The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	381	34331	4666454	integrase	Paenibacillus_phage(90.24%)	50	13714:13748	42218:42252
WP_083037927.1|381_786_-	hypothetical protein	NA	A0A0N9RRE8	Paenibacillus_phage	90.4	3.9e-62
WP_083037929.1|853_1087_-	hypothetical protein	NA	A0A0N9SJZ3	Paenibacillus_phage	96.1	3.4e-34
WP_158530229.1|1486_1633_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	79.1	3.9e-12
WP_083037931.1|1622_2021_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	96.7	4.7e-60
WP_083037933.1|3294_4386_-	SAM-dependent DNA methyltransferase	NA	A0A0N9ST12	Paenibacillus_phage	88.7	5.0e-197
WP_158530230.1|4697_4970_+	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	94.4	4.8e-48
WP_083037937.1|5469_6606_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.4	4.0e-64
WP_158530231.1|6845_7007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037939.1|7003_7471_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	83.6	3.1e-71
WP_083037943.1|7783_8173_-	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	92.9	1.9e-66
WP_083037945.1|8186_8513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119115.1|8513_8708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119116.1|8707_9046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037947.1|9208_9409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037949.1|9405_9702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037958.1|9694_10207_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.6	1.3e-38
WP_083037960.1|10218_10479_-	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.8	2.2e-10
WP_083037964.1|11004_11511_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	54.8	9.9e-39
WP_083037966.1|11632_12280_-	hypothetical protein	NA	A0A0E3X9K0	Bacillus_phage	66.5	1.3e-80
13714:13748	attL	TATTGTTAAGTTGGCGAACCCACGGGATAACACCG	NA	NA	NA	NA
WP_083037968.1|14573_14759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037970.1|14755_15289_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	84.2	9.8e-29
WP_083037972.1|15263_16283_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	85.3	1.0e-143
WP_083037974.1|16267_16882_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	91.2	1.4e-98
WP_158530232.1|16882_18016_-	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	71.4	4.1e-157
WP_083041500.1|18015_19671_-	hypothetical protein	NA	A0A0N9S7Z3	Paenibacillus_phage	90.3	2.0e-298
WP_083037978.1|19812_20592_-	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	47.9	9.5e-57
WP_083037979.1|20800_21214_-	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	91.2	9.8e-69
WP_083037982.1|21372_21579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037984.1|21591_22329_-	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	97.6	1.2e-136
WP_083037986.1|22413_22941_-	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	92.6	5.4e-80
WP_083037988.1|23006_23570_-	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	96.8	1.1e-86
WP_083037990.1|23622_24573_-	hypothetical protein	NA	A0A0N9S7Y2	Paenibacillus_phage	88.0	2.7e-162
WP_083037992.1|24588_25965_-	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	86.2	1.9e-225
WP_083037994.1|25961_26732_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	93.4	1.5e-139
WP_083038001.1|26739_27006_-	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	89.8	9.5e-41
WP_083038003.1|27016_27541_-	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	97.7	5.7e-90
WP_083038005.1|27553_28420_-	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	96.8	2.7e-137
WP_083038007.1|28434_28851_-	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	93.3	2.6e-61
WP_083038010.1|28786_29164_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	70.1	6.7e-40
WP_083038012.1|29221_29620_-	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	69.7	3.3e-45
WP_083038014.1|29650_29899_-	hypothetical protein	NA	A0A0N9RTL0	Paenibacillus_phage	95.1	8.5e-44
WP_083038016.1|30066_30393_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	93.5	1.5e-51
WP_083038018.1|30408_30711_-	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	7.7e-47
WP_158530233.1|30707_30881_-	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.2e-20
WP_155116369.1|30877_31054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038020.1|31433_31733_-	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	68.7	1.7e-30
WP_083038022.1|31753_31981_-	hypothetical protein	NA	A0A0C5AN65	Paenibacillus_phage	75.7	1.5e-23
WP_083038024.1|32046_32247_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
WP_083038026.1|32383_33082_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	3.6e-47
WP_083038028.1|33107_34331_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	85.5	2.1e-199
42218:42252	attR	TATTGTTAAGTTGGCGAACCCACGGGATAACACCG	NA	NA	NA	NA
>prophage 2
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	101443	188499	4666454	head,terminase,portal,integrase,transposase,bacteriocin,tRNA,tail,capsid	Paenibacillus_phage(47.54%)	111	139657:139673	188607:188623
WP_083038087.1|101443_101629_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_083038088.1|101753_103442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997460.1|103381_104182_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	4.2e-23
WP_024093949.1|104182_104377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530236.1|104358_104733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038092.1|106257_107190_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_083038094.1|107417_108116_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083038096.1|108494_109541_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_083038098.1|109543_111070_-	spore germination protein	NA	NA	NA	NA	NA
WP_079940618.1|111084_112215_-	endospore germination permease	NA	NA	NA	NA	NA
WP_083038100.1|112334_113792_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	1.7e-123
WP_077997450.1|113887_114301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038102.1|114492_115944_-	amino acid permease	NA	NA	NA	NA	NA
WP_158530237.1|116020_116176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093941.1|116872_118162_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
WP_077997449.1|118720_120352_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_024093940.1|120468_120921_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_077997447.1|120940_121558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530507.1|123781_126526_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_083038106.1|127079_127682_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_024093934.1|127896_128193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530238.1|128504_129161_-	amino acid permease	NA	NA	NA	NA	NA
WP_158530239.1|129073_129925_-	amino acid permease	NA	NA	NA	NA	NA
WP_083038116.1|130120_131962_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	26.0	2.0e-36
WP_024093930.1|133711_134257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023485097.1|134439_136056_-	MFS transporter	NA	NA	NA	NA	NA
WP_079940614.1|136099_136999_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093927.1|137295_137439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038118.1|137643_138168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654361.1|138406_138607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485094.1|138619_139036_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_079940611.1|139131_139386_+	hypothetical protein	NA	NA	NA	NA	NA
139657:139673	attL	GCCCCCTACCCTGTCTA	NA	NA	NA	NA
WP_083038119.1|139916_140513_+	DUF4352 domain-containing protein	NA	A0A0K2CYG1	Paenibacillus_phage	86.8	6.4e-61
WP_158530240.1|141282_141444_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	84.0	1.8e-15
WP_083038121.1|141476_141719_-|transposase	transposase	transposase	A0A0C5AN23	Paenibacillus_phage	88.8	1.2e-31
WP_083038123.1|141733_142012_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	89.2	3.3e-44
WP_083041503.1|142008_142683_-	hypothetical protein	NA	A0A0C5AEW3	Paenibacillus_phage	93.7	2.6e-127
WP_024094415.1|142682_142922_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_158530241.1|142957_143116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038125.1|143108_143504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038127.1|143516_144872_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	39.4	3.6e-11
WP_083038128.1|144875_145154_-	ketopantoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_083038130.1|145150_145735_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	44.9	4.8e-37
WP_083038131.1|146794_147205_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.7e-28
WP_083038133.1|147207_147450_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	36.8	2.2e-12
WP_083038135.1|147449_148433_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.5	3.1e-105
WP_083038137.1|148437_149076_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.9	4.4e-52
WP_083038139.1|149072_151178_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.3	1.5e-144
WP_023485206.1|151400_151826_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_083038141.1|151855_152320_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.1	1.9e-52
WP_083038143.1|152321_153653_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	49.3	1.8e-116
WP_083038145.1|153653_153836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038146.1|153828_154239_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	50.0	5.6e-32
WP_083038148.1|154235_154649_-	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.9	9.6e-40
WP_083041504.1|154648_154969_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.9e-28
WP_083038149.1|155009_155381_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	61.3	4.6e-33
WP_083038151.1|155407_155647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038153.1|155658_156705_-|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	86.1	2.0e-171
WP_083038154.1|156720_157080_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	1.2e-43
WP_083038156.1|157092_157716_-	hypothetical protein	NA	S5M9M5	Brevibacillus_phage	69.2	1.2e-70
WP_083038158.1|157760_158780_-|head	phage head morphogenesis protein	head	S5MTV5	Brevibacillus_phage	55.2	1.6e-104
WP_158530242.1|158776_160249_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	60.7	5.3e-165
WP_083038160.1|160262_161534_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.7	6.6e-164
WP_083038162.1|161526_162270_-	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	53.4	1.9e-54
WP_083038164.1|162535_162835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038166.1|163360_163573_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	87.0	2.3e-29
WP_083038169.1|163984_165280_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083038171.1|165433_165784_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	4.7e-56
WP_083041506.1|166385_166823_-	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	91.7	2.0e-67
WP_158530243.1|166854_167007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038173.1|166975_167518_-	hypothetical protein	NA	A0A2I7SCB6	Paenibacillus_phage	80.6	1.1e-43
WP_083038181.1|167679_167871_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	84.3	1.5e-19
WP_158530244.1|167883_168042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038183.1|168038_168248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038185.1|168472_168700_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	56.2	2.0e-15
WP_158530245.1|168716_168875_-	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	74.4	7.1e-12
WP_083038187.1|168871_169192_-	hypothetical protein	NA	A0A2I7SCA0	Paenibacillus_phage	88.2	4.0e-46
WP_083038189.1|169196_169412_-	hypothetical protein	NA	A0A0K2CY28	Paenibacillus_phage	85.9	6.5e-32
WP_158530246.1|169408_169834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530247.1|169788_170145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530248.1|170188_170353_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	81.8	4.2e-15
WP_083038192.1|170368_170488_-	hypothetical protein	NA	A0A2H4J260	uncultured_Caudovirales_phage	61.5	2.6e-06
WP_083038194.1|170622_171723_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.3	4.8e-163
WP_083038200.1|172695_172962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038202.1|172965_173334_-	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	49.6	1.1e-23
WP_083038204.1|173524_173899_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	64.5	1.1e-42
WP_083038206.1|173900_174110_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	70.6	2.8e-24
WP_083038208.1|174102_175032_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	36.7	2.9e-28
WP_083038211.1|174883_175783_-	DUF4373 domain-containing protein	NA	A0A2H4J4T0	uncultured_Caudovirales_phage	65.8	6.1e-23
WP_083038213.1|176138_176546_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	76.5	5.3e-51
WP_158530249.1|178341_178509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038223.1|178801_179146_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.9	3.9e-55
WP_083038231.1|179231_179975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530250.1|179907_180141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038233.1|180192_180384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530251.1|180346_180604_-	hypothetical protein	NA	A0A0N9RRC2	Paenibacillus_phage	51.2	1.0e-07
WP_083038235.1|180708_181464_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	88.4	3.9e-124
WP_158530252.1|181489_181654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038237.1|181683_181926_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	46.9	1.5e-13
WP_083038239.1|181997_182225_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	86.7	9.3e-29
WP_083038241.1|182217_182592_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.3	1.1e-55
WP_083038243.1|182746_183007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038245.1|182983_183247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038246.1|183252_183537_-	hypothetical protein	NA	R9VWW1	Paenibacillus_phage	71.3	1.9e-26
WP_083038248.1|183585_183879_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	89.5	6.1e-41
WP_083038250.1|183875_184616_-	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	95.5	1.5e-131
WP_083038252.1|184633_185263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940401.1|185419_185611_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083038254.1|185736_186153_+	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	77.2	1.3e-44
WP_083038256.1|186106_187162_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	30.4	1.6e-06
WP_083038258.1|187257_188499_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	98.3	2.5e-237
188607:188623	attR	GCCCCCTACCCTGTCTA	NA	NA	NA	NA
>prophage 3
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	320902	363670	4666454	integrase,tRNA,coat,transposase	Paenibacillus_phage(33.33%)	31	317195:317211	351854:351870
317195:317211	attL	AAATTAGAATTCGGAAT	NA	NA	NA	NA
WP_158530261.1|320902_321621_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.4	3.2e-59
WP_083038375.1|322874_326315_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_083038377.1|326591_327134_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023484143.1|327239_328034_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036654904.1|328060_328246_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_036656935.1|328427_328673_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083038379.1|328952_329570_+	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.6	3.1e-18
WP_024094581.1|329715_329982_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_077997668.1|330478_330709_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	49.3	4.4e-10
WP_083038381.1|330844_331933_-	LCP family protein	NA	NA	NA	NA	NA
WP_046655237.1|334574_334925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038383.1|335004_335424_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	59.8	5.3e-38
WP_024093300.1|335492_335819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158530262.1|335755_336184_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585048.1|336221_336680_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083038386.1|336900_340257_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	37.8	1.1e-88
WP_158530263.1|340322_340997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483571.1|341074_341449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482825.1|344488_344896_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482829.1|348786_349788_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_083038393.1|349829_350648_-	YdcF family protein	NA	NA	NA	NA	NA
WP_083038395.1|350575_351106_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023482831.1|351156_351804_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	48.8	1.2e-20
WP_083038398.1|352014_352446_-	hypothetical protein	NA	NA	NA	NA	NA
351854:351870	attR	AAATTAGAATTCGGAAT	NA	NA	NA	NA
WP_083038401.1|352478_354446_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_023482833.1|354594_354834_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_077997333.1|354910_355873_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_036656949.1|355860_356640_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_083038403.1|356760_358809_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	3.5e-66
