The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	659385	679783	4170996	head,protease,capsid,tail	Paracoccus_phage(22.22%)	20	NA	NA
WP_081506425.1|659385_660033_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_081506426.1|660059_660977_-	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	42.4	8.4e-12
WP_081506427.1|661029_661818_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_081506428.1|662047_662734_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008282330.1|662890_663979_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.3	1.3e-35
WP_081506429.1|663992_665600_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	27.4	2.4e-30
WP_081508538.1|666092_667865_+	type I secretion protein	NA	NA	NA	NA	NA
WP_008282334.1|667952_669260_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.1	1.8e-15
WP_157132423.1|669294_669462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081506430.1|673544_673988_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	48.2	2.8e-29
WP_081506431.1|673984_674860_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	39.3	3.6e-52
WP_081506432.1|674856_675489_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	51.0	4.8e-59
WP_081506433.1|675502_676144_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	40.4	2.5e-18
WP_081506434.1|676136_676343_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_081506435.1|676326_676662_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_008282342.1|676666_677080_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_081506436.1|677104_677518_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_008282344.1|677514_677853_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_081506437.1|677852_678452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081506438.1|678601_679783_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.7	1.1e-69
>prophage 2
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	2992224	3062171	4170996	integrase,transposase	Lactococcus_phage(16.67%)	39	3019655:3019714	3066704:3066771
WP_008281741.1|2992224_2993403_-|transposase	IS5-like element ISRssp10 family transposase	transposase	NA	NA	NA	NA
WP_081507739.1|2993440_2993851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508638.1|2994578_3003380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507740.1|3003469_3005266_+	type I secretion system permease/ATPase	NA	NA	NA	NA	NA
WP_157667310.1|3005634_3009171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507742.1|3009196_3010522_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_081507743.1|3010653_3010929_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157667311.1|3011152_3012577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507744.1|3014486_3015155_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081508579.1|3015496_3017035_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_081507008.1|3017024_3017816_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.7	9.1e-31
WP_157667312.1|3018657_3019278_+	hypothetical protein	NA	NA	NA	NA	NA
3019655:3019714	attL	CTAGGGTCTGTTGACGTTTAAGGATTCCCAAATCAGGGATTGAATGATTCAAGGTTACCA	NA	NA	NA	NA
WP_087148880.1|3019722_3020479_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.6	1.5e-22
WP_081507746.1|3020591_3020807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667313.1|3021176_3021440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667314.1|3022142_3022586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667315.1|3022682_3023603_+	transcriptional regulator	NA	K4K6E1	Caulobacter_phage	40.4	5.8e-37
WP_081507749.1|3023784_3028881_+	S-layer family protein	NA	NA	NA	NA	NA
WP_157667316.1|3029238_3034032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507751.1|3034146_3034752_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_081507752.1|3035187_3040137_+	S-layer family protein	NA	NA	NA	NA	NA
WP_157667317.1|3040656_3045786_+	S-layer family protein	NA	NA	NA	NA	NA
WP_081507754.1|3046545_3047154_-	metallophosphoesterase	NA	R4TNI5	Mycobacterium_phage	29.7	9.2e-07
WP_081507755.1|3047504_3048149_+	AAA family ATPase	NA	A2I303	Vibrio_virus	37.4	8.2e-30
WP_081507756.1|3048836_3050420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667318.1|3050942_3051488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507757.1|3051814_3052666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667319.1|3052915_3053059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081507758.1|3053561_3053882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081508639.1|3053905_3054334_+	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_081507759.1|3054623_3056186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667374.1|3056877_3057252_-	DUF1394 domain-containing protein	NA	NA	NA	NA	NA
