3	2.2e-129
WP_006118117.1|4024094_4025339_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	42.3	9.9e-64
WP_006118118.1|4025338_4025674_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_006118119.1|4025667_4027218_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_006118120.1|4027214_4028552_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	27.5	4.6e-27
WP_006118121.1|4028559_4029672_+	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	42.9	6.9e-77
WP_100208600.1|4029668_4030337_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	47.3	1.4e-37
WP_044241446.1|4030481_4030829_+	phage GP46 family protein	NA	F6MIL5	Haemophilus_phage	40.0	6.4e-13
WP_006118124.1|4030830_4031913_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	42.3	1.8e-61
WP_006118125.1|4031917_4032403_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_006118126.1|4032453_4033488_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	58.8	1.2e-30
WP_006118127.1|4033487_4034081_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	46.2	6.6e-42
WP_006118128.1|4034468_4034861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118132.1|4036925_4037162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118134.1|4037493_4037808_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_006118135.1|4037820_4039251_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.4e-45
WP_044241447.1|4039276_4040290_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006118137.1|4040381_4041029_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006118138.1|4041510_4041807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118139.1|4042015_4042336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118140.1|4042348_4042600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|4043136_4043766_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|4043762_4044110_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006117714.1|4044129_4045701_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
>prophage 23
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	4141954	4148796	4528215	integrase	Erwinia_phage(66.67%)	7	4140221:4140234	4158620:4158633
4140221:4140234	attL	GCCAGTACGTGCTG	NA	NA	NA	NA
WP_006118218.1|4141954_4142935_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	69.1	3.4e-128
WP_006118219.1|4142972_4143326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118222.1|4145269_4145497_-	TraR/DksA C4-type zinc finger protein	NA	F1BUS2	Erwinia_phage	51.4	1.3e-14
WP_080577323.1|4145496_4145742_-	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	51.4	1.3e-07
WP_006118224.1|4145781_4146150_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	72.2	3.0e-37
WP_006118225.1|4146576_4147161_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	39.7	3.2e-33
WP_006118226.1|4147251_4148796_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	2.3e-14
4158620:4158633	attR	GCCAGTACGTGCTG	NA	NA	NA	NA
>prophage 24
NZ_CP017581	Pantoea stewartii subsp. stewartii DC283 chromosome, complete genome	4528215	4292810	4357866	4528215	tRNA,transposase,protease	uncultured_Caudovirales_phage(23.08%)	58	NA	NA
WP_006118343.1|4292810_4294151_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_006118344.1|4294264_4294810_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_006118345.1|4296418_4297426_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.9	5.7e-70
WP_006118346.1|4297462_4299022_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.6	2.4e-11
WP_080577331.1|4299208_4300177_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
WP_006118348.1|4300264_4300633_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_006118349.1|4300733_4301183_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_006118350.1|4301283_4301814_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.1	4.2e-56
WP_006118351.1|4301887_4302241_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_006118352.1|4302243_4306011_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_006118353.1|4306007_4307747_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_006118354.1|4308236_4309556_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003855513.1|4309588_4309795_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_006118355.1|4310104_4310668_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_006118356.1|4310705_4311449_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_006118357.1|4311743_4313684_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_006118358.1|4313718_4314339_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_006118359.1|4314559_4315225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006118361.1|4315328_4316900_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	2.3e-174
WP_006117592.1|4316919_4317267_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|4317263_4317893_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120924.1|4318145_4318295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120926.1|4318291_4318741_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4318780_4319008_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_006120927.1|4319012_4319330_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_006120928.1|4319336_4319732_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_006120929.1|4319993_4320743_-	esterase	NA	NA	NA	NA	NA
WP_006120930.1|4320897_4322829_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	6.1e-12
WP_006120931.1|4322886_4323213_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_006120932.1|4323186_4324818_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_006120933.1|4324903_4325638_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_006120935.1|4325704_4328140_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.2e-67
WP_006120936.1|4328156_4328600_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_006120937.1|4328822_4330121_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.9	1.8e-63