WP_083038405.1|361643_362999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482839.1|363100_363670_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
>prophage 4
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	367352	440576	4666454	protease,integrase,transposase	Paenibacillus_phage(50.0%)	57	387393:387411	442314:442332
WP_083041512.1|367352_368312_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_083038407.1|368902_370423_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_083038409.1|370529_370865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997331.1|370888_371479_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_083038411.1|371475_372030_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_083038413.1|372157_372589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038415.1|372588_372867_+	DUF2653 family protein	NA	NA	NA	NA	NA
WP_083038417.1|373032_375282_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_079940582.1|376059_376770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038421.1|376766_378284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038423.1|378364_379183_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155121091.1|382294_382456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038424.1|382741_384064_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_158530264.1|385801_386098_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_083038428.1|386155_386848_+	LrgB family protein	NA	NA	NA	NA	NA
WP_077997666.1|386910_387663_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
387393:387411	attL	TCAGAGCGGATACTTTGGA	NA	NA	NA	NA
WP_023482861.1|388232_389273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121090.1|392795_392945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038433.1|393254_393554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041513.1|394405_394519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038435.1|394555_395044_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_152532830.1|394949_395285_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_083038437.1|395323_395611_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023483467.1|395752_396427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038439.1|397474_397723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158530265.1|397784_397976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038443.1|398000_400973_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158530266.1|401111_402228_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_104932629.1|402819_403937_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_083038447.1|403973_405059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038449.1|404977_405778_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_042119509.1|406200_406470_+	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_023484151.1|406555_408436_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023484150.1|408916_410134_+	cytochrome P450	NA	NA	NA	NA	NA
WP_083038451.1|411218_412055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083038453.1|412224_413703_-	hypothetical protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	9.7e-26
WP_023485550.1|415053_416064_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023485551.1|416071_417049_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083041514.1|417145_418669_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_158530267.1|418867_419029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038169.1|419439_420735_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083038455.1|420818_421502_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.9e-13
WP_158530268.1|421816_423286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530269.1|423527_423692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997300.1|424583_424907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096761176.1|425012_425450_-	DUF2383 domain-containing protein	NA	NA	NA	NA	NA
WP_083041515.1|425687_426710_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_083038461.1|427051_427915_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023482953.1|428043_428469_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482955.1|429202_429700_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093834.1|429755_430442_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_042118868.1|430480_431434_-	carbamate kinase	NA	NA	NA	NA	NA
WP_083038463.1|433974_435216_-	arginine deiminase	NA	NA	NA	NA	NA
WP_083041516.1|437112_438639_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_083038467.1|439219_439459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038469.1|439485_439794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038471.1|440129_440576_-|transposase	transposase	transposase	NA	NA	NA	NA
442314:442332	attR	TCCAAAGTATCCGCTCTGA	NA	NA	NA	NA
>prophage 5
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	558445	634541	4666454	head,portal,integrase,transposase,holin,tRNA,tail,capsid	Paenibacillus_phage(51.52%)	108	621363:621378	636145:636160
WP_077997234.1|558445_559813_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.6	2.5e-44
WP_083038574.1|559826_560987_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_023482678.1|561010_561703_-	bacillithiol biosynthesis deacetylase BshB1	NA	NA	NA	NA	NA
WP_077997232.1|561695_562124_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023482676.1|562211_563015_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_023482675.1|563197_563713_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_036657911.1|563785_564124_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_077997228.1|564277_565147_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	42.3	6.4e-62
WP_077585203.1|565143_566031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940818.1|566058_566667_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_024093767.1|567019_567889_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023482669.1|567922_568594_-	cytochrome b6	NA	NA	NA	NA	NA
WP_077997227.1|568611_569160_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_042119497.1|569438_569873_-	DUF2487 family protein	NA	NA	NA	NA	NA
WP_024093765.1|570188_570374_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_036657906.1|570425_570947_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_023482664.1|572313_572910_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_083038576.1|573139_573394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038578.1|573608_573947_-	hypothetical protein	NA	S5MA89	Brevibacillus_phage	36.5	3.3e-06
WP_083038580.1|574209_574548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038583.1|574773_574863_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.1e-05
WP_083038585.1|575007_575232_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	61.3	5.0e-19
WP_083038587.1|575697_575886_+	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.3	1.1e-27
WP_083038589.1|575886_576159_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	85.6	1.4e-34
WP_083038591.1|576162_576369_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	86.8	2.7e-27
WP_083038593.1|576765_578493_-	ricin-type beta-trefoil lectin domain protein	NA	R9VWV6	Paenibacillus_phage	35.8	7.3e-65
WP_083038595.1|578535_579804_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	66.9	4.4e-152
WP_083038598.1|580596_583047_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_036654848.1|583439_584123_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	2.2e-121
WP_158530271.1|584143_585004_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	98.3	1.0e-131
WP_083038601.1|585389_585938_-	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	96.7	4.8e-87
WP_083038603.1|587388_588477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038605.1|588451_588712_-	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	36.7	4.2e-09
WP_083038607.1|588723_589029_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	43.9	9.0e-19
WP_083038609.1|589193_589433_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	94.9	7.2e-32
WP_024094415.1|590113_590353_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_158530241.1|590388_590547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038125.1|590539_590935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038127.1|590947_592303_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	39.4	3.6e-11
WP_083038128.1|592306_592585_-	ketopantoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_083038130.1|592581_593166_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	44.9	4.8e-37
WP_083038131.1|594226_594637_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.7e-28
WP_083038133.1|594639_594882_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	36.8	2.2e-12
WP_083038135.1|594881_595865_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.5	3.1e-105
WP_083038137.1|595869_596508_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.9	4.4e-52
WP_083038139.1|596504_598610_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.3	1.5e-144
WP_023485206.1|598832_599258_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_083038611.1|599287_599752_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.7	1.7e-53
WP_083038143.1|599753_601085_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	49.3	1.8e-116
WP_083038145.1|601085_601268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038146.1|601260_601671_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	50.0	5.6e-32
WP_083038148.1|601667_602081_-	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.9	9.6e-40
WP_083041504.1|602080_602401_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.9e-28
WP_083038149.1|602441_602813_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	61.3	4.6e-33
WP_083038151.1|602838_603078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038153.1|603089_604136_-|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	86.1	2.0e-171
WP_083038154.1|604151_604511_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	1.2e-43
WP_083038613.1|604523_605147_-	hypothetical protein	NA	S5M9M5	Brevibacillus_phage	68.8	3.5e-70
WP_083038158.1|605191_606211_-|head	phage head morphogenesis protein	head	S5MTV5	Brevibacillus_phage	55.2	1.6e-104
WP_158530272.1|606207_607680_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	60.7	2.0e-164
WP_083038615.1|608957_609701_-	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	55.5	1.3e-55
WP_083038617.1|609966_610266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038619.1|610280_610562_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	1.7e-40
WP_083038621.1|610618_610822_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.7e-27
WP_083041506.1|610966_611404_-	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	91.7	2.0e-67
WP_158530243.1|611435_611588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038173.1|611556_612099_-	hypothetical protein	NA	A0A2I7SCB6	Paenibacillus_phage	80.6	1.1e-43
WP_083038181.1|612260_612452_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	84.3	1.5e-19
WP_158530244.1|612464_612623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038623.1|612619_612829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038627.1|613091_613337_-	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	73.1	1.0e-25
WP_158530273.1|613364_613529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530274.1|613628_613787_-	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	56.1	5.8e-06
WP_083038629.1|613791_614103_-	hypothetical protein	NA	A0A2I7SCA0	Paenibacillus_phage	95.1	1.3e-49
WP_083038631.1|614318_615056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530248.1|615099_615264_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	81.8	4.2e-15
WP_083038192.1|615279_615399_-	hypothetical protein	NA	A0A2H4J260	uncultured_Caudovirales_phage	61.5	2.6e-06
WP_083038634.1|615533_616634_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.6	1.7e-163
WP_083038636.1|616681_617611_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0C5AFC4	Paenibacillus_phage	80.6	1.3e-161
WP_083038202.1|617876_618245_-	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	49.6	1.1e-23
WP_083038204.1|618435_618810_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	64.5	1.1e-42
WP_083038206.1|618811_619021_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	70.6	2.8e-24
WP_083038640.1|619013_619943_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	34.5	2.6e-29
WP_083041521.1|619794_620397_-	hypothetical protein	NA	A0A2H4J4T0	uncultured_Caudovirales_phage	67.1	2.2e-24
WP_083038642.1|620696_621017_-	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	65.4	1.5e-32
WP_083038644.1|621013_621403_-	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	89.9	2.3e-59
621363:621378	attL	CGGTATGCTTTTATAT	NA	NA	NA	NA
WP_083038646.1|621411_621816_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	89.6	2.4e-64
WP_158530249.1|623609_623777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038223.1|624069_624414_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.9	3.9e-55
WP_083038231.1|624499_625243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530250.1|625175_625409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038233.1|625460_625652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530275.1|625614_625872_-	hypothetical protein	NA	A0A0N9RRC2	Paenibacillus_phage	50.0	6.6e-07
WP_083038652.1|625868_626057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038654.1|626092_626401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038656.1|626397_627153_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	88.4	3.9e-124
WP_158530276.1|627178_627343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485299.1|627372_627606_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
WP_024093545.1|627743_627965_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	91.8	5.6e-31
WP_083038658.1|627961_628339_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.2e-58
WP_158530277.1|628453_628693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038662.1|628753_628948_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	57.9	5.7e-11
WP_083038664.1|628961_629228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038666.1|629400_630294_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_083038668.1|630306_631524_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	55.3	2.1e-127
WP_024094472.1|631766_632294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094473.1|632413_633370_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_083038670.1|634295_634541_-	hypothetical protein	NA	G3MBC5	Bacillus_virus	37.2	4.4e-08
636145:636160	attR	ATATAAAAGCATACCG	NA	NA	NA	NA
>prophage 6
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	771948	848177	4666454	head,terminase,portal,integrase,transposase,protease,bacteriocin,tRNA,tail,capsid	Paenibacillus_phage(75.34%)	104	783367:783382	852207:852222
WP_083038751.1|771948_773298_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_083038752.1|773300_774068_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023483648.1|774234_774912_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_024094561.1|776490_776631_-	YfhD family protein	NA	NA	NA	NA	NA
WP_077995679.1|776781_777903_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	34.3	3.2e-29
WP_083038754.1|778061_779915_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	2.4e-143
WP_083038756.1|779971_780571_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024094564.1|780693_781725_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_104932739.1|781768_782215_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083041528.1|782304_782721_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_083038758.1|782863_784015_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
783367:783382	attL	GCAGAGGAAGCTGATC	NA	NA	NA	NA
WP_077995684.1|786080_786428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038760.1|786464_787661_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_024094568.1|787862_788858_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_036656512.1|789043_789316_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_036656508.1|789415_790441_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_042119084.1|790772_791810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094570.1|791799_792354_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083038762.1|792997_793552_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	9.9e-24
WP_083038764.1|793582_794578_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_158530283.1|794568_795600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530284.1|796185_796467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083321.1|796479_796758_-	hypothetical protein	NA	M1PSD2	Streptococcus_phage	54.2	2.7e-14
WP_083038770.1|797236_797815_+	DUF4352 domain-containing protein	NA	A0A0K2CYG1	Paenibacillus_phage	86.0	1.4e-60
WP_083038772.1|797979_798255_+	hypothetical protein	NA	A0A2I7SCF3	Paenibacillus_phage	83.7	3.5e-38