WP_157667320.1|3057273_3057483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667321.1|3057707_3058034_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157667322.1|3058694_3059432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667323.1|3059498_3059813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157667324.1|3059846_3060416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081507762.1|3060443_3060704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087148881.1|3060943_3062171_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.4	6.9e-102
3066704:3066771	attR	CTAGGGTCTGTTGACGTTTAAGGATTCCCAAATCAGGGATTGAATGATTCAAGGTTACCAAATGGGAG	NA	NA	NA	NA
>prophage 3
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	3428234	3458660	4170996	protease,holin,tRNA	Bacillus_phage(20.0%)	30	NA	NA
WP_081508000.1|3428234_3429176_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_081508001.1|3429321_3430257_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_081508651.1|3430445_3431288_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_081508002.1|3431416_3431623_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_157667345.1|3431952_3432114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508004.1|3433052_3433898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081508005.1|3433998_3435309_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_081508652.1|3435717_3436671_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081508006.1|3436770_3437652_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_081508007.1|3437761_3439078_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	2.7e-11
WP_081508008.1|3439074_3439749_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_008280031.1|3439965_3440373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508009.1|3440376_3441015_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081508010.1|3441046_3441952_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081508011.1|3442037_3442958_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087148909.1|3443313_3444150_+	alpha/beta hydrolase	NA	A0A220NRX7	Mycobacterium_phage	29.6	6.9e-13
WP_081508012.1|3444234_3444633_+	RidA family protein	NA	NA	NA	NA	NA
WP_081508013.1|3444718_3445636_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081508014.1|3445846_3446860_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_081508015.1|3446834_3447749_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_081508016.1|3447867_3448461_+	amino acid transporter	NA	NA	NA	NA	NA
WP_008280041.1|3448556_3449477_+	DMT family transporter	NA	NA	NA	NA	NA
WP_008280042.1|3449489_3450518_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.1	5.0e-21
WP_008280043.1|3450514_3451351_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_081508017.1|3451350_3452076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508018.1|3452078_3453008_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_081508019.1|3453111_3454581_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081508654.1|3454850_3455423_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_081508020.1|3455419_3456928_+|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	24.2	3.8e-17
WP_081508021.1|3457001_3458660_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.6	3.5e-64
>prophage 4
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	3617271	3650261	4170996	tail,integrase,transposase	Thiobacimonas_phage(40.0%)	53	3639681:3639696	3645793:3645808
WP_081508116.1|3617271_3617673_-	hypothetical protein	NA	A0A2L0V149	Salmonella_phage	35.0	9.7e-05
WP_081508117.1|3617669_3618326_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	44.0	8.6e-35
WP_081508118.1|3618322_3618997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508661.1|3618993_3621768_-|tail	phage tail tape-measure protein	tail	M4SPQ3	Rhodobacter_phage	24.6	1.8e-12
WP_081508119.1|3621799_3621994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508120.1|3622152_3622482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508121.1|3622530_3623466_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	53.2	1.2e-90