WP_006120939.1|4330287_4330488_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_006120940.1|4330543_4331548_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006120941.1|4331551_4332784_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006120942.1|4332961_4334242_-	GTPase HflX	NA	NA	NA	NA	NA
WP_006120943.1|4334317_4334632_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_006120944.1|4334736_4335687_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_006120945.1|4335679_4337524_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.3	5.6e-55
WP_006120946.1|4337573_4339250_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	29.0	3.0e-23
WP_006120947.1|4339246_4339723_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_006120949.1|4339719_4341240_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_006120950.1|4341238_4342378_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_006120954.1|4343153_4343702_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.4	1.8e-30
WP_006120956.1|4343801_4344851_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_006120957.1|4344943_4345840_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006120960.1|4345851_4349190_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_006120961.1|4349327_4350266_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_006120962.1|4350793_4351264_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_006120963.1|4351749_4352013_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_006120964.1|4352086_4352359_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_006120965.1|4352453_4352717_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_006120969.1|4353949_4354882_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_006120970.1|4354889_4355093_-	AaeX family protein	NA	NA	NA	NA	NA
WP_006120971.1|4355322_4356240_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_006120972.1|4356420_4357866_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 1
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	0	2758	47481		Ralstonia_phage(100.0%)	3	NA	NA
WP_100208627.1|300_900_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_052310142.1|1161_1965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120542.1|2113_2758_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	31.0	2.6e-07
>prophage 2
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	10114	14137	47481		Dishui_lake_phycodnavirus(33.33%)	4	NA	NA
WP_006120550.1|10114_12505_-	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	30.7	2.8e-38
WP_006120551.1|12533_13109_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	53.5	1.4e-44
WP_082999273.1|13266_13449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082999278.1|13576_14137_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.4	1.3e-18
>prophage 3
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	17574	18516	47481	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_006118556.1|17574_18516_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.0	4.4e-72
>prophage 4
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	22207	28221	47481	transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_044241689.1|22207_22522_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	39.3	4.1e-11
WP_006117592.1|22518_22866_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118549.1|22885_24421_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.8	8.2e-169
WP_044241685.1|25210_25894_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006118548.1|26071_26866_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	31.9	2.3e-10
WP_141119363.1|26852_27104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241682.1|27246_28221_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.3	1.2e-08
>prophage 5
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	34947	37205	47481		Vibrio_phage(100.0%)	3	NA	NA
WP_044241698.1|34947_35139_-	hypothetical protein	NA	A0A2I7QQE5	Vibrio_phage	55.0	3.8e-07
WP_014014959.1|35838_36624_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_006118534.1|36653_37205_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	61.6	7.2e-51
>prophage 6
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	40432	42940	47481		Stx2-converting_phage(66.67%)	5	NA	NA
WP_006118530.1|40432_40618_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
WP_044241676.1|40902_41211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241673.1|41243_41552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|41966_42596_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006118527.1|42592_42940_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.4e-44
>prophage 7
NZ_CP017587	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence	47481	46718	47066	47481		Stx2-converting_phage(100.0%)	1	NA	NA
WP_006119137.1|46718_47066_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	69.2	1.5e-41
>prophage 1
NZ_CP017588	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ07, complete sequence	65483	13563	21816	65483	transposase	Stx2-converting_phage(71.43%)	8	NA	NA
WP_006122358.1|13563_13911_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	2.7e-43
WP_006119686.1|13930_15502_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_044243452.1|15494_16517_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006117591.1|16831_18403_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	1.7e-174
WP_006117592.1|18422_18770_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|18766_19396_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_044242367.1|19510_21130_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	25.1	1.5e-11
WP_006120386.1|21201_21816_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	44.3	1.7e-37
>prophage 1
NZ_CP017590	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ09, complete sequence	132938	1236	72790	132938	transposase,integrase,holin	Stx2-converting_phage(55.17%)	57	4894:4953	26089:26261