WP_083038774.1|798304_798655_+	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	83.6	3.9e-50
WP_158530285.1|799154_799307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038777.1|799322_799568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083038779.1|799709_800132_+	hypothetical protein	NA	O48383	Streptococcus_phage	66.7	3.2e-06
WP_040931869.1|800154_800358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083038781.1|800498_800897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038783.1|800854_801502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038785.1|801898_802183_+	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	81.4	9.5e-31
WP_083038787.1|802170_802449_+	hypothetical protein	NA	A0A0K2CZB9	Paenibacillus_phage	91.9	1.8e-42
WP_158530286.1|802548_803418_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	1.1e-133
WP_036654509.1|803438_804122_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_158530287.1|804289_804460_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	84.3	3.9e-16
WP_083038791.1|804591_804831_-|transposase	transposase	transposase	A0A0K2CZD0	Paenibacillus_phage	94.9	1.5e-32
WP_083038793.1|804845_805121_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	93.4	2.2e-48
WP_083041529.1|805117_805789_-	hypothetical protein	NA	A0A0K2CZQ6	Paenibacillus_phage	93.2	5.4e-125
WP_083038795.1|805788_806028_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0C5AEI6	Paenibacillus_phage	94.9	4.1e-35
WP_083038797.1|806166_806505_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	93.8	1.5e-54
WP_083038799.1|806514_807588_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	97.2	1.3e-208
WP_083038801.1|807593_808709_-	hypothetical protein	NA	A0A2I7SBZ4	Paenibacillus_phage	89.2	1.3e-195
WP_083038803.1|808711_809578_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	97.2	3.2e-162
WP_083038805.1|809577_813279_-|tail	phage tail tape measure protein	tail	A0A2I7SBZ5	Paenibacillus_phage	95.2	0.0e+00
WP_083038807.1|813512_813884_-	hypothetical protein	NA	A0A2I7SBZ1	Paenibacillus_phage	98.4	5.5e-63
WP_046655268.1|813954_814551_-	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
WP_083038809.1|814586_814916_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	99.1	9.9e-56
WP_083038811.1|814912_815305_-	hypothetical protein	NA	A0A2I7SC01	Paenibacillus_phage	84.7	5.0e-54
WP_083038813.1|815301_815622_-|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	90.6	5.5e-51
WP_083038815.1|815618_815879_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	95.2	3.1e-36
WP_083038817.1|816004_817147_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	99.2	5.1e-208
WP_083041530.1|817143_817860_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	93.3	2.4e-123
WP_158530513.1|817879_819067_-|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	98.2	2.5e-226
WP_083038821.1|819099_820836_-|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	64.7	1.1e-217
WP_083038823.1|820816_821131_-|terminase	phage terminase small subunit P27 family	terminase	A0A0K2CYB1	Paenibacillus_phage	92.3	2.3e-46
WP_083038825.1|821271_821613_-	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	93.9	1.0e-55
WP_083038827.1|821624_821975_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	89.7	8.1e-56
WP_083038829.1|822208_822481_-	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	93.3	3.9e-42
WP_096761193.1|822529_822856_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	100.0	1.2e-56
WP_083038831.1|822929_823154_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0K2CZG8	Paenibacillus_phage	95.9	4.2e-34
WP_083038833.1|823215_823422_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	90.9	1.1e-28
WP_083038835.1|823597_824221_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_083038837.1|824186_824450_-	DUF3310 domain-containing protein	NA	A0A291LBF7	Klebsiella_phage	52.1	8.8e-15
WP_083038839.1|824430_825822_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	65.0	1.9e-172
WP_083038841.1|825818_826097_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	51.1	2.1e-19
WP_083038843.1|826372_828700_-	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	62.0	1.8e-297
WP_083038845.1|828719_829310_-	hypothetical protein	NA	A0A217EQT8	Bacillus_phage	26.2	3.1e-07
WP_083038847.1|829324_829843_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	32.9	1.6e-12
WP_083038851.1|830077_830737_-	hypothetical protein	NA	A0A0C5AN16	Bacteriophage	94.8	8.3e-78
WP_083038853.1|830956_831412_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	93.3	1.4e-52
WP_158530515.1|831312_831591_-	hypothetical protein	NA	A0A0C5AET7	Bacteriophage	78.4	1.5e-36
WP_083038857.1|831710_831893_-	hypothetical protein	NA	A0A2I7SDI2	Paenibacillus_phage	80.0	2.8e-20
WP_083038859.1|831904_833866_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	59.5	7.6e-228
WP_083041531.1|833885_834245_-	hypothetical protein	NA	A0A160DH61	Gordonia_phage	50.5	1.5e-17
WP_083038861.1|834436_835036_-	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	63.0	1.5e-57
WP_083038863.1|835041_836229_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	48.0	9.6e-101
WP_083038865.1|836225_836612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530288.1|836617_836812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038867.1|836950_837205_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	82.5	7.7e-32
WP_083038869.1|837201_837522_-	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	71.4	1.4e-33
WP_083038871.1|837539_837761_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	90.4	1.1e-31
WP_083038873.1|837769_838195_-	hypothetical protein	NA	A0A0K2CZT5	Paenibacillus_phage	97.2	1.2e-74
WP_083038875.1|838191_838467_-	DNA cytosine methyltransferase	NA	A0A0K2CZT5	Paenibacillus_phage	97.4	2.5e-28
WP_158530289.1|838474_838660_-	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	78.9	2.5e-16
WP_083038878.1|838713_838950_-	hypothetical protein	NA	A0A0K2CZM3	Paenibacillus_phage	86.1	2.1e-28
WP_083038880.1|838965_839349_-	hypothetical protein	NA	A0A0K2CZT2	Paenibacillus_phage	84.1	3.1e-53
WP_083038882.1|839378_839576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038884.1|839610_839829_-	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	98.6	2.7e-33
WP_083038889.1|840107_840302_-	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	78.1	5.0e-23
WP_158530290.1|840491_840647_-	hypothetical protein	NA	A0A0K2CZ71	Paenibacillus_phage	95.3	7.5e-14
WP_083038892.1|840643_840859_-	hypothetical protein	NA	A0A0K2CZE8	Paenibacillus_phage	90.1	4.1e-26
WP_083038894.1|840865_841159_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	92.8	5.0e-43
WP_083038896.1|841155_841449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038898.1|841527_842352_-	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	90.5	2.0e-137
WP_155116349.1|842378_842525_-	hypothetical protein	NA	A0A0C5ABE5	Paenibacillus_phage	72.9	7.8e-13
WP_036656239.1|842650_842887_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	100.0	7.4e-37
WP_083038900.1|842997_843285_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	91.4	1.0e-40
WP_083038904.1|843685_844126_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0K2CZC9	Paenibacillus_phage	94.5	1.8e-76
WP_083038906.1|844202_845438_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	74.6	4.1e-179
WP_158530291.1|845519_846743_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158530292.1|846613_847588_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_023483878.1|847664_848177_-	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.9	3.5e-23
852207:852222	attR	GCAGAGGAAGCTGATC	NA	NA	NA	NA
>prophage 7
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1100528	1151550	4666454	bacteriocin,integrase,tail,transposase	Paenibacillus_phage(11.76%)	47	1097274:1097289	1115676:1115691
1097274:1097289	attL	TTACATCTTTATTTTT	NA	NA	NA	NA
WP_083039162.1|1100528_1100768_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	1.1e-35
WP_083039164.1|1100794_1101082_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	58.7	1.0e-08
WP_083039166.1|1101081_1101372_-	hypothetical protein	NA	A3QSC2	Clostridium_virus	43.3	2.5e-18
WP_158530307.1|1101390_1101696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530308.1|1101809_1102334_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	75.9	3.8e-49
WP_158530309.1|1102358_1102637_-	hypothetical protein	NA	A0A0C5AJ63	Bacteriophage	90.2	1.1e-36
WP_083039172.1|1102560_1102893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039173.1|1103053_1103368_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|1103367_1103709_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024094809.1|1103776_1104358_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039175.1|1104606_1105590_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_036657613.1|1106834_1107779_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_083039181.1|1108540_1108999_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_158530310.1|1109124_1109487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039184.1|1109506_1109755_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083039186.1|1110070_1113400_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	26.2	2.6e-42
WP_083039188.1|1113754_1114660_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	56.9	7.6e-90
WP_023483458.1|1115069_1115276_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|1115376_1115655_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_083039190.1|1116319_1116958_+	hemolysin III family protein	NA	NA	NA	NA	NA
1115676:1115691	attR	AAAAATAAAGATGTAA	NA	NA	NA	NA
WP_024094813.1|1118800_1119025_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
WP_083041540.1|1119165_1120476_-	xanthine permease	NA	NA	NA	NA	NA
WP_083039192.1|1121527_1122229_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_080675845.1|1123592_1124429_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023482893.1|1124415_1125432_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_083041541.1|1125436_1126213_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_036654840.1|1126381_1127302_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.2	7.4e-32
WP_024094820.1|1127383_1128103_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	1.2e-10
WP_083039194.1|1128110_1129016_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	5.6e-16
WP_083039196.1|1129012_1129843_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_083039198.1|1129839_1130826_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.4	2.1e-40
WP_023482886.1|1130815_1131910_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_158530311.1|1131906_1133460_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482884.1|1133640_1134012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039202.1|1134011_1135148_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_083039204.1|1135122_1136313_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482881.1|1136309_1137032_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	3.2e-46
WP_083039206.1|1137286_1138006_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_083039208.1|1137927_1138290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039210.1|1138256_1138814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530312.1|1138806_1139382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039215.1|1139333_1143041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654846.1|1146437_1146776_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_083039217.1|1146918_1148085_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023482876.1|1148424_1149207_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_077995858.1|1149760_1150363_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158530298.1|1150680_1151550_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
>prophage 8
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1226142	1268819	4666454	tail,terminase,portal,holin,tRNA,coat,capsid	Paenibacillus_phage(92.31%)	48	NA	NA
WP_023483267.1|1226142_1226514_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|1226636_1227530_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039261.1|1227905_1228463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995896.1|1229747_1229987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530313.1|1230009_1230162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|1230280_1231423_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995897.1|1231627_1231978_+	DNA primase	NA	NA	NA	NA	NA
WP_077995898.1|1231979_1232621_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|1232711_1233638_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|1233882_1235895_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_158529834.1|1236655_1236982_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_077995899.1|1237017_1237296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483255.1|1238501_1238726_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_158530314.1|1238852_1239086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654887.1|1239230_1240217_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_083039265.1|1240595_1242059_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|1242226_1242865_-	ribonuclease H	NA	NA	NA	NA	NA
WP_083039267.1|1243504_1243732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039271.1|1244417_1245023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039274.1|1245102_1245297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039276.1|1245361_1246231_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.8	2.5e-162
WP_083039278.1|1246223_1246640_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	94.9	3.2e-67
WP_083039280.1|1246627_1247077_-	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	90.3	9.0e-68
WP_083039282.1|1247061_1249503_-	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.2	0.0e+00
WP_083039284.1|1249382_1250840_-|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	96.3	2.6e-281
WP_083039286.1|1250839_1253755_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	86.7	0.0e+00
WP_158530315.1|1253782_1253947_-	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	98.1	1.3e-21
WP_158530316.1|1254132_1254486_-	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.3	1.9e-52
WP_083039292.1|1254561_1255110_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	99.5	1.9e-96
WP_083039294.1|1255122_1255497_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	95.2	1.2e-62
WP_083039296.1|1255493_1255919_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	91.5	5.9e-69
WP_083039298.1|1255915_1256185_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.6	3.9e-42
WP_083039300.1|1256247_1256631_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	97.6	6.7e-64
WP_083039302.1|1256645_1257581_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	78.2	2.8e-140
WP_083039304.1|1257635_1258271_-	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	78.7	2.1e-62
WP_083039305.1|1258359_1259223_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	88.8	7.6e-140
WP_083039307.1|1259219_1260713_-|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	91.9	3.7e-243
WP_158530517.1|1260736_1262422_-|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	96.1	1.5e-301
WP_158530519.1|1262602_1262881_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	55.4	9.3e-23
WP_083039313.1|1263171_1263351_-	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	89.8	3.2e-16
WP_083039316.1|1264160_1264550_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039318.1|1264546_1264807_-	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	85.9	5.1e-31
WP_083039320.1|1264952_1265144_-	hypothetical protein	NA	A0A0N9SGN2	Paenibacillus_phage	91.7	2.9e-15
WP_083039322.1|1265703_1265946_-	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	95.6	1.3e-12
WP_083039324.1|1266518_1266725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530317.1|1266958_1267117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530521.1|1267250_1268003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039328.1|1268360_1268819_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	60.0	1.5e-38
>prophage 9
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1271883	1279647	4666454	integrase	Paenibacillus_phage(76.92%)	17	1277710:1277724	1284195:1284209
WP_083039341.1|1271883_1272723_-	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	81.0	2.1e-110
WP_083039343.1|1272858_1273143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039344.1|1273188_1273491_-	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	93.0	1.5e-45
WP_158530318.1|1273487_1273661_-	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.2e-20
WP_083039346.1|1273758_1274223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039348.1|1274439_1275234_-	phage antirepressor	NA	A0A0N9SJU0	Paenibacillus_phage	97.3	2.6e-142
WP_083039350.1|1275256_1275514_-	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	57.1	2.0e-27
WP_083039352.1|1275507_1275810_-	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	71.7	2.2e-30
