The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	0	13169	1954607		Tupanvirus(100.0%)	9	NA	NA
WP_081569686.1|2175_2460_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_081569687.1|2948_4907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569688.1|6444_7059_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003657094.1|7045_7897_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003663891.1|8026_9553_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003657091.1|9658_10132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003657089.1|10464_10725_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003672044.1|10798_11119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658683.1|11507_13169_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.8	6.0e-40
>prophage 2
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	18870	21346	1954607		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_003658680.1|18870_20214_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.1	1.7e-90
WP_081569689.1|20317_21346_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	40.6	1.3e-66
>prophage 3
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	27241	31340	1954607		Staphylococcus_phage(50.0%)	4	NA	NA
WP_081569691.1|27241_28462_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	38.3	4.1e-06
WP_003657069.1|28619_29279_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_081569692.1|29508_30270_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_081569693.1|30284_31340_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.1	1.6e-35
>prophage 4
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	36435	37698	1954607		Aeromonas_phage(100.0%)	1	NA	NA
WP_003657037.1|36435_37698_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.0	3.4e-96
>prophage 5
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	47237	53399	1954607	tRNA	Bodo_saltans_virus(33.33%)	5	NA	NA
WP_003670232.1|47237_48386_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	33.1	1.3e-06
WP_003660952.1|48494_50045_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003657031.1|50179_50977_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_081569696.1|51071_52427_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SD04	Indivirus	25.0	6.8e-10
WP_081569697.1|52553_53399_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.8	2.7e-25
>prophage 6
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	66539	67214	1954607		Bacillus_virus(100.0%)	1	NA	NA
WP_003658639.1|66539_67214_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	40.2	2.7e-07
>prophage 7
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	70431	71373	1954607		Escherichia_phage(100.0%)	1	NA	NA
WP_003657002.1|70431_71373_-	class A beta-lactamase BRO-1	NA	Q38058	Escherichia_phage	33.7	2.9e-31
>prophage 8
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	93938	101458	1954607		Prochlorococcus_phage(40.0%)	9	NA	NA
WP_003656948.1|93938_94667_+	3-oxoacyl-ACP reductase FabG	NA	A0A0K0KVL6	Prochlorococcus_phage	30.3	1.8e-12
WP_003656945.1|94857_95094_+	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	49.2	1.5e-05
WP_003656943.1|95308_95806_+	peptidoglycan-binding protein LysM	NA	A0A0A7RW06	Clostridium_phage	43.6	1.4e-05
WP_003656941.1|95951_96341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172830167.1|96947_98678_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	1.4e-55
WP_003656937.1|98677_99193_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003656936.1|99356_100379_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003656934.1|100487_100898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003656932.1|101245_101458_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.7	7.1e-15
>prophage 9
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	108774	116535	1954607		Enterobacteria_phage(33.33%)	5	NA	NA
WP_049148558.1|108774_109824_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	31.2	5.4e-23
WP_049148557.1|109919_111152_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003658604.1|111183_112230_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003658602.1|112490_113447_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.3	2.4e-25
WP_003672553.1|113670_116535_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	35.1	2.0e-19
>prophage 10
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	131402	135887	1954607		uncultured_virus(25.0%)	5	NA	NA
WP_003657728.1|131402_131693_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	4.2e-18