WP_081508122.1|3623578_3624013_-	hypothetical protein	NA	A0A1B0T6E9	Thiobacimonas_phage	44.6	7.2e-30
WP_081508123.1|3624009_3624513_-	hypothetical protein	NA	A0A2K9VH22	Faecalibacterium_phage	40.5	2.4e-16
WP_081508124.1|3624514_3624940_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_081508125.1|3624939_3625167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508126.1|3625347_3625704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508127.1|3625700_3626660_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	45.4	2.4e-70
WP_081508128.1|3626679_3627045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508129.1|3627037_3628123_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	36.2	6.2e-46
WP_081508130.1|3628420_3628639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508131.1|3628638_3629970_-	hypothetical protein	NA	A0A1B1P712	Rhodovulum_phage	43.3	1.6e-88
WP_081508132.1|3629966_3631517_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	46.9	2.3e-102
WP_081508133.1|3631509_3633159_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	60.7	5.1e-185
WP_081508134.1|3633155_3633350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508135.1|3633349_3633640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508136.1|3633639_3633936_-	hypothetical protein	NA	A0A1B0T6F5	Thiobacimonas_phage	52.6	1.1e-24
WP_157667351.1|3633932_3634148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508137.1|3634164_3634737_-	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	54.5	1.3e-42
WP_009819464.1|3634738_3635041_-	hypothetical protein	NA	A0A1B1P718	Rhodovulum_phage	62.6	2.2e-25
WP_081508138.1|3635037_3635382_-	DUF2730 family protein	NA	A0A1B0T6F6	Thiobacimonas_phage	44.2	1.6e-19
WP_081508139.1|3635378_3635951_-	carboxylesterase	NA	NA	NA	NA	NA
WP_081508140.1|3635941_3636553_-	peptidoglycan-binding protein	NA	G8DH66	Emiliania_huxleyi_virus	57.4	3.7e-56
WP_081508141.1|3636595_3636985_-	hypothetical protein	NA	A0A1B1P702	Rhodovulum_phage	35.5	3.6e-12
WP_081508142.1|3636974_3637226_-	hypothetical protein	NA	A0A1B0T6G9	Thiobacimonas_phage	56.5	1.4e-09
WP_081508143.1|3637222_3637675_-	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	61.0	2.4e-44
WP_081508144.1|3637671_3638088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508145.1|3638113_3638374_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	76.2	1.1e-25
WP_081508146.1|3638377_3638587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508147.1|3638583_3638823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508148.1|3638835_3639015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508149.1|3639019_3639670_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	66.5	3.0e-80
WP_081508150.1|3639671_3639872_-	hypothetical protein	NA	NA	NA	NA	NA
3639681:3639696	attL	TGTTGAAGGGGGTGTT	NA	NA	NA	NA
WP_081508151.1|3639868_3640219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508152.1|3640205_3640580_-	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	61.5	8.1e-38
WP_081508153.1|3640576_3641107_-	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	50.0	7.7e-42
WP_081508154.1|3641103_3641901_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	71.7	2.3e-98
WP_081508155.1|3641919_3644043_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0T6H2	Thiobacimonas_phage	63.8	1.3e-252
WP_081508156.1|3644039_3644894_-	chromosome partitioning protein ParB	NA	A0A1B0T6H9	Thiobacimonas_phage	43.6	2.5e-50
WP_037268626.1|3644890_3645115_-	hypothetical protein	NA	A0A1B1P711	Rhodovulum_phage	60.8	1.0e-16
WP_081508157.1|3645114_3645375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508159.1|3645565_3645778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157667352.1|3645777_3645948_-	hypothetical protein	NA	NA	NA	NA	NA
3645793:3645808	attR	TGTTGAAGGGGGTGTT	NA	NA	NA	NA
WP_081508160.1|3646207_3646654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508161.1|3646650_3646896_-	hypothetical protein	NA	A0A1B0T6N5	Pelagibaca_phage	50.0	4.4e-08
WP_081508162.1|3647001_3647658_+	LexA family transcriptional regulator	NA	A0A1B0T6H5	Thiobacimonas_phage	39.6	9.9e-39
WP_081508163.1|3647712_3648195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081508164.1|3648884_3650261_+	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	45.5	1.7e-53
>prophage 5
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	3654787	3684676	4170996	tail,integrase,transposase	Thiobacimonas_phage(44.0%)	37	3648482:3648498	3690615:3690631