WP_083039354.1|1275834_1276074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039356.1|1276122_1276320_-	helix-turn-helix transcriptional regulator	NA	J9QEC3	Clostridium_phage	53.2	8.6e-07
WP_083039358.1|1276384_1276645_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	50.0	2.9e-10
WP_083039361.1|1276650_1276992_-	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	77.6	2.8e-37
WP_083039363.1|1276988_1277180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083039365.1|1277227_1277488_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	77.5	2.3e-23
WP_083039367.1|1277608_1277935_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	30.9	6.4e-15
1277710:1277724	attL	AAGAACAAATATTGC	NA	NA	NA	NA
WP_083039369.1|1277948_1278410_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	60.1	1.1e-47
WP_083039371.1|1278507_1279647_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.0	9.3e-61
1284195:1284209	attR	AAGAACAAATATTGC	NA	NA	NA	NA
>prophage 10
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1360268	1414656	4666454	protease,transposase	Bacillus_virus(25.0%)	53	NA	NA
WP_083039432.1|1360268_1360814_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.8	4.1e-22
WP_083039434.1|1361247_1361952_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_083039436.1|1362507_1364439_+	lantibiotic dehydratase family protein	NA	A0A2H4PQG8	Staphylococcus_phage	26.4	2.5e-50
WP_083039438.1|1364323_1365127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995990.1|1365110_1366475_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_083039440.1|1366761_1368078_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_083039442.1|1368366_1369350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039444.1|1369697_1371221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039446.1|1371148_1371724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039447.1|1371763_1372042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530323.1|1372145_1372718_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.0	6.2e-13
WP_083039449.1|1372835_1373252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039451.1|1373200_1373632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094946.1|1373849_1375307_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_083039453.1|1375492_1376581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039455.1|1376935_1377211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337483.1|1377186_1377939_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039457.1|1378035_1379229_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|1379254_1380814_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|1381578_1381827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|1381833_1382097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|1382280_1383222_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_083039461.1|1383403_1384018_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_023484416.1|1385465_1386155_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039462.1|1386354_1386645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116244.1|1386660_1386804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039464.1|1387007_1387538_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_149867720.1|1387532_1388297_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158530324.1|1388558_1389299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039468.1|1389482_1389707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039470.1|1389805_1390420_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_083039472.1|1390451_1392368_-	AAA family ATPase	NA	Q331U3	Clostridium_botulinum_C_phage	35.2	3.2e-05
WP_083039474.1|1392627_1393914_+	MFS transporter	NA	NA	NA	NA	NA
WP_083039476.1|1394141_1394474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|1394792_1395062_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023483433.1|1395094_1395388_+	ppGpp-regulated growth inhibitor	NA	NA	NA	NA	NA
WP_023483432.1|1395639_1395930_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077584850.1|1398569_1398827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484751.1|1400227_1400509_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_083039478.1|1400516_1401527_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_083039480.1|1401546_1402041_-	Dna2/Cas4 domain-containing protein	NA	NA	NA	NA	NA
WP_083039482.1|1402037_1404716_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_023484747.1|1404829_1405630_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_083039484.1|1405666_1406629_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_083039485.1|1406621_1408529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039487.1|1408550_1409255_-	CRISPR-associated protein Cas6	NA	NA	NA	NA	NA
WP_083038169.1|1409664_1410960_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083039489.1|1412623_1413211_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096761161.1|1413298_1413421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096761160.1|1413531_1413678_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083039491.1|1413762_1414122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039494.1|1414138_1414342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039496.1|1414536_1414656_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1419138	1476577	4666454	integrase,transposase	Paenibacillus_phage(60.0%)	43	1425482:1425501	1475364:1475383
WP_083039509.1|1419138_1420380_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.9	1.4e-65
WP_083038274.1|1420668_1421892_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_083039511.1|1422625_1423678_-	hypothetical protein	NA	NA	NA	NA	NA
1425482:1425501	attL	TGTTTCAATACACCTCGTGT	NA	NA	NA	NA
WP_083039516.1|1426009_1426210_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051428093.1|1428961_1429228_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036658172.1|1429290_1429542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039522.1|1429899_1432230_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083039524.1|1432413_1433580_+	amidohydrolase	NA	NA	NA	NA	NA
WP_083039526.1|1433651_1434839_+	MFS transporter	NA	NA	NA	NA	NA
WP_036656001.1|1436286_1436604_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158530325.1|1436818_1437436_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.4	1.9e-39
WP_023483532.1|1439464_1440835_-	amino acid permease	NA	NA	NA	NA	NA
WP_083039530.1|1440925_1442038_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_155116241.1|1442827_1443112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658155.1|1443372_1443606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530326.1|1443656_1444028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932629.1|1444206_1445323_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_083041545.1|1445300_1445801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530327.1|1445888_1446407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484139.1|1447161_1447356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658150.1|1447591_1447789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039534.1|1448344_1448830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039537.1|1449627_1449807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483464.1|1455461_1455848_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_083039539.1|1457978_1458419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039541.1|1458551_1458923_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	44.0	3.3e-15
WP_083039542.1|1459126_1459489_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_083039544.1|1459522_1459756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530328.1|1459742_1460165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039545.1|1460392_1461922_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_042118705.1|1461933_1462497_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_083041546.1|1462640_1462805_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_083039547.1|1462821_1464810_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_036658128.1|1464806_1465034_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_036658125.1|1465828_1466707_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996027.1|1466817_1467975_+	MFS transporter	NA	NA	NA	NA	NA
WP_036658123.1|1468233_1468746_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083039549.1|1468742_1469036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996029.1|1470615_1470978_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
WP_158530329.1|1470992_1471397_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	85.8	2.4e-64
WP_104932629.1|1471484_1472602_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_083039551.1|1473242_1474601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530330.1|1475460_1476577_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	98.9	1.7e-152
1475364:1475383	attR	TGTTTCAATACACCTCGTGT	NA	NA	NA	NA
>prophage 12
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1578339	1587240	4666454		Synechococcus_phage(28.57%)	8	NA	NA
WP_083039680.1|1578339_1578963_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	3.1e-26
WP_083039681.1|1578959_1580006_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	1.9e-68
WP_083039683.1|1580100_1581675_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
WP_083039685.1|1581659_1583903_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.5	2.0e-168
WP_083039687.1|1583880_1584576_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_023485276.1|1584649_1584892_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
WP_083039689.1|1584986_1585871_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.9	1.9e-37
WP_036655290.1|1585944_1587240_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 13
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1728099	1769159	4666454	holin,transposase	Paenibacillus_phage(37.5%)	39	NA	NA
WP_083039768.1|1728099_1729155_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	31.8	2.3e-21
WP_083039770.1|1729701_1730433_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.8e-17
WP_083039771.1|1730660_1731128_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_158530346.1|1731359_1732229_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	99.2	7.5e-135
WP_083039773.1|1732249_1732933_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	3.1e-120
WP_024093255.1|1733120_1733822_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_024093253.1|1735347_1735869_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_077996124.1|1735942_1736425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996125.1|1736475_1737207_-	VOC family protein	NA	NA	NA	NA	NA
WP_083039775.1|1737605_1737944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039776.1|1737856_1738396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093249.1|1738392_1739295_-	EamA family transporter	NA	NA	NA	NA	NA
WP_083039778.1|1739626_1740610_-	phosphotransferase	NA	NA	NA	NA	NA
WP_083039779.1|1742149_1742740_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039781.1|1742864_1743926_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_083039782.1|1744203_1745244_-	oxidoreductase	NA	NA	NA	NA	NA
WP_083038169.1|1745653_1746949_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024093243.1|1747133_1747433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039783.1|1747959_1748442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039785.1|1748852_1749338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093237.1|1750742_1751114_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083039786.1|1751115_1751541_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_077996132.1|1751897_1752302_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
WP_083038169.1|1752592_1753888_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_036655354.1|1754325_1754517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093234.1|1754726_1754978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940455.1|1755043_1755733_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024093233.1|1756278_1757487_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_083039788.1|1757476_1757704_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_083039789.1|1757849_1758218_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093230.1|1758220_1758391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483551.1|1758397_1758823_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083039791.1|1759092_1759662_-	acetyltransferase	NA	NA	NA	NA	NA
WP_083039794.1|1760132_1761371_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023483554.1|1761498_1762332_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_083039796.1|1762779_1763586_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_083039799.1|1763768_1764947_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_083039801.1|1764995_1767356_-	AAA family ATPase	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.5	2.9e-08
WP_083039803.1|1767641_1769159_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	1.8e-123
>prophage 14
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	1793879	1839820	4666454	bacteriocin,integrase,tRNA,transposase	Bacillus_phage(23.08%)	42	1786794:1786820	1839869:1839895
1786794:1786820	attL	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
WP_083039817.1|1793879_1794179_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_036655376.1|1794186_1795308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039819.1|1795831_1796446_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	3.7e-11
WP_083039821.1|1796424_1796748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039823.1|1797075_1797360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039825.1|1797376_1798057_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_083039826.1|1799983_1800682_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_083039828.1|1800653_1801577_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_083039829.1|1802374_1802578_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_158530348.1|1802633_1803323_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158530349.1|1803255_1803777_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052337475.1|1803760_1804384_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_023483616.1|1804803_1805334_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_036655386.1|1806320_1806938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039831.1|1806924_1807488_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023483612.1|1809231_1809633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039833.1|1811454_1812525_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024093192.1|1812667_1813186_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.7e-49
WP_024093191.1|1813212_1813950_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_077996173.1|1813942_1814428_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_083039835.1|1815642_1817346_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	2.4e-76
WP_083039837.1|1818753_1819008_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083039839.1|1819333_1819810_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_158530350.1|1820040_1820757_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.1	1.3e-44
WP_036656001.1|1820909_1821227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483999.1|1821905_1822562_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_083038169.1|1822970_1824266_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042119089.1|1825038_1825326_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.8	2.4e-05
WP_083039841.1|1825373_1825655_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158530351.1|1825666_1825834_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	50.9	5.4e-10
WP_083039842.1|1826218_1827592_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_040931540.1|1828357_1829128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_083039844.1|1829114_1831061_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_083039846.1|1831447_1833136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039848.1|1833117_1833354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039850.1|1833358_1833916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083039851.1|1833915_1834152_-	lipase chaperone	NA	NA	NA	NA	NA
WP_083039853.1|1835658_1837641_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.4	2.9e-41
WP_083039854.1|1837657_1838161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039856.1|1838247_1838931_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	4.1e-120
WP_083039857.1|1839068_1839575_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	100.0	4.9e-86
WP_083039859.1|1839586_1839820_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	97.4	9.5e-37
1839869:1839895	attR	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
>prophage 15
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2158496	2217693	4666454	holin,integrase,transposase	Paenibacillus_phage(23.08%)	60	2168826:2168842	2219104:2219120