WP_003669834.1|131818_133456_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	62.5	9.0e-174
WP_003657730.1|133657_134536_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003658496.1|134532_135375_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	1.3e-96
WP_003674168.1|135371_135887_+	dihydrofolate reductase	NA	A0A1B2IFI7	Erwinia_phage	39.9	5.2e-27
>prophage 11
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	139126	142590	1954607		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_049155991.1|139126_140119_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.6	1.4e-12
WP_003657738.1|140118_141018_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_081569704.1|141282_142590_-	diaminopimelate decarboxylase	NA	A0A2K9L0W9	Tupanvirus	26.6	7.8e-19
>prophage 12
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	157568	161717	1954607		Enterobacteria_phage(50.0%)	3	NA	NA
WP_003657755.1|157568_158102_+	flavin reductase	NA	Q9KX93	Enterobacteria_phage	46.3	5.8e-13
WP_003658468.1|158275_159874_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_003657757.1|160196_161717_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.2	1.0e-99
>prophage 13
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	168286	176115	1954607	tRNA	Bodo_saltans_virus(25.0%)	6	NA	NA
WP_003657767.1|168286_169012_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	25.2	6.4e-07
WP_003657768.1|169145_171458_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.0	9.7e-73
WP_003657769.1|171577_172096_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_172798033.1|172183_172681_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.2e-13
WP_081569711.1|172773_174087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003672581.1|174195_176115_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.2	4.2e-130
>prophage 14
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	193200	196568	1954607		Vibrio_phage(50.0%)	3	NA	NA
WP_003665128.1|193200_194622_+	type IV pilus secretin PilQ	NA	R9TEZ5	Vibrio_phage	21.9	4.8e-14
WP_003657653.1|194817_195453_+	shikimate kinase	NA	NA	NA	NA	NA
WP_003657652.1|195449_196568_+	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	30.0	1.6e-25
>prophage 15
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	199929	202673	1954607		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_003670175.1|199929_200898_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.8	1.2e-24
WP_003657646.1|200970_201744_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003657645.1|201830_202673_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.5	8.5e-35
>prophage 16
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	216451	217060	1954607		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003660359.1|216451_217060_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	4.5e-38
>prophage 17
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	221380	269881	1954607	holin,head,integrase,tail	Moraxella_phage(92.06%)	68	221185:221224	270261:270300
221185:221224	attL	ATTATGAGTCCTCTGCTCTAACCAACTGAGCTATAGGCCC	NA	NA	NA	NA
WP_081569717.1|221380_222646_+|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	99.8	3.5e-242
WP_003662063.1|222640_222928_-	hypothetical protein	NA	A0A0R6PH27	Moraxella_phage	100.0	2.1e-49
WP_081569718.1|222929_223259_-	septal ring lytic transglycosylase RlpA family protein	NA	A0A0R6PHZ7	Moraxella_phage	93.6	3.3e-51
WP_081569719.1|223469_223946_-	hypothetical protein	NA	A0A0R6PHK6	Moraxella_phage	99.4	1.3e-88
WP_081569720.1|223950_224208_-	hypothetical protein	NA	A0A0R6PHP0	Moraxella_phage	98.8	1.3e-42
WP_081569721.1|224204_224528_-	hypothetical protein	NA	A0A0R6PHR5	Moraxella_phage	99.1	7.4e-56
WP_081569723.1|224741_225113_-	hypothetical protein	NA	A0A0R6PHL9	Moraxella_phage	76.8	5.4e-18
WP_003661847.1|225109_225604_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	39.6	7.5e-23
WP_003661846.1|225600_225825_-	hypothetical protein	NA	A0A0R6PD26	Moraxella_phage	60.3	5.0e-19
WP_081569724.1|225834_226539_-	hypothetical protein	NA	A0A0R6PD08	Moraxella_phage	98.3	1.3e-126
WP_003661842.1|226535_227165_-	hypothetical protein	NA	A0A0R6PHJ4	Moraxella_phage	99.5	2.1e-118
WP_172830159.1|227264_227762_-	siphovirus Gp157 family protein	NA	A0A0R6PHR8	Moraxella_phage	99.4	1.4e-85
WP_003661838.1|227730_227901_-	hypothetical protein	NA	A0A0R6PHP2	Moraxella_phage	100.0	4.5e-20
WP_081569726.1|227897_228140_-	hypothetical protein	NA	A0A0R6PHK7	Moraxella_phage	93.8	5.4e-35
WP_081569727.1|228232_228523_-	hypothetical protein	NA	A0A0R6PD25	Moraxella_phage	100.0	4.5e-52