3648482:3648498	attL	TTCACTGCAAACTTCGC	NA	NA	NA	NA
WP_081508170.1|3654787_3658726_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	40.4	8.4e-117
WP_081508171.1|3658722_3659106_-	hypothetical protein	NA	A0A0U2C0Z1	Paracoccus_phage	45.6	4.0e-24
WP_081508172.1|3659102_3659804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508173.1|3659805_3660474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508174.1|3660473_3663113_-|tail	phage tail tape-measure protein	tail	A0A1B0T6D4	Thiobacimonas_phage	38.8	6.4e-20
WP_008280191.1|3663114_3663309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508175.1|3663467_3663797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508176.1|3663846_3664782_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	52.6	1.1e-88
WP_081508177.1|3664882_3665317_-	hypothetical protein	NA	A0A1B0T6E9	Thiobacimonas_phage	43.9	2.5e-30
WP_081508178.1|3665313_3665811_-	hypothetical protein	NA	A0A2K9VH22	Faecalibacterium_phage	42.7	4.3e-18
WP_081508179.1|3665812_3666238_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_081508180.1|3666322_3666679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508181.1|3666675_3667635_-	hypothetical protein	NA	A0A219VH83	Ochrobactrum_phage	45.7	1.9e-70
WP_081508182.1|3667654_3668020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508183.1|3668012_3669098_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	39.4	1.7e-51
WP_081508184.1|3669396_3669615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508185.1|3669618_3670944_-	hypothetical protein	NA	A0A1B1P712	Rhodovulum_phage	42.9	1.4e-84
WP_081508186.1|3670940_3672491_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	46.9	4.6e-103
WP_081508187.1|3672492_3674133_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	61.2	2.7e-186
WP_081508188.1|3674129_3674699_-	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	55.2	4.4e-43
WP_008280207.1|3674700_3675003_-	hypothetical protein	NA	A0A1B1P718	Rhodovulum_phage	63.6	1.3e-25
WP_081508189.1|3674999_3675344_-	DUF2730 family protein	NA	A0A1B0T6F6	Thiobacimonas_phage	45.2	1.2e-19
WP_081508190.1|3675340_3675913_-	carboxylesterase	NA	NA	NA	NA	NA
WP_081508191.1|3675903_3676515_-	peptidoglycan-binding protein	NA	G8DH66	Emiliania_huxleyi_virus	57.8	3.1e-55
WP_081508192.1|3676556_3676946_-	hypothetical protein	NA	A0A1B1P702	Rhodovulum_phage	34.5	5.1e-11
WP_081508193.1|3676955_3677408_-	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	61.6	4.8e-45
WP_081508194.1|3677412_3678063_-	DUF3164 family protein	NA	A0A1B0T6L8	Pelagibaca_phage	63.2	2.0e-76
WP_081508195.1|3678064_3678265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508196.1|3678261_3678612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508197.1|3678598_3678973_-	hypothetical protein	NA	A0A1B0T6G8	Thiobacimonas_phage	60.7	1.4e-37
WP_081508198.1|3678969_3679503_-	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	49.1	1.8e-38
WP_081508199.1|3679499_3680297_-	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	82.4	4.0e-111
WP_081508200.1|3680315_3682439_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0T6H2	Thiobacimonas_phage	62.8	1.1e-251
WP_081508201.1|3682435_3683290_-	chromosome partitioning protein ParB	NA	A0A1B0T6H9	Thiobacimonas_phage	45.8	2.8e-54
WP_081508202.1|3683299_3683509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081508203.1|3683675_3683927_-	hypothetical protein	NA	A0A1B0T6I1	Thiobacimonas_phage	53.0	1.1e-14
WP_157667353.1|3684016_3684676_+	hypothetical protein	NA	A0A1B1P6Y7	Rhodovulum_phage	37.2	1.1e-29
3690615:3690631	attR	GCGAAGTTTGCAGTGAA	NA	NA	NA	NA
>prophage 6
NZ_CP020474	Roseovarius mucosus strain SMR3 chromosome, complete genome	4170996	3841787	3847080	4170996		Staphylococcus_phage(33.33%)	7	NA	NA
WP_081508303.1|3841787_3843266_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	5.3e-24
WP_008281962.1|3843353_3844052_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	48.9	1.1e-51
WP_081508304.1|3844051_3844408_+	6-pyruvoyl tetrahydropterin synthase family protein	NA	NA	NA	NA	NA
WP_081508305.1|3844386_3845127_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	36.7	8.0e-37
WP_081508306.1|3845138_3845603_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	53.3	4.4e-25
WP_081508307.1|3845654_3846344_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	5.2e-14
WP_081508308.1|3846336_3847080_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	7.8e-16