WP_158530298.1|2158496_2159366_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_083039995.1|2159483_2160614_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_077996342.1|2161335_2162547_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_083039997.1|2162774_2164019_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_023482337.1|2164276_2164975_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_083039998.1|2165032_2165488_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_083040000.1|2165629_2166376_-	response regulator	NA	NA	NA	NA	NA
WP_083041561.1|2168192_2168318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040002.1|2168302_2168692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657256.1|2168806_2169817_-	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
2168826:2168842	attL	TCAATATGATCCTTCCC	NA	NA	NA	NA
WP_036655618.1|2171292_2171721_-	EamA family transporter	NA	NA	NA	NA	NA
WP_083040003.1|2172125_2173103_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_158530359.1|2173251_2173413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096761128.1|2173522_2173699_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_036655623.1|2173755_2174994_+	peptidase T	NA	NA	NA	NA	NA
WP_083040005.1|2175077_2175515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040006.1|2175696_2176134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041562.1|2176484_2177723_+	class I SAM-dependent methyltransferase	NA	A0A1C9C5J0	Heterosigma_akashiwo_virus	29.7	4.7e-42
WP_024092967.1|2177719_2178259_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	34.4	2.8e-23
WP_083040008.1|2178255_2179179_+	NAD(P)-dependent oxidoreductase	NA	M1H4P8	Acanthocystis_turfacea_Chlorella_virus	27.7	1.0e-17
WP_083041563.1|2179130_2179790_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_158530360.1|2179936_2180374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040011.1|2180379_2181147_+	hydroxylase	NA	NA	NA	NA	NA
WP_083040013.1|2181165_2181720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530361.1|2181737_2181887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530362.1|2181914_2182295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040016.1|2182300_2182570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092971.1|2182619_2183390_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046654998.1|2184542_2185592_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_051427956.1|2185551_2186274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482359.1|2186454_2187312_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_083040018.1|2187360_2188041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996356.1|2188058_2188880_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024092976.1|2188940_2189708_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_024092977.1|2189932_2191066_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_083040020.1|2191070_2192192_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_083040021.1|2192274_2193927_-	hypothetical protein	NA	A0A1W6JQM0	Staphylococcus_phage	37.4	7.5e-19
WP_083040022.1|2194110_2195700_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.2	8.0e-10
WP_077996360.1|2195716_2196115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040023.1|2196172_2196808_-	peptidase	NA	NA	NA	NA	NA
WP_077996362.1|2196845_2197031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040038.1|2198465_2198807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040040.1|2198839_2199904_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_158530363.1|2199967_2200702_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077996366.1|2200853_2201690_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.8	3.5e-41
WP_077996367.1|2202339_2203209_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_083041565.1|2203198_2203957_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_083040041.1|2203983_2205162_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	31.1	8.8e-38
WP_083040043.1|2205255_2205987_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_083040052.1|2207987_2210018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530364.1|2210434_2210557_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	6.5e-05
WP_023482371.1|2211262_2211619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116213.1|2211757_2211907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996373.1|2212327_2213668_+	amino acid permease	NA	NA	NA	NA	NA
WP_144029504.1|2215350_2215500_-|holin	putative holin-like toxin	holin	A0A0C5AEI3	Bacteriophage	77.3	2.6e-08
WP_158530365.1|2215568_2216069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585142.1|2216085_2216376_-	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	50.0	3.2e-10
WP_083041566.1|2216671_2217067_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	59.6	2.6e-10
WP_077585141.1|2217230_2217374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530366.1|2217318_2217693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	42.3	1.1e-23
2219104:2219120	attR	TCAATATGATCCTTCCC	NA	NA	NA	NA
>prophage 16
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2619520	2658697	4666454	bacteriocin,integrase,tRNA,transposase	Paenibacillus_phage(33.33%)	37	2636396:2636422	2661442:2661468
WP_023482488.1|2619520_2620000_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_023482489.1|2619996_2620875_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023482490.1|2620881_2621400_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036655844.1|2621412_2622441_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.7	4.3e-65
WP_077996594.1|2622572_2623712_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	8.8e-51
WP_096761331.1|2623936_2624239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040337.1|2625202_2626219_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_083040339.1|2626314_2628246_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	1.1e-58
WP_083040341.1|2628520_2629156_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_042118394.1|2629169_2629667_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_023482499.1|2629685_2630177_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_083040343.1|2631214_2631478_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_024093068.1|2631522_2632284_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.8e-12
WP_023482502.1|2632605_2632887_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
WP_023482503.1|2632976_2634605_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	8.1e-159
WP_083039022.1|2634774_2635458_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	4.8e-121
WP_158530298.1|2635478_2636348_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
2636396:2636422	attL	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
WP_083040345.1|2637684_2638095_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	37.1	9.2e-19
WP_080675781.1|2638562_2638766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585169.1|2639004_2639217_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585170.1|2639295_2639529_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077585279.1|2639535_2639688_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655866.1|2640798_2641191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530380.1|2641642_2641990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040350.1|2641982_2642297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040352.1|2643281_2644064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040353.1|2644030_2645056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997611.1|2645296_2645965_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	96.8	7.2e-130
WP_083040356.1|2646535_2647423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038274.1|2647548_2648772_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_083040358.1|2648876_2649062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040361.1|2649058_2650162_-	endospore germination permease	NA	NA	NA	NA	NA
WP_083040363.1|2650158_2651685_-	spore germination protein	NA	NA	NA	NA	NA
WP_083040365.1|2652441_2653689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040367.1|2656809_2657523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040369.1|2657600_2658104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655875.1|2658472_2658697_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
2661442:2661468	attR	TTTTTTACACTGTCTACTTGACAGGGG	NA	NA	NA	NA
>prophage 17
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2711798	2718987	4666454	bacteriocin,transposase	Paenibacillus_phage(50.0%)	8	NA	NA
WP_083040412.1|2711798_2712389_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.4e-12
WP_024093137.1|2712400_2712688_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	51.6	3.8e-19
WP_036655918.1|2712999_2713236_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996662.1|2713913_2714159_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_083040415.1|2714229_2714922_+	hypothetical protein	NA	D2XR29	Bacillus_phage	44.1	2.0e-45
WP_158530383.1|2714908_2715067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040417.1|2715646_2716093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041582.1|2717649_2718987_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	A0A0K2CYN4	Paenibacillus_phage	31.4	1.2e-06
>prophage 18
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2815814	2871245	4666454	integrase,transposase	Bacillus_phage(23.08%)	57	2844196:2844215	2870776:2870795
WP_158530298.1|2815814_2816684_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_083040532.1|2816982_2817414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530389.1|2817506_2817941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040538.1|2818160_2818979_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_083040541.1|2818971_2820084_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_083040544.1|2820295_2821687_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_083040547.1|2821832_2822372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040550.1|2822732_2824199_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	39.7	2.1e-81
WP_083040552.1|2824195_2825551_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	1.4e-55
WP_083040555.1|2825591_2826698_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|2827312_2827702_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|2827923_2828358_+	universal stress protein	NA	NA	NA	NA	NA
WP_083040558.1|2828657_2828915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040560.1|2828971_2829928_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
WP_023484892.1|2829982_2830468_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_077996729.1|2830536_2830845_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484894.1|2830865_2831066_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_083040562.1|2831160_2833587_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	6.3e-115
WP_077997625.1|2833643_2834267_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|2834356_2835034_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|2835030_2835837_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_083040565.1|2836080_2836368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996732.1|2837077_2837362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040568.1|2837534_2838560_+	copper resistance protein CopC/CopD	NA	NA	NA	NA	NA
WP_083041586.1|2838127_2839222_+	CopD family protein	NA	NA	NA	NA	NA
WP_023484901.1|2839613_2839970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530390.1|2840401_2840647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038169.1|2841252_2842548_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083040573.1|2842960_2843155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158530391.1|2843158_2843308_+	hypothetical protein	NA	NA	NA	NA	NA
2844196:2844215	attL	CTGTCTACTTGACGGGGGTA	NA	NA	NA	NA
WP_024095256.1|2844315_2845017_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_083040583.1|2846930_2847095_+	rubredoxin	NA	NA	NA	NA	NA
WP_083040586.1|2847166_2847712_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_083040592.1|2847990_2848644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040596.1|2848759_2849941_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_083040599.1|2850105_2850288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530392.1|2850729_2851620_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.8	3.1e-43
WP_083040603.1|2853406_2854324_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	56.7	2.8e-92
WP_024095250.1|2854467_2854848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040606.1|2855740_2856436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041588.1|2856860_2857154_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_083040609.1|2857634_2857847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040617.1|2858638_2859433_-	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_036656007.1|2859506_2859950_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023484941.1|2860213_2860372_-	thioredoxin-coupled arsenate reductase-like protein	NA	NA	NA	NA	NA
WP_023484942.1|2860956_2861874_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_083040621.1|2861892_2862861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040624.1|2862862_2864344_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	4.1e-16
WP_023484945.1|2864358_2864757_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_083040627.1|2864758_2865637_-	ribokinase	NA	NA	NA	NA	NA
WP_036656005.1|2865629_2866619_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095243.1|2867696_2867873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656003.1|2867917_2869267_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.9	7.6e-70
WP_158225718.1|2869270_2869411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656001.1|2869570_2869888_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158530279.1|2869839_2870757_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	3.1e-46
WP_158530393.1|2870798_2871245_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.7	1.2e-24
2870776:2870795	attR	CTGTCTACTTGACGGGGGTA	NA	NA	NA	NA
>prophage 19
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2899799	2962207	4666454	terminase,portal,integrase,transposase,holin,tail,capsid	Paenibacillus_phage(82.5%)	73	2926094:2926112	2964064:2964082
WP_083038169.1|2899799_2901095_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077996761.1|2901509_2902313_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_023483749.1|2902345_2903422_+	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_083040675.1|2905068_2905638_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_023483752.1|2905634_2906567_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_036656029.1|2906628_2906997_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	43.5	1.7e-19
WP_083040679.1|2907101_2907422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040689.1|2907806_2908055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040693.1|2908228_2909716_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	5.0e-123
WP_036656033.1|2910923_2912096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095212.1|2912261_2913182_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024095210.1|2916634_2917102_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119821.1|2917187_2918021_+	5'-3' exonuclease	NA	A0A2P1JXG8	Rhodococcus_phage	30.3	2.2e-19
WP_036657514.1|2918208_2918448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040696.1|2919198_2920416_+	glutathionylspermidine synthase family protein	NA	NA	NA	NA	NA
WP_024095207.1|2921080_2921470_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_023483766.1|2921515_2922082_+	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_024095205.1|2922319_2922550_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_083040700.1|2922546_2924559_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_046655070.1|2924609_2924807_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_024095203.1|2925600_2925894_-	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
2926094:2926112	attL	TTGCCCACATTTTGCCCAC	NA	NA	NA	NA
WP_083040707.1|2926118_2927306_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	51.5	1.6e-103
WP_083040710.1|2927317_2927905_-	helix-turn-helix domain-containing protein	NA	E5DV74	Deep-sea_thermophilic_phage	43.9	6.1e-40
WP_083040713.1|2928245_2928443_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083040716.1|2928435_2928777_+	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	72.4	3.8e-34
WP_083040719.1|2928782_2928998_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	45.8	8.5e-08
WP_083040722.1|2929102_2929300_+	helix-turn-helix transcriptional regulator	NA	J9QEC3	Clostridium_phage	56.5	1.1e-06
WP_083040726.1|2929355_2930180_+	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	87.6	5.1e-133
WP_083040730.1|2930200_2930590_+	hypothetical protein	NA	A0A0K2CZ66	Paenibacillus_phage	75.2	2.3e-51
WP_083040733.1|2930586_2931345_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	69.1	8.6e-95
WP_083040737.1|2931525_2932242_-	hypothetical protein	NA	Q7Y4L3	Streptococcus_phage	48.9	1.4e-30