WP_003660107.1|228519_228681_-	hypothetical protein	NA	A0A0R6PHL0	Moraxella_phage	100.0	7.0e-23
WP_081569728.1|229040_229301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569729.1|229381_230092_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PIF7	Moraxella_phage	38.8	7.1e-43
WP_081569730.1|230229_230421_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003661167.1|230497_230932_+	hypothetical protein	NA	A0A0R6PHM4	Moraxella_phage	100.0	5.6e-75
WP_081569731.1|230921_231974_+	helix-turn-helix domain-containing protein	NA	A0A0R6PHP4	Moraxella_phage	89.9	1.3e-149
WP_081569732.1|231951_232476_+	hypothetical protein	NA	A0A0R6PHI8	Moraxella_phage	95.4	5.5e-93
WP_081569733.1|232492_232834_+	DUF1064 domain-containing protein	NA	A0A0R6PHM2	Moraxella_phage	96.5	4.8e-53
WP_081569734.1|232834_233500_+	FAD-dependent thymidylate synthase	NA	A0A0R6PHK2	Moraxella_phage	95.9	1.5e-119
WP_081569735.1|233568_233871_+	hypothetical protein	NA	A0A0R6PD09	Moraxella_phage	99.0	1.7e-54
WP_152704769.1|233890_234343_+	hypothetical protein	NA	A0A0R6PCZ2	Moraxella_phage	98.0	7.2e-81
WP_003661153.1|234352_234532_+	hypothetical protein	NA	A0A0R6PHI3	Moraxella_phage	100.0	2.3e-27
WP_081570055.1|234851_235112_+	DUF3310 domain-containing protein	NA	A0A0R6PHM6	Moraxella_phage	90.7	7.3e-38
WP_064644683.1|235142_235535_+	hypothetical protein	NA	A0A0R6PHJ2	Moraxella_phage	97.7	2.7e-68
WP_156878894.1|235636_235798_-	hypothetical protein	NA	A0A0R6PJG0	Moraxella_phage	100.0	4.4e-25
WP_003661441.1|235846_236713_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	51.8	5.6e-42
WP_003661442.1|236741_236915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661443.1|236911_238051_+	hypothetical protein	NA	A4JWM1	Burkholderia_virus	58.4	1.1e-130
WP_003661444.1|238043_238571_+	formyl transferase	NA	A4JWM2	Burkholderia_virus	40.0	9.4e-32
WP_003661445.1|238607_239027_+	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	63.6	1.1e-43
WP_003661446.1|239026_240499_+	hypothetical protein	NA	A0A0R6PHB9	Moraxella_phage	95.3	2.2e-280
WP_003661447.1|240498_241914_+	DUF4055 domain-containing protein	NA	A0A0R6PHK8	Moraxella_phage	99.8	2.3e-274
WP_081569737.1|241925_243665_+|head	head morphogenesis protein	head	A0A0R6PHM5	Moraxella_phage	99.7	0.0e+00
WP_081569738.1|243882_244521_+	hypothetical protein	NA	A0A0R6PHK3	Moraxella_phage	100.0	6.5e-88
WP_081569739.1|244523_245540_+	hypothetical protein	NA	A0A0R6PHI9	Moraxella_phage	97.6	1.1e-185
WP_003669660.1|245550_245754_+	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	98.5	1.7e-29
WP_003659806.1|245814_246174_+	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	100.0	1.9e-60
WP_081569740.1|246175_246532_+	glutamate 5-kinase	NA	A0A0R6PH70	Moraxella_phage	98.3	2.1e-59
WP_003669655.1|246531_246879_+	HK97 gp10 family phage protein	NA	A0A0R6PHN4	Moraxella_phage	100.0	1.8e-63
WP_003669653.1|246875_247076_-	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	75.8	4.5e-19
WP_081569741.1|247447_247831_+	hypothetical protein	NA	A0A0R6PK03	Moraxella_phage	99.2	1.1e-69
WP_081569742.1|247830_248019_+	hypothetical protein	NA	A0A0R6PFF0	Moraxella_phage	96.8	5.3e-30
WP_081569743.1|248022_248931_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	99.3	7.2e-165
WP_049155873.1|249212_249674_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	99.3	7.6e-78
WP_013107936.1|249709_249958_+	hypothetical protein	NA	A0A0R6PJS2	Moraxella_phage	96.3	2.0e-40
WP_013107937.1|250039_250492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569744.1|250789_251581_+	ORF6C domain-containing protein	NA	A0A0R6PIG1	Moraxella_phage	79.9	1.1e-57
WP_003660046.1|251738_251921_+	hypothetical protein	NA	A0A0R6PDJ5	Moraxella_phage	98.3	2.2e-25
WP_003669635.1|251883_252720_+	hypothetical protein	NA	A0A0R6PI23	Moraxella_phage	99.3	2.7e-150
WP_081569745.1|252752_256739_+|tail	phage tail tape measure protein	tail	G3ENB0	Psychrobacter_phage	36.5	4.8e-88
WP_081569746.1|256841_257174_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	98.2	3.1e-57
WP_081569747.1|257277_257667_+	hypothetical protein	NA	A0A0R6PDW9	Moraxella_phage	98.4	4.3e-66
WP_004463043.1|257750_258419_+|tail	phage minor tail protein L	tail	A0A0R6PF73	Moraxella_phage	100.0	1.5e-130
WP_013107943.1|258620_258890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569748.1|258947_259736_+	C40 family peptidase	NA	A0A0R6PHD1	Moraxella_phage	92.7	7.4e-150
WP_081569749.1|259801_260395_+|tail	tail assembly protein	tail	A0A0R6PJH2	Moraxella_phage	100.0	9.7e-86
WP_081569750.1|261873_266664_+	DUF1983 domain-containing protein	NA	A0A0R6PHL4	Moraxella_phage	72.7	0.0e+00