WP_006117714.1|1236_2808_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_141119394.1|3355_3751_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_006120875.1|3695_4622_-	hypothetical protein	NA	NA	NA	NA	NA
4894:4953	attL	GGCTTTGTTGAATAATAGGTAATCATTCTGTTTTGTCTGCACTGTTTTGGTAGAAAACGC	NA	NA	NA	NA
WP_006120876.1|5055_6078_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006117714.1|6283_7855_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_006117592.1|7874_8222_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_044241253.1|8218_8848_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120879.1|9123_10491_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.5e-28
WP_044241265.1|10551_10881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120880.1|10928_11396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120881.1|11771_11975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044242597.1|12003_12267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120883.1|12270_12936_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_080577432.1|12938_13910_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	3.1e-73
WP_006120886.1|14141_14573_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_006120887.1|14572_15844_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.6	6.0e-149
WP_082999281.1|16288_17044_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	93.6	3.6e-133
WP_044242602.1|18927_19554_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.6	1.7e-16
WP_044242605.1|19550_19856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120890.1|19896_20682_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	3.0e-50
WP_006120891.1|20729_21212_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_006120893.1|21586_21895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120894.1|22144_23716_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.1e-175
WP_006117600.1|23735_24083_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	1.6e-43
WP_044241253.1|24079_24709_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006120896.1|25133_25430_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006120897.1|25416_25683_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_080577434.1|25609_26101_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	92.1	9.0e-53
WP_006120905.1|31206_34893_-	RHS repeat protein	NA	A0A1W5K0N1	Bacteriophage	41.8	5.8e-245
26089:26261	attR	GGCTTTGTTGAATAATAGGTAATCATTCTGTTTTGTCTGCACTGTTTTGGTAGAAAACGCTGATGCCAGACAGAACACCGTCATACGCAAGCATGTAATGCATTGATTTTATGTTATCTGAAACAACCGTTTTCATAGTACCACAGCATAAAATCCATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_006120906.1|35171_38564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006120907.1|38610_39054_-	lysozyme	NA	A0A2I7S753	Vibrio_phage	64.4	8.4e-42
WP_044242610.1|39050_39323_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_044242612.1|39315_39639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|40605_41235_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|41231_41579_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006120745.1|41598_43170_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_044242615.1|43618_43933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052310146.1|43993_44455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999282.1|46340_46874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006120918.1|46902_47691_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_006120919.1|48279_49293_+	replication initiation protein	NA	NA	NA	NA	NA
WP_006122256.1|51351_54399_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_044243369.1|54548_55133_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	41.3	7.0e-28
WP_006122254.1|55326_56088_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	26.8	5.5e-09
WP_044243367.1|56101_56854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|57195_57825_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|57821_58169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006120105.1|58188_59760_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	2.7e-175
WP_085980116.1|61111_61918_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_006122298.1|62224_62389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006122297.1|62429_62744_-	CcdB family protein	NA	NA	NA	NA	NA
WP_025861853.1|62746_62983_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_006122295.1|63123_63693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006117591.1|64894_66466_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	1.7e-174
WP_006118527.1|66485_66833_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.4e-44
WP_044241253.1|66829_67459_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006122290.1|71779_72790_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.7	9.3e-20
>prophage 1
NZ_CP017591	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence	304641	82016	149891	304641	integrase,transposase	Stx2-converting_phage(27.27%)	60	81611:81670	158851:159025
81611:81670	attL	GGCTTTGTTGAATAATAGGTAATCATTCTGTTTTGTCTGCACTGTTTTGGTAGAAAACGC	NA	NA	NA	NA
WP_044241399.1|82016_83048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006121927.1|84441_85377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006121928.1|85437_86004_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	35.0	1.6e-16
WP_006121929.1|86093_86324_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_006121930.1|86327_86828_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006121931.1|86920_87706_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006121932.1|88007_89402_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	29.7	4.5e-41
WP_006121933.1|89414_91268_-	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