WP_158530397.1|2932334_2932511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040744.1|2932677_2932923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040747.1|2933097_2933628_+	helix-turn-helix transcriptional regulator	NA	A0A0N9S7X2	Paenibacillus_phage	94.8	5.7e-45
WP_083040750.1|2933640_2933973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040753.1|2933965_2934280_+	hypothetical protein	NA	A0A0C5AEB5	Paenibacillus_phage	45.5	1.4e-14
WP_083040756.1|2934396_2935233_+	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	70.9	4.5e-97
WP_083040763.1|2935716_2936307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040766.1|2936390_2937020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040768.1|2937012_2937531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040771.1|2937520_2937922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040774.1|2937990_2938449_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	60.7	4.0e-39
WP_083040776.1|2938828_2939557_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_158530398.1|2939691_2939850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040780.1|2940083_2940290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040784.1|2940613_2940841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040786.1|2941493_2941703_+	hypothetical protein	NA	A0A0N9SGN2	Paenibacillus_phage	77.6	1.2e-19
WP_158530399.1|2941692_2941860_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	96.3	6.2e-22
WP_083040789.1|2941861_2942137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040791.1|2942126_2942525_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	96.9	4.1e-64
WP_083040796.1|2943373_2943619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040799.1|2943611_2943791_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	83.1	5.1e-14
WP_158530519.1|2944081_2944360_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	55.4	9.3e-23
WP_158530517.1|2944540_2946226_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	96.1	1.5e-301
WP_083039307.1|2946249_2947743_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	91.9	3.7e-243
WP_083039305.1|2947739_2948603_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	88.8	7.6e-140
WP_083039304.1|2948691_2949327_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	78.7	2.1e-62
WP_083040802.1|2950330_2950714_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	94.5	1.3e-62
WP_083040803.1|2950714_2951047_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	95.5	8.4e-55
WP_083040804.1|2951043_2951469_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	90.8	2.2e-68
WP_083040805.1|2951465_2951840_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	96.8	7.3e-63
WP_083040806.1|2951852_2952401_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	98.4	8.1e-95
WP_036654935.1|2952452_2952830_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	100.0	4.0e-61
WP_158530400.1|2953015_2953180_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	85.2	6.9e-18
WP_083040808.1|2953206_2955579_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	75.1	3.4e-222
WP_083040809.1|2955575_2955821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040812.1|2955871_2956168_+	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	58.2	1.3e-19
WP_083040815.1|2956169_2957627_+	hypothetical protein	NA	A0A0N9RRA9	Paenibacillus_phage	95.7	9.8e-281
WP_083040818.1|2957617_2959951_+	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	92.8	0.0e+00
WP_083040820.1|2959935_2960382_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	67.1	5.7e-46
WP_036654923.1|2960369_2960786_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	94.2	1.6e-66
WP_083040822.1|2960778_2961648_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	92.7	2.8e-158
WP_083040824.1|2961808_2962207_+	hypothetical protein	NA	A0A0N9RTJ2	Paenibacillus_phage	98.3	2.3e-22
2964064:2964082	attR	TTGCCCACATTTTGCCCAC	NA	NA	NA	NA
>prophage 20
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	2997497	3121768	4666454	integrase,transposase,holin,tRNA,coat	Paenibacillus_phage(48.28%)	110	3051075:3051090	3059764:3059779
WP_077996785.1|2997497_2997962_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_023483795.1|2998167_2998425_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	48.0	3.6e-13
WP_083040859.1|2999988_3000816_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024095177.1|3000812_3001478_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_083040860.1|3001582_3002500_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997631.1|3002554_3003295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095175.1|3003546_3005442_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.1	1.3e-102
WP_083040861.1|3005559_3008130_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_024095174.1|3008552_3008750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530401.1|3009152_3011000_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.9	4.8e-123
WP_083040864.1|3011596_3011842_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	4.5e-05
WP_104932629.1|3011825_3012943_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_083040865.1|3013154_3014321_-	MFS transporter	NA	NA	NA	NA	NA
WP_144029560.1|3016998_3017163_+|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	88.2	1.1e-07
WP_024095157.1|3017537_3018044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040866.1|3019040_3021140_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	35.9	3.4e-32
WP_158530402.1|3021406_3021646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484406.1|3024113_3024653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761292.1|3024953_3025139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040867.1|3025753_3027187_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_083040868.1|3027183_3028335_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.7	5.6e-21
WP_083040869.1|3028936_3029596_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.6	1.1e-05
WP_158530403.1|3029765_3030842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656171.1|3031269_3031464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530404.1|3031985_3032246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040872.1|3032399_3032948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485365.1|3033818_3034262_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_023485364.1|3034618_3034990_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|3035066_3036578_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_083040874.1|3036601_3036874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996804.1|3036916_3037333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996805.1|3037597_3037909_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_083040875.1|3037929_3038250_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083040876.1|3038296_3038938_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_083040877.1|3039073_3040180_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_024093279.1|3040199_3041429_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|3041647_3042097_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_077996810.1|3042268_3042841_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_083040878.1|3043021_3043855_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.3	1.2e-09
WP_083040879.1|3045213_3046440_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	1.9e-112
WP_023485352.1|3046426_3046864_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_083040880.1|3046888_3048286_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024093285.1|3048528_3048720_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077585192.1|3048751_3049111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040881.1|3049419_3050103_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	6.3e-121
WP_158530298.1|3050123_3050993_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
3051075:3051090	attL	CACCTCAAGGCTCTTT	NA	NA	NA	NA
WP_083040882.1|3051434_3052028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040883.1|3052270_3052873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530405.1|3052980_3053133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040885.1|3053235_3053637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121080.1|3053623_3053764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040886.1|3053913_3054576_+	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	46.7	5.1e-11
WP_083040887.1|3054551_3054782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093293.1|3055042_3055282_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_024093295.1|3056030_3056273_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	90.0	6.2e-31
WP_083040888.1|3058685_3059258_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_023483374.1|3059371_3059674_+	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	45.0	9.8e-10
WP_083040889.1|3060125_3061121_+	amidinotransferase	NA	NA	NA	NA	NA
3059764:3059779	attR	CACCTCAAGGCTCTTT	NA	NA	NA	NA
WP_077996877.1|3061547_3061748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040890.1|3062103_3062403_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.6	2.1e-20
WP_083040891.1|3063092_3063548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093303.1|3063631_3064675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996887.1|3064694_3065000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144029661.1|3065027_3065129_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_158530406.1|3065362_3065752_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077996888.1|3065952_3066999_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_036656196.1|3067077_3067410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040892.1|3067661_3068570_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_023484381.1|3070312_3071164_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_083041591.1|3071552_3072656_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_083040893.1|3072708_3074079_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_083039773.1|3074222_3074906_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	3.1e-120
WP_024094896.1|3075043_3075796_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
WP_077585196.1|3075993_3076206_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_083040894.1|3076785_3077355_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_083040895.1|3077746_3078043_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	68.6	1.0e-11
WP_083040896.1|3078272_3079178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093312.1|3079260_3079434_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|3080381_3080579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530407.1|3081060_3081228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083040897.1|3081239_3081464_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_083040898.1|3082925_3083111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040899.1|3083128_3083698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040900.1|3084207_3085569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121069.1|3085555_3085732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996746.1|3085839_3086157_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158530279.1|3086108_3087026_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	3.1e-46
WP_083040901.1|3087218_3087713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|3087950_3088340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530298.1|3088517_3089387_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_083039022.1|3089407_3090091_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	4.8e-121
WP_158530408.1|3090363_3090552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040903.1|3090578_3090833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996897.1|3091237_3093553_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
WP_023483454.1|3094330_3094999_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996899.1|3096926_3097997_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_083040904.1|3098113_3099601_+	MFS transporter	NA	NA	NA	NA	NA
WP_083040905.1|3099621_3101016_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023483448.1|3101081_3101732_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_023483447.1|3101733_3102738_+	sugar kinase	NA	NA	NA	NA	NA
WP_158530409.1|3102938_3104774_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_083040906.1|3104793_3105672_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_083040907.1|3105699_3107583_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_023483444.1|3107611_3108076_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_158530410.1|3108427_3109528_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_083040909.1|3111652_3112519_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.4	1.1e-08
WP_036658109.1|3113769_3114411_+	acetyltransferase	NA	NA	NA	NA	NA
WP_083040910.1|3114428_3115151_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_158530535.1|3117903_3120339_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_104932629.1|3120650_3121768_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
>prophage 21
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	3252545	3279211	4666454	tail,plate,portal,transposase,coat	Brevibacillus_phage(41.18%)	32	NA	NA
WP_024095080.1|3252545_3252707_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024095079.1|3253169_3253427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040974.1|3253735_3254581_+	hypothetical protein	NA	J9QE81	Clostridium_phage	25.3	1.8e-08
WP_023482425.1|3254595_3256077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530419.1|3256224_3256605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040976.1|3256922_3257363_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.9	7.6e-19
WP_083040977.1|3257446_3257839_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940799.1|3258092_3258533_+	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	78.0	1.1e-57
WP_158530420.1|3258909_3259302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|3259772_3260201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996983.1|3260175_3260358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040979.1|3260358_3261693_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
WP_077996985.1|3261694_3262156_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
WP_083040980.1|3262175_3262598_+|portal	phage portal protein	portal	A0A0A8WJT4	Clostridium_phage	43.2	4.4e-24
WP_083040981.1|3262966_3265012_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	41.7	6.0e-135
WP_083040982.1|3265011_3265653_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.8	4.2e-50
WP_083040983.1|3265657_3266626_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.5	2.6e-112
WP_023482436.1|3266625_3266913_+	DUF2577 domain-containing protein	NA	S5M5M4	Brevibacillus_phage	36.8	7.4e-15
WP_023482437.1|3266915_3267338_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.3e-27
WP_083040984.1|3267315_3268392_+|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.3	5.3e-98
WP_083041597.1|3268396_3268966_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.9	1.2e-32
WP_083040985.1|3268962_3269241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040986.1|3269244_3270783_+	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	36.5	3.4e-13
WP_083040987.1|3270795_3271191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530421.1|3271183_3271339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094415.1|3271374_3271614_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_158530422.1|3272912_3273056_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	5.3e-06
WP_083040988.1|3274522_3275545_+	lactate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
WP_158530423.1|3275733_3275874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083040989.1|3276130_3277498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997000.1|3278081_3278429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484507.1|3279007_3279211_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
>prophage 22
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	3563484	3629158	4666454	head,plate,terminase,portal,integrase,transposase,bacteriocin,tail,capsid	Paenibacillus_phage(44.07%)	91	3581986:3582004	3634265:3634283
WP_083041104.1|3563484_3565020_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	1.8e-123
WP_077997167.1|3565307_3565805_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_083041105.1|3565822_3567181_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_023485512.1|3567320_3567725_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_024095035.1|3567839_3568400_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_024095034.1|3568412_3568640_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_024095033.1|3568734_3569184_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_077997168.1|3569301_3570168_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.0	4.2e-37
WP_083041605.1|3570181_3571543_+	exodeoxyribonuclease VII large subunit	NA	A0A160DF99	Gordonia_phage	34.5	3.1e-34