WP_003658428.1|266718_267048_+|holin	phage holin family protein	holin	A0A0R6PH52	Moraxella_phage	100.0	6.4e-55
WP_081569751.1|267158_267704_+	DUF882 domain-containing protein	NA	A0A0R6PI81	Moraxella_phage	95.6	1.2e-93
WP_003671754.1|267723_268194_-	hypothetical protein	NA	A0A0R6PCF0	Moraxella_phage	100.0	1.3e-85
WP_003660391.1|268300_268501_-	hypothetical protein	NA	A0A0R6PCD3	Moraxella_phage	100.0	2.1e-29
WP_081569752.1|268502_269471_-	hypothetical protein	NA	A0A0R6PGS2	Moraxella_phage	97.8	5.0e-180
WP_003661334.1|269533_269881_-	hypothetical protein	NA	A0A0R6PH82	Moraxella_phage	100.0	9.7e-62
270261:270300	attR	ATTATGAGTCCTCTGCTCTAACCAACTGAGCTATAGGCCC	NA	NA	NA	NA
>prophage 18
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	274868	278663	1954607	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_013108111.1|274868_276920_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	28.7	6.6e-57
WP_003664367.1|277220_278663_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.4	7.4e-47
>prophage 19
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	282625	289341	1954607		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003660346.1|282625_283855_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.5	3.9e-97
WP_003660345.1|284179_285442_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.6	1.3e-42
WP_003674083.1|285716_287402_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	1.9e-33
WP_003660343.1|287634_289341_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	5.5e-33
>prophage 20
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	298160	300764	1954607		Acinetobacter_phage(100.0%)	1	NA	NA
WP_081569754.1|298160_300764_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.2	2.7e-23
>prophage 21
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	305482	306946	1954607		Pseudomonas_phage(100.0%)	1	NA	NA
WP_077656049.1|305482_306946_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	30.6	2.1e-36
>prophage 22
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	312587	316302	1954607		Cedratvirus(50.0%)	2	NA	NA
WP_013108096.1|312587_313382_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.4	3.6e-11
WP_003671724.1|313725_316302_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.3	6.7e-123
>prophage 23
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	330606	332040	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_081569759.1|330606_332040_-	exonuclease SbcCD subunit D C-terminal domain-containing protein	NA	L0LAJ8	Bacillus_phage	23.0	6.3e-06
>prophage 24
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	338917	345830	1954607		Bathycoccus_sp._RCC1105_virus(33.33%)	6	NA	NA
WP_003660308.1|338917_340546_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	27.3	1.4e-33
WP_063453978.1|340906_341641_+	pirin family protein	NA	NA	NA	NA	NA
WP_003657554.1|341995_342484_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_003670104.1|342531_343230_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	6.2e-07
WP_003660305.1|343226_344294_-	dihydroorotase	NA	NA	NA	NA	NA
WP_172830169.1|344468_345830_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	2.3e-53
>prophage 25
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	354737	358744	1954607		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_003660298.1|354737_356372_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	3.4e-149
WP_172798032.1|356518_357370_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	5.9e-52
WP_036378377.1|357451_358744_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.8	7.4e-131
>prophage 26
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	362612	363641	1954607		Wolbachia_phage(100.0%)	1	NA	NA
WP_003657532.1|362612_363641_+	signal peptide peptidase SppA	NA	Q9JMP1	Wolbachia_phage	30.7	7.5e-17
>prophage 27
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	371042	373115	1954607		Bacillus_virus(50.0%)	2	NA	NA
WP_042510401.1|371042_372089_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	4.2e-15
WP_003672712.1|372146_373115_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.1e-17
>prophage 28
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	380215	382852	1954607	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_065251917.1|380215_382852_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.8	1.4e-168
>prophage 29
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	386021	387170	1954607	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003657508.1|386021_387170_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.3	1.6e-89