WP_044241253.1|91755_92385_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|92381_92729_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006117714.1|92748_94320_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.3	3.0e-174
WP_080577490.1|94240_94915_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_006121939.1|95081_96431_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_006121940.1|96854_97397_-	chorismate mutase	NA	NA	NA	NA	NA
WP_006121941.1|97984_99856_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	1.5e-15
WP_006121942.1|100042_100420_-	4-amino-4-deoxy-L-arabinose-phospho-UDP flippase subunit F	NA	NA	NA	NA	NA
WP_006121943.1|100416_100740_-	EamA family transporter	NA	NA	NA	NA	NA
WP_006121944.1|100742_102401_-	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_006121945.1|102406_103300_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_006121946.1|103296_105279_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.6	6.7e-22
WP_006121947.1|105278_106259_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	30.9	4.9e-34
WP_006121948.1|106259_107396_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.5	4.1e-32
WP_044243068.1|107924_108311_+	VOC family protein	NA	NA	NA	NA	NA
WP_006121950.1|108318_108630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006121951.1|108805_109090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006121952.1|109725_110418_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	8.5e-25
WP_006121954.1|110414_111602_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	2.1e-18
WP_006121955.1|111719_112853_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006121956.1|112849_115924_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_006121957.1|116176_117835_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	8.9e-12
WP_044243074.1|118147_118492_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_006121959.1|118496_119402_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006117937.1|119637_120669_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006121960.1|120725_121610_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156879149.1|121703_121856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110268492.1|122206_122302_+	protein MgtR	NA	NA	NA	NA	NA
WP_006121962.1|122686_123724_+	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	28.8	2.6e-17
WP_006121963.1|123762_125235_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	4.8e-41
WP_006121964.1|126086_127073_-	D-threonate 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006121965.1|127576_128722_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_006121966.1|128744_129626_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_006121967.1|129703_131125_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_006121968.1|131126_132284_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_006121969.1|132288_132759_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_006121971.1|132760_133441_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006118957.1|133643_134831_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	59.9	4.7e-132
WP_006121972.1|134875_135277_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006121973.1|136373_137081_-	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	44.1	1.2e-37
WP_006121974.1|137510_137945_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	31.8	2.0e-08
WP_006121975.1|138031_138505_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006121976.1|138720_139137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071988805.1|139707_140277_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	1.9e-17
WP_006117592.1|140273_140621_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006118619.1|140640_142212_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.2	1.9e-173
WP_006121980.1|144111_144450_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006121982.1|144800_145115_-	YebG family protein	NA	NA	NA	NA	NA
WP_006121983.1|145228_146023_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_006121984.1|146019_146580_-	hypothetical protein	NA	A0A1V0SHD8	Hokovirus	35.7	4.2e-22
WP_006121986.1|148355_148751_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_039339626.1|148811_149891_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	24.6	1.5e-20
158851:159025	attR	GGCTTTGTTGAATAATAGGTAATCATTCTGTTTTGTCTGCACTGTTTTGGTAGAAAACGCTGATGCCAGACAGAACACCGTCATACGCAAGCATGTAATGCATTGATTTTATGTTATCTGAAACAACCGTTTTCATAGTACCACAGCATAAAATCCATTTATTCAACAAAGCCAT	NA	NA	NA	NA
>prophage 2
NZ_CP017591	Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence	304641	244379	301011	304641	transposase	Stx2-converting_phage(58.33%)	43	NA	NA
WP_006122073.1|244379_245336_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	6.4e-71
WP_006122074.1|245604_247254_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_006122075.1|247328_247616_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_006122076.1|247801_249268_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_039339318.1|249282_250665_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	1.3e-27
WP_006122078.1|251128_251713_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006122079.1|253002_253506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100208645.1|253521_255657_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_006122081.1|255906_257451_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.6	1.8e-14
WP_006122082.1|257501_258242_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_006122083.1|258562_259666_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	1.5e-26
WP_033742273.1|260975_261887_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_006122087.1|261883_262702_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_006122088.1|262712_263108_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_006117937.1|263190_264222_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085980110.1|264305_264860_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_006122090.1|264883_266119_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006122091.1|266214_266907_+	aspartate/glutamate racemase	NA	NA	NA	NA	NA