WP_023485507.1|3571532_3571784_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_042119780.1|3571795_3572692_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_036658495.1|3573632_3575525_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_083041106.1|3575560_3576403_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_083041107.1|3576477_3576939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485502.1|3576935_3577382_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_083041108.1|3577395_3579126_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_083041606.1|3579278_3580613_+	SpoIVB peptidase	NA	NA	NA	NA	NA
WP_036658065.1|3580798_3581590_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	34.2	1.7e-08
3581986:3582004	attL	CATCATCTACAGTATGATG	NA	NA	NA	NA
WP_083041109.1|3582091_3583315_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	85.5	6.9e-195
WP_158530437.1|3583362_3583818_-	hypothetical protein	NA	A0A0C5AC96	Paenibacillus_phage	73.2	4.3e-57
WP_158530539.1|3583855_3584134_-	helix-turn-helix domain-containing protein	NA	A0A0C5AC96	Paenibacillus_phage	96.7	7.3e-44
WP_083041112.1|3584403_3584601_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AJQ3	Paenibacillus_phage	92.3	2.2e-26
WP_083041113.1|3584597_3585338_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	85.8	6.6e-116
WP_083041114.1|3585369_3585597_+	hypothetical protein	NA	A0A0C5AN65	Paenibacillus_phage	73.9	2.2e-22
WP_083041115.1|3585612_3585897_+	hypothetical protein	NA	R9VWW1	Paenibacillus_phage	85.1	5.4e-34
WP_083041116.1|3585902_3586163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038658.1|3586277_3586655_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.2e-58
WP_024093545.1|3586651_3586873_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	91.8	5.6e-31
WP_023485299.1|3587010_3587244_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
WP_158530438.1|3587273_3587438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041117.1|3587465_3588221_+	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	78.1	9.4e-110
WP_083038233.1|3588545_3588737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530250.1|3588788_3589022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038231.1|3588954_3589698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083038223.1|3589783_3590128_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.9	3.9e-55
WP_158530249.1|3590420_3590588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041118.1|3592381_3592786_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	89.6	2.4e-64
WP_083038644.1|3592794_3593184_+	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	89.9	2.3e-59
WP_083038642.1|3593180_3593501_+	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	65.4	1.5e-32
WP_083041521.1|3593800_3594403_+	hypothetical protein	NA	A0A2H4J4T0	uncultured_Caudovirales_phage	67.1	2.2e-24
WP_083041119.1|3594254_3595184_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	36.7	1.3e-28
WP_083038206.1|3595176_3595386_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	70.6	2.8e-24
WP_083038204.1|3595387_3595762_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	64.5	1.1e-42
WP_083038202.1|3595952_3596321_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	49.6	1.1e-23
WP_083038636.1|3596586_3597516_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0C5AFC4	Paenibacillus_phage	80.6	1.3e-161
WP_083038634.1|3597563_3598664_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.6	1.7e-163
WP_083038192.1|3598798_3598918_+	hypothetical protein	NA	A0A2H4J260	uncultured_Caudovirales_phage	61.5	2.6e-06
WP_158530439.1|3598933_3599098_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	72.7	7.4e-12
WP_083041120.1|3599147_3599378_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	81.8	7.9e-28
WP_158530440.1|3599601_3599763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530441.1|3599731_3600283_+	RNA polymerase subunit sigma-24	NA	A0A0K2CNQ1	Brevibacillus_phage	59.0	1.8e-46
WP_083041123.1|3600448_3601432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530442.1|3602436_3602604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041124.1|3603395_3604667_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.7	4.2e-163
WP_158530443.1|3604681_3606154_+|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	60.7	1.2e-164
WP_083038158.1|3606150_3607170_+|head	phage head morphogenesis protein	head	S5MTV5	Brevibacillus_phage	55.2	1.6e-104
WP_083038156.1|3607214_3607838_+	hypothetical protein	NA	S5M9M5	Brevibacillus_phage	69.2	1.2e-70
WP_083038154.1|3607850_3608210_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	1.2e-43
WP_083038153.1|3608225_3609272_+|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	86.1	2.0e-171
WP_083038151.1|3609283_3609523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038149.1|3609549_3609921_+	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	61.3	4.6e-33
WP_083041504.1|3609961_3610282_+	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.9e-28
WP_083038148.1|3610281_3610695_+	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.9	9.6e-40
WP_083041125.1|3610691_3610910_+	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	49.2	6.8e-13
WP_158530444.1|3610930_3611101_+	hypothetical protein	NA	A0A0A7RTY3	Clostridium_phage	51.0	6.7e-08
WP_083038145.1|3611093_3611276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038143.1|3611276_3612608_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	49.3	1.8e-116
WP_083038611.1|3612609_3613074_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.7	1.7e-53
WP_083038169.1|3613200_3614496_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023485206.1|3614908_3615334_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_083041126.1|3615556_3617665_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	43.4	9.9e-149
WP_083041127.1|3617921_3618299_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	45.1	3.1e-21
WP_083041128.1|3618303_3619287_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	55.9	1.4e-105
WP_083041129.1|3619286_3619529_+	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	36.8	2.2e-12
WP_083041130.1|3619531_3619942_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.0	2.4e-27
WP_083041131.1|3619934_3621011_+|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	52.7	7.9e-102
WP_158530541.1|3621021_3621585_+	DUF2313 domain-containing protein	NA	A0A0K2CNM8	Brevibacillus_phage	46.9	3.9e-36
WP_083040985.1|3621581_3621860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041133.1|3621863_3622970_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	38.5	1.1e-10
WP_083041134.1|3622891_3623227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041135.1|3623239_3623635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094416.1|3623627_3623786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041136.1|3623821_3624061_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	97.5	1.4e-35
WP_083041609.1|3624060_3624774_+	hypothetical protein	NA	A0A0C5AJ66	Bacteriophage	74.1	8.9e-94
WP_083038123.1|3624784_3625063_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	89.2	3.3e-44
WP_083041137.1|3625077_3625323_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_083041138.1|3625472_3626129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041139.1|3626581_3627289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530445.1|3627585_3627789_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	98.0	2.4e-20
WP_158530446.1|3627833_3628268_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.9	4.8e-74
WP_158530447.1|3628405_3629158_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	98.7	5.5e-134
3634265:3634283	attR	CATCATCTACAGTATGATG	NA	NA	NA	NA
>prophage 23
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	3689623	3696379	4666454		Staphylococcus_phage(57.14%)	7	NA	NA
WP_023482600.1|3689623_3690061_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|3691005_3692118_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|3692121_3692787_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_083041157.1|3692821_3694054_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
WP_024093718.1|3694085_3694556_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_077997197.1|3694986_3695769_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
WP_036658393.1|3695737_3696379_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 24
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	3751514	3819923	4666454	head,terminase,portal,transposase,bacteriocin,tail,capsid	Paenibacillus_phage(50.0%)	96	NA	NA
WP_079940546.1|3751514_3752615_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.8	4.4e-23
WP_083041176.1|3753893_3755369_-	recombinase family protein	NA	D7RWL2	Brochothrix_phage	26.2	4.8e-25
WP_083041177.1|3755398_3756142_-	LexA family transcriptional regulator	NA	A0A1B2APZ3	Phage_Wrath	37.6	4.4e-11
WP_083041178.1|3756279_3756558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041179.1|3756572_3756755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041180.1|3756817_3757087_+	hypothetical protein	NA	R9VWW1	Paenibacillus_phage	78.7	2.6e-30
WP_083041181.1|3757108_3757462_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	90.3	1.3e-48
WP_083041182.1|3757454_3757706_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	74.0	4.2e-22
WP_158530451.1|3757846_3758011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041183.1|3758047_3758794_+	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	78.9	3.2e-110
WP_083041184.1|3759121_3759313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041185.1|3759332_3759596_+	hypothetical protein	NA	A0A0C5AFB6	Paenibacillus_phage	77.0	1.5e-30
WP_158530452.1|3759774_3759942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041187.1|3760885_3761689_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	1.6e-46
WP_083038213.1|3761738_3762146_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	76.5	5.3e-51
WP_083041188.1|3762170_3762506_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	92.7	8.0e-53
WP_083038211.1|3762502_3763402_+	DUF4373 domain-containing protein	NA	A0A2H4J4T0	uncultured_Caudovirales_phage	65.8	6.1e-23
WP_083038208.1|3763253_3764183_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	36.7	2.9e-28
WP_083038206.1|3764175_3764385_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	70.6	2.8e-24
WP_083038204.1|3764386_3764761_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	64.5	1.1e-42
WP_083038202.1|3764951_3765320_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	49.6	1.1e-23
WP_083038200.1|3765323_3765590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038636.1|3765586_3766516_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0C5AFC4	Paenibacillus_phage	80.6	1.3e-161
WP_083041189.1|3766563_3767664_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.3	4.8e-163
WP_083038192.1|3767798_3767918_+	hypothetical protein	NA	A0A2H4J260	uncultured_Caudovirales_phage	61.5	2.6e-06
WP_158530248.1|3767933_3768098_+	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	81.8	4.2e-15
WP_083038631.1|3768141_3768879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038629.1|3769094_3769406_+	hypothetical protein	NA	A0A2I7SCA0	Paenibacillus_phage	95.1	1.3e-49
WP_158530274.1|3769410_3769569_+	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	56.1	5.8e-06
WP_083038169.1|3769681_3770977_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158530273.1|3771473_3771638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038627.1|3771665_3771911_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	73.1	1.0e-25
WP_083038623.1|3772173_3772383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530244.1|3772379_3772538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038181.1|3772550_3772742_+	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	84.3	1.5e-19
WP_083038173.1|3772903_3773446_+	hypothetical protein	NA	A0A2I7SCB6	Paenibacillus_phage	80.6	1.1e-43
WP_083041506.1|3773598_3774036_+	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	91.7	2.0e-67
WP_083038621.1|3774180_3774384_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.7e-27
WP_083038619.1|3774440_3774722_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	1.7e-40
WP_083038617.1|3774736_3775036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038615.1|3775301_3776045_+	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	55.5	1.3e-55
WP_083041190.1|3776037_3777309_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.2	3.6e-162
WP_158530272.1|3777323_3778796_+|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	60.7	2.0e-164
WP_083038158.1|3778792_3779812_+|head	phage head morphogenesis protein	head	S5MTV5	Brevibacillus_phage	55.2	1.6e-104
WP_083038613.1|3779856_3780480_+	hypothetical protein	NA	S5M9M5	Brevibacillus_phage	68.8	3.5e-70
WP_083038154.1|3780492_3780852_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	1.2e-43
WP_083038153.1|3780867_3781914_+|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	86.1	2.0e-171
WP_083038151.1|3781925_3782165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038149.1|3782191_3782563_+	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	61.3	4.6e-33
WP_083041504.1|3782603_3782924_+	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.9e-28
WP_083038148.1|3782923_3783337_+	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.9	9.6e-40
WP_083038146.1|3783333_3783744_+	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	50.0	5.6e-32
WP_083038145.1|3783736_3783919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038143.1|3783919_3785251_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	49.3	1.8e-116
WP_083038611.1|3785252_3785717_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.7	1.7e-53
WP_023485206.1|3785746_3786172_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_083041191.1|3786394_3788500_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.2	2.1e-143
WP_083038137.1|3788496_3789135_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.9	4.4e-52
WP_083038135.1|3789139_3790123_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.5	3.1e-105
WP_083038133.1|3790122_3790365_+	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	36.8	2.2e-12
WP_083038131.1|3790367_3790778_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.7e-28
WP_083038130.1|3791838_3792423_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	44.9	4.8e-37
WP_083038128.1|3792419_3792698_+	ketopantoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_083041192.1|3792701_3793805_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	39.4	2.9e-11
WP_083041135.1|3793817_3794213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094416.1|3794205_3794364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041136.1|3794399_3794639_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	97.5	1.4e-35
WP_083041612.1|3794638_3795154_+	hypothetical protein	NA	A0A0C5AJ66	Bacteriophage	92.2	1.1e-90
WP_083038169.1|3795250_3796546_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083041193.1|3796956_3797157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083038123.1|3797167_3797446_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	89.2	3.3e-44
WP_083041137.1|3797460_3797706_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_083041138.1|3797855_3798512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041139.1|3798964_3799672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530453.1|3799968_3800139_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	98.2	8.7e-24
WP_158530446.1|3800217_3800652_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.9	4.8e-74
WP_158530447.1|3800789_3801542_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	98.7	5.5e-134
WP_083041141.1|3802173_3802665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041610.1|3803967_3804459_-	SocA family protein	NA	I6R0L8	Salmonella_phage	46.9	1.1e-29
WP_083041143.1|3805227_3805566_-	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	48.1	1.1e-17
WP_158530454.1|3806073_3806352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041195.1|3807788_3809012_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	5.8e-226
WP_077995608.1|3809215_3809632_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_083041196.1|3809667_3810075_-	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
WP_083041197.1|3811134_3811635_+	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	9.3e-05
WP_083041198.1|3812013_3812517_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.5	9.4e-74
WP_158530455.1|3812875_3813088_-	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	78.8	1.1e-23
WP_083041200.1|3813042_3813360_-	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	98.8	6.2e-39
WP_024094464.1|3813356_3813548_-	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_024094463.1|3814044_3814266_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_077995602.1|3814334_3814538_-	hypothetical protein	NA	A0A0K2CYF6	Paenibacillus_phage	60.0	5.8e-06
WP_077995601.1|3815152_3815797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094459.1|3816421_3816625_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_077995599.1|3816814_3817204_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
WP_051427884.1|3817353_3817686_+	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	8.5e-31