>prophage 30
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	396740	399593	1954607		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003670518.1|396740_399593_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.7	3.5e-258
>prophage 31
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	408998	414439	1954607		Salmonella_phage(33.33%)	6	NA	NA
WP_003665418.1|408998_409463_-	dUTP diphosphatase	NA	S4TR87	Salmonella_phage	60.1	1.4e-42
WP_003657482.1|409603_410050_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003660255.1|410093_410369_-	glutaredoxin 3	NA	A0A223FNA2	NY_014_poxvirus	36.8	1.9e-07
WP_003657479.1|410475_410889_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_081569767.1|410989_412105_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003664591.1|412369_414439_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.1	5.6e-112
>prophage 32
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	421145	421721	1954607		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003657468.1|421145_421721_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	72.5	2.2e-74
>prophage 33
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	427590	428259	1954607		Vibrio_phage(100.0%)	1	NA	NA
WP_003657460.1|427590_428259_-	alpha/beta fold hydrolase	NA	A0A2I7SAF7	Vibrio_phage	32.9	1.7e-17
>prophage 34
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	460155	468561	1954607		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_003657430.1|460155_461457_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	37.3	3.8e-10
WP_081569769.1|461484_461838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660214.1|462172_462925_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003660213.1|462927_463911_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003662490.1|463921_464662_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	7.8e-16
WP_049156405.1|464801_465371_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	60.5	2.7e-16
WP_003664900.1|465844_466597_+	peptidase M15	NA	NA	NA	NA	NA
WP_081569770.1|466626_467370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669445.1|467469_468561_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	1.3e-83
>prophage 35
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	481523	486752	1954607	tRNA,protease	Tupanvirus(50.0%)	3	NA	NA
WP_004463137.1|481523_483320_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	21.5	3.7e-19
WP_003660185.1|483777_485640_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_003660184.1|485774_486752_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.3	9.2e-25
>prophage 36
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	491320	495043	1954607		Streptomyces_phage(100.0%)	1	NA	NA
WP_003660175.1|491320_495043_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.4	2.7e-173
>prophage 37
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	501890	614352	1954607	protease,head,tail,portal,tRNA,terminase,integrase	Moraxella_phage(73.91%)	111	530141:530162	567921:567942
WP_003660167.1|501890_503159_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.6	1.1e-20
WP_081569781.1|503258_504092_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003660164.1|504161_505340_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_065251893.1|505477_506896_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003662551.1|506964_507684_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	38.8	2.2e-23
WP_081569782.1|507676_508957_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_081569783.1|509170_509875_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	48.7	7.6e-45
WP_036332108.1|510024_511110_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	49.2	2.3e-80
WP_003660152.1|511348_512395_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_081569784.1|512621_512999_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003667114.1|513073_513745_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003669480.1|513976_516124_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_003660143.1|516130_516619_+	YchJ family protein	NA	NA	NA	NA	NA
WP_003664680.1|516735_517842_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.3	2.2e-75
WP_003660140.1|517961_518492_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	33.5	2.3e-17
WP_003660137.1|518532_519276_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_081569785.1|519488_520721_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	30.4	9.2e-38