WP_006122092.1|266951_267308_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_044241253.1|267452_268082_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|268078_268426_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006120745.1|268445_270017_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_044243100.1|271590_271812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141119410.1|272211_272616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122093.1|273695_273854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122094.1|273862_274414_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_085980112.1|274533_275268_+	phytochelatin synthase family protein	NA	NA	NA	NA	NA
WP_006122098.1|277532_278243_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_141119411.1|278242_278680_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_141119412.1|278711_279011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122099.1|279137_279644_-	MFS transporter	NA	NA	NA	NA	NA
WP_006122100.1|279624_280863_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_044243116.1|280859_281183_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_044243118.1|281352_281724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044243120.1|282305_282914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082999283.1|288601_289570_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	90.1	1.8e-169
WP_006122104.1|289764_290175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122105.1|290272_291184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044241253.1|293414_294044_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.0e-17
WP_006117592.1|294040_294388_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.1e-44
WP_006120745.1|294407_295979_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	2.7e-175
WP_082999284.1|297789_298323_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006122232.1|300702_301011_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.8	2.0e-05
>prophage 1
NZ_CP017592	Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence	47186	318	17618	47186	lysis	Escherichia_phage(23.08%)	21	NA	NA
WP_006122363.1|318_2223_+	Gp29 protelomerase	NA	Q37967	Escherichia_phage	63.2	2.4e-210
WP_044243583.1|2260_2641_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	46.7	1.1e-21
WP_006122366.1|3818_7817_-	replication origin-binding protein	NA	Q7Y3X9	Yersinia_phage	43.4	8.3e-298
WP_006122367.1|8095_8740_-	helix-turn-helix transcriptional regulator	NA	Q7Y3X6	Yersinia_phage	39.8	3.4e-36
WP_006122368.1|8869_9088_+	Cro repressor	NA	M4R204	Salicola_phage	47.5	3.9e-08
WP_006122369.1|9087_9765_+	antiterminator Q	NA	Q7Y3X2	Yersinia_phage	37.7	6.8e-35
WP_052310172.1|9799_10003_+	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	43.4	1.2e-06
WP_141119426.1|10042_10261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080577527.1|10265_11207_+	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_006122372.1|11656_11857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122373.1|11911_12196_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	54.8	9.5e-23
WP_044243597.1|12192_12501_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	68.3	1.6e-31
WP_006122375.1|12671_12893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141119427.1|12917_13223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044243599.1|13309_13888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122378.1|14089_14479_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_006122379.1|14526_14814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044243601.1|15028_16111_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	68.1	6.7e-117
WP_006122382.1|16347_16572_+|lysis	lysis protein S	lysis	H9C183	Pectobacterium_phage	63.3	1.2e-09
WP_006122383.1|16602_17076_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	56.3	9.3e-47
WP_006122384.1|17072_17618_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	37.8	2.9e-20
>prophage 2
NZ_CP017592	Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence	47186	31940	46644	47186	plate,tail	Shigella_phage(15.38%)	17	NA	NA
WP_006122410.1|31940_32213_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	51.1	2.3e-05
WP_006122411.1|32212_33706_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	45.6	1.3e-107
WP_006122412.1|33717_34086_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_006122413.1|34089_34632_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_006122414.1|34752_36597_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	25.2	3.9e-08
WP_006122415.1|36660_38067_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	27.5	1.2e-25
WP_006122417.1|38063_39134_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	31.8	5.7e-44
WP_100208655.1|39166_39715_+|plate	phage baseplate assembly protein V	plate	A0A077KAY0	Edwardsiella_phage	40.4	6.6e-12
WP_006122419.1|39711_40146_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	40.3	2.2e-18
WP_006122420.1|40149_41301_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.6	3.2e-32
WP_006122421.1|41342_41906_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	34.4	4.1e-25
WP_006122422.1|41916_42147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006122423.1|42190_43117_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	59.6	3.3e-24
WP_006122424.1|43116_43719_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	40.5	4.3e-33
WP_044243610.1|43738_44011_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006122425.1|44440_45469_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	52.1	5.1e-82
WP_006122426.1|45468_46644_-	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	68.8	4.4e-154