WP_083041202.1|3818549_3819923_+	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	3.7e-27
>prophage 25
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	4304493	4311712	4666454	transposase	Paenibacillus_phage(75.0%)	9	NA	NA
WP_083039022.1|4304493_4305177_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	4.8e-121
WP_158530298.1|4305197_4306067_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_077995392.1|4306317_4306866_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
WP_077995391.1|4307217_4307430_-	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
WP_036654824.1|4307433_4307706_-	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
WP_083041358.1|4307702_4307894_-	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.9	5.2e-25
WP_077997500.1|4308352_4308571_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.0e-13
WP_083041359.1|4309377_4310160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041360.1|4311442_4311712_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	9.6e-41
>prophage 26
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	4558472	4633058	4666454	protease,transposase	Paenibacillus_phage(50.0%)	60	NA	NA
WP_083041445.1|4558472_4559042_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	35.2	1.8e-12
WP_083041446.1|4559001_4559271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940833.1|4559395_4560568_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995360.1|4560590_4561349_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940834.1|4561527_4562259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041447.1|4562287_4563754_+	antitoxin	NA	NA	NA	NA	NA
WP_083041633.1|4563838_4564402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|4564525_4565422_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|4566404_4566773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094105.1|4566958_4567693_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|4567748_4568534_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_083041448.1|4568647_4569928_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_077584927.1|4569822_4570164_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_158530555.1|4570242_4571307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484539.1|4571834_4572107_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_104932703.1|4572127_4572547_-	ribonuclease	NA	NA	NA	NA	NA
WP_083041450.1|4574573_4575773_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083041451.1|4576254_4576485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995371.1|4576739_4577807_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_083041452.1|4577921_4578938_+	NTP transferase domain-containing protein	NA	K7QKA7	Escherichia_phage	36.1	3.7e-24
WP_104932488.1|4579879_4580107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041454.1|4580196_4580970_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_083041455.1|4581267_4581930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530493.1|4582309_4584736_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_036656619.1|4585233_4586025_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083041457.1|4586060_4586741_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_083041458.1|4586745_4588278_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023484736.1|4588650_4589769_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
WP_023484737.1|4589945_4590773_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_080548066.1|4590756_4591260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041459.1|4591220_4592783_-	gluconokinase	NA	NA	NA	NA	NA
WP_083041460.1|4592817_4594179_-	GntP family permease	NA	NA	NA	NA	NA
WP_083041461.1|4594289_4594967_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484741.1|4596149_4596467_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
WP_077995381.1|4597053_4597365_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
WP_083041462.1|4598168_4598357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083039022.1|4598998_4599682_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.4	4.8e-121
WP_158530298.1|4599702_4600572_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_077995383.1|4600745_4601135_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_158530495.1|4601623_4603837_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	51.5	4.2e-198
WP_077997499.1|4604433_4604853_+	DUF4064 domain-containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	100.0	5.7e-24
WP_083041464.1|4605145_4607779_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	47.7	8.9e-232
WP_036658193.1|4608310_4608592_+|transposase	IS3 family transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
WP_083041465.1|4608597_4609224_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	99.0	9.9e-105
WP_083041466.1|4609153_4609345_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484244.1|4609501_4609981_-	cysteine dioxygenase-like protein	NA	NA	NA	NA	NA
WP_023484245.1|4610139_4610454_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_046655018.1|4611010_4612150_-	lactonase family protein	NA	NA	NA	NA	NA
WP_024094007.1|4612180_4612438_-	YqkE family protein	NA	NA	NA	NA	NA
WP_077995258.1|4612661_4613615_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023484248.1|4613706_4614465_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
WP_024094005.1|4614458_4615412_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_024094004.1|4615401_4616355_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
WP_083041467.1|4617478_4617970_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_079940665.1|4621519_4621693_+	DUF3951 domain-containing protein	NA	NA	NA	NA	NA
WP_155116373.1|4622109_4622262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041468.1|4622418_4622973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654309.1|4624991_4625735_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083041469.1|4630212_4631268_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.1	2.5e-15
WP_158530497.1|4632353_4633058_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP020557	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 chromosome, complete genome	4666454	4641805	4661478	4666454	holin,portal,tail,capsid	Paenibacillus_phage(100.0%)	23	NA	NA
WP_083041474.1|4641805_4642192_+	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	93.8	8.9e-64
WP_158530499.1|4642268_4642880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041476.1|4643146_4643773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041477.1|4643775_4643988_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083041478.1|4644130_4644583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041479.1|4644664_4644925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158530501.1|4644927_4645209_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	72.7	9.1e-26
WP_083041481.1|4645394_4645712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041482.1|4646025_4646895_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.5	6.5e-163
WP_083041483.1|4646887_4647304_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	92.8	4.6e-66
WP_083040820.1|4647291_4647738_-	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	67.1	5.7e-46
WP_083041484.1|4647722_4650056_-	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	94.3	0.0e+00
WP_083041485.1|4650046_4651504_-	hypothetical protein	NA	A0A0N9RRA9	Paenibacillus_phage	95.7	4.9e-280
WP_083041486.1|4651503_4654479_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	58.9	3.5e-248
WP_158530503.1|4654506_4654671_-	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	92.6	1.6e-19
WP_083041487.1|4654856_4655234_-	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.8	3.0e-56
WP_083041489.1|4655846_4656221_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	96.0	2.1e-62
WP_083041490.1|4656217_4656643_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	94.3	4.8e-71
WP_083041491.1|4656639_4656972_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	95.5	6.5e-55
WP_083041492.1|4656972_4657356_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	94.5	1.3e-62
WP_083041493.1|4658412_4659048_-	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	86.2	2.2e-59
WP_083041494.1|4659124_4659985_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	96.9	1.5e-151
WP_083041495.1|4659981_4661478_-|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	93.5	2.4e-250
>prophage 1
NZ_CP020558	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 plasmid pPLP3, complete sequence	128414	11089	47371	128414		Bacillus_phage(29.03%)	56	NA	NA
WP_083041646.1|11089_11638_-	hypothetical protein	NA	A0A0H3UYV8	Geobacillus_virus	41.8	1.2e-32
WP_083041784.1|11664_12207_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	44.0	8.4e-28
WP_083041647.1|12211_12637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041648.1|12624_12858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041649.1|12911_16097_-	DNA polymerase III subunit alpha	NA	A0A0K2FL87	Brevibacillus_phage	52.8	3.0e-266
WP_158530563.1|16568_17180_-	hypothetical protein	NA	B6CXH7	Clostridium_phage	43.5	3.2e-23
WP_083041651.1|17608_18331_-	hypothetical protein	NA	A0A218KC34	Bacillus_phage	39.1	3.3e-43
WP_083041652.1|18540_19434_+	DNA ligase	NA	A0A1P8CWY5	Bacillus_phage	31.9	3.3e-29
WP_083041653.1|19575_20547_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	58.0	1.7e-103
WP_083041654.1|20585_22661_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	66.6	2.2e-270
WP_083041655.1|22647_23007_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	F8WQ19	Bacillus_phage	55.6	6.0e-30
WP_158530565.1|23099_23249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041656.1|23493_25119_-	hypothetical protein	NA	A0A218KBX3	Bacillus_phage	41.2	1.0e-116
WP_158530567.1|25144_25354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530569.1|25507_26200_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	76.4	2.0e-90
WP_158530571.1|26628_26802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083037939.1|26798_27266_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	83.6	3.1e-71
WP_083041659.1|27259_27577_-	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	88.6	1.9e-51
WP_158530573.1|27705_27987_-	hypothetical protein	NA	A0A142F1S1	Bacillus_phage	41.8	3.7e-11
WP_083041661.1|27946_28336_-	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	89.9	4.7e-65
WP_083041662.1|28336_28771_-	hypothetical protein	NA	A0A0C5AJ86	Bacteriophage	86.0	8.7e-68
WP_083041663.1|28788_29016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041664.1|29237_29432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041665.1|29527_29815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041666.1|29811_30093_-	hypothetical protein	NA	A0A0K2CZG0	Paenibacillus_phage	84.0	4.7e-14
WP_158530575.1|30477_30711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041668.1|30707_31199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041669.1|31221_32271_-	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	40.1	7.0e-63
WP_083041670.1|32299_32632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041671.1|32644_34201_-	hypothetical protein	NA	A0A0K2FLE2	Brevibacillus_phage	41.9	1.3e-116
WP_083041672.1|34210_34813_-	hypothetical protein	NA	U5J9F4	Bacillus_phage	35.3	8.0e-19
WP_083041673.1|34832_35138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041674.1|35158_35380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530577.1|35417_36629_-	hypothetical protein	NA	A0A0K2FMA2	Brevibacillus_phage	33.1	4.9e-52
WP_083041676.1|36880_37465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041677.1|37801_38308_-	hypothetical protein	NA	Q2LI92	Bacillus_phage	34.6	7.6e-15
WP_083041678.1|38424_38736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530579.1|38725_38971_-	hypothetical protein	NA	A0A0K2CXM5	Paenibacillus_phage	46.6	6.3e-07
WP_083041680.1|39044_39251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041681.1|39240_39651_-	hypothetical protein	NA	A0A2I7QT09	Vibrio_phage	36.9	6.0e-10
WP_083041682.1|39650_39857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041683.1|39875_40187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041684.1|40480_40738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041685.1|40740_41001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530581.1|40997_41135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041686.1|41449_41707_-	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	74.4	2.2e-26
WP_083041687.1|41708_42092_-	hypothetical protein	NA	A0A0N9RRE2	Paenibacillus_phage	83.3	7.1e-05
WP_083041688.1|42098_42365_-	hypothetical protein	NA	A0A1I9S5U8	Bacillus_phage	39.7	1.5e-06
WP_083041690.1|42591_42909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158530583.1|42960_43125_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	77.3	7.9e-14
WP_083041691.1|43141_43636_-	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	49.1	5.3e-37
WP_083041785.1|43613_44057_-	adenine methyltransferase	NA	A0A0C5AN16	Bacteriophage	83.2	3.0e-71
WP_083041692.1|44065_44578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041693.1|45189_45522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041694.1|45518_46289_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_083041695.1|46306_47371_-	AAA family ATPase	NA	A0A0K2FM28	Brevibacillus_phage	37.9	2.2e-56
>prophage 2
NZ_CP020558	Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 plasmid pPLP3, complete sequence	128414	77689	115198	128414	holin,integrase,transposase,tail	Brevibacillus_phage(39.29%)	38	79885:79917	112671:112703
WP_083041735.1|77689_79891_+	AAA family ATPase	NA	A0A0H3UZA5	Geobacillus_virus	40.7	9.0e-153
79885:79917	attL	AACTTGACAAATATAAAATATAATGATATAATA	NA	NA	NA	NA
WP_083041736.1|80036_80249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041737.1|80241_80532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041738.1|80570_80855_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	53.3	3.0e-16
WP_083041739.1|81406_81610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041740.1|81606_81948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041741.1|82048_82267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041742.1|82277_83549_+	hypothetical protein	NA	A0A218KCD4	Bacillus_phage	37.1	2.7e-69
WP_083041743.1|83563_83788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041744.1|83872_84763_+	hypothetical protein	NA	A0A0K2FLZ1	Brevibacillus_phage	42.4	7.8e-55
WP_158530592.1|84762_86490_+	DNA-packaging protein	NA	A0A0K2FLD6	Brevibacillus_phage	58.7	7.5e-187
WP_083041745.1|86494_87973_+	hypothetical protein	NA	A0A0K2FL40	Brevibacillus_phage	40.1	6.2e-97
WP_083041746.1|88120_89380_+	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	44.6	1.5e-51
WP_083041747.1|89397_89922_+	hypothetical protein	NA	A0A0K2FLQ8	Brevibacillus_phage	36.4	8.5e-09
WP_083041748.1|89954_90959_+	hypothetical protein	NA	A0A218KCB5	Bacillus_phage	33.8	2.2e-45
WP_083041749.1|91039_91606_+	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	39.7	6.5e-23
WP_158530612.1|91738_92047_+	hypothetical protein	NA	A0A218KCB1	Bacillus_phage	41.6	5.9e-10
WP_083041751.1|92048_92375_+	hypothetical protein	NA	A0A218KCB7	Bacillus_phage	46.2	1.2e-16
WP_083041752.1|92355_93069_+	hypothetical protein	NA	E0YJ26	Lactococcus_phage	28.7	8.8e-25
WP_083041753.1|93056_93545_+	hypothetical protein	NA	A0A0K2FLZ9	Brevibacillus_phage	33.3	1.2e-20
WP_083041754.1|93550_94318_+	hypothetical protein	NA	A0A218KCC3	Bacillus_phage	29.6	1.0e-23
WP_083041755.1|94350_95106_+	hypothetical protein	NA	A0A0K2FL50	Brevibacillus_phage	40.6	2.4e-49
WP_158530594.1|95194_95359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083041756.1|95459_96017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041757.1|96009_96504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041758.1|96512_97481_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2FM05	Brevibacillus_phage	58.2	3.4e-104
WP_158530596.1|97496_97907_+	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	40.7	4.4e-21
WP_158530598.1|97924_99568_+|tail	phage tail tape measure protein	tail	A0A0H3UYV0	Geobacillus_virus	30.2	1.0e-07
WP_083041761.1|99534_100995_+	hypothetical protein	NA	A0A218KCA6	Bacillus_phage	22.2	2.3e-19
WP_083041762.1|101048_105074_+	hypothetical protein	NA	F8WPZ6	Bacillus_phage	54.9	2.0e-49
WP_158530600.1|105133_105889_+	hypothetical protein	NA	A0A218KCB4	Bacillus_phage	35.1	7.6e-43
WP_083041764.1|105904_109726_+	hypothetical protein	NA	A0A0K2FLF6	Brevibacillus_phage	27.4	2.9e-90
WP_083041765.1|109749_110790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083041766.1|110911_112387_+	hypothetical protein	NA	Q332A8	Clostridium_botulinum_C_phage	37.3	1.2e-20
WP_158530614.1|112825_113089_+|holin	holin	holin	A0A1P8BMK2	Lactococcus_phage	35.1	2.8e-05
112671:112703	attR	AACTTGACAAATATAAAATATAATGATATAATA	NA	NA	NA	NA
WP_083041768.1|114184_114406_+	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	84.7	2.1e-22
WP_083041769.1|114667_114940_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	63.7	2.2e-29
WP_083041770.1|114952_115198_+|transposase	transposase	transposase	A0A0C5AEQ4	Bacteriophage	95.0	1.3e-28