WP_003660134.1|520818_521049_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003660133.1|521276_522722_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003660131.1|522858_523803_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003660130.1|524007_525552_+	MFS transporter	NA	NA	NA	NA	NA
WP_081569786.1|525555_526443_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_081569787.1|526466_527228_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	29.1	1.0e-10
WP_003662577.1|527311_528637_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	100.0	1.5e-251
WP_081569788.1|528716_530117_-	DUF3482 domain-containing protein	NA	A0A0R6PEL3	Moraxella_phage	100.0	5.2e-247
530141:530162	attL	TATGTACACAATTATGTACACA	NA	NA	NA	NA
WP_003660124.1|530249_530447_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJ71	Moraxella_phage	100.0	9.8e-35
WP_081569789.1|530525_530999_-	hypothetical protein	NA	A0A0R6PJB7	Moraxella_phage	100.0	1.2e-91
WP_172830161.1|531189_532854_-	DEAD/DEAH box helicase	NA	A0A0R6PJG7	Moraxella_phage	100.0	0.0e+00
WP_172830162.1|532840_533797_-	PD-(D/E)XK nuclease family protein	NA	A0A0R6PJD3	Moraxella_phage	100.0	6.6e-193
WP_081569792.1|534001_534478_-	DUF669 domain-containing protein	NA	A0A0R6PEL5	Moraxella_phage	100.0	1.1e-84
WP_081569793.1|534480_535164_-	ATP-binding protein	NA	A0A0R6PJ99	Moraxella_phage	100.0	5.0e-126
WP_081569794.1|535153_535540_-	hypothetical protein	NA	A0A0R6PJM8	Moraxella_phage	100.0	8.6e-67
WP_081569795.1|535529_535709_-	hypothetical protein	NA	A0A0R6PJR2	Moraxella_phage	100.0	4.4e-26
WP_081569796.1|536012_536579_-	hypothetical protein	NA	A0A0R6PJ56	Moraxella_phage	100.0	2.8e-98
WP_147374831.1|536585_537638_-	hypothetical protein	NA	A0A0R6PJB2	Moraxella_phage	100.0	4.2e-201
WP_081569798.1|537760_538474_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJG5	Moraxella_phage	100.0	9.8e-133
WP_081569799.1|538595_538826_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	100.0	8.5e-38
WP_081569800.1|538864_541348_+	DUF3987 domain-containing protein	NA	A0A0R6PJB9	Moraxella_phage	100.0	0.0e+00
WP_081569801.1|541581_541923_+	DUF1064 domain-containing protein	NA	A0A0R6PJB1	Moraxella_phage	100.0	1.4e-57
WP_081569802.1|541919_542105_+	hypothetical protein	NA	A0A0R6PEJ6	Moraxella_phage	100.0	3.7e-28
WP_081570056.1|542112_542355_+	DUF3310 domain-containing protein	NA	A0A0R6PEG8	Moraxella_phage	100.0	3.9e-41
WP_004463074.1|542354_542732_+	hypothetical protein	NA	A0A0R6PKM5	Moraxella_phage	100.0	2.0e-68
WP_156878894.1|542833_542995_-	hypothetical protein	NA	A0A0R6PJG0	Moraxella_phage	100.0	4.4e-25
WP_065249125.1|543347_543692_+	HNH endonuclease	NA	A0A0R6PIT6	Moraxella_phage	100.0	3.9e-63
WP_003661941.1|543797_544253_+|terminase	phage terminase small subunit P27 family	terminase	A0A0R6PI76	Moraxella_phage	100.0	3.2e-81
WP_081569803.1|544249_545944_+|terminase	terminase large subunit	terminase	A0A0R6PIA4	Moraxella_phage	100.0	0.0e+00
WP_036344453.1|546467_546788_+	site-specific DNA-methyltransferase	NA	A0A0R6PIT5	Moraxella_phage	100.0	3.5e-58
WP_003660069.1|546780_547992_+|portal	phage portal protein	portal	A0A0R6PKP4	Moraxella_phage	100.0	4.1e-232
WP_081569804.1|547972_548623_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PJ24	Moraxella_phage	100.0	9.5e-119
WP_120649154.1|549959_550262_+	hypothetical protein	NA	A0A0R6PJV4	Moraxella_phage	98.0	2.4e-48
WP_081569805.1|550239_550527_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0R6PKP1	Moraxella_phage	98.9	2.1e-49
WP_081569806.1|550526_550853_+|head	phage head closure protein	head	A0A0R6PDH4	Moraxella_phage	98.1	1.4e-54
WP_003660059.1|550849_551392_+	hypothetical protein	NA	A0A0R6PIP5	Moraxella_phage	100.0	6.6e-97
WP_003660056.1|551391_551739_+	DUF3168 domain-containing protein	NA	A0A0R6PI72	Moraxella_phage	100.0	9.7e-62
WP_003660055.1|551748_552195_+	hypothetical protein	NA	A0A0R6PIA3	Moraxella_phage	100.0	1.1e-73
WP_049148410.1|552248_552578_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A0R6PJ86	Moraxella_phage	100.0	9.9e-56
WP_049148424.1|552628_552901_+	DUF4035 domain-containing protein	NA	A0A0R6PJD6	Moraxella_phage	100.0	5.5e-44
WP_036331412.1|553374_553719_+	DUF3168 domain-containing protein	NA	A0A0R6PKK8	Moraxella_phage	100.0	1.9e-62
WP_003663126.1|553763_554195_+	hypothetical protein	NA	A0A0R6PJI3	Moraxella_phage	100.0	3.8e-71
WP_081569807.1|554284_554608_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A0R6PKI3	Moraxella_phage	99.1	5.9e-53
WP_050810518.1|554682_554940_+	DUF4035 domain-containing protein	NA	A0A0R6PJ91	Moraxella_phage	100.0	1.8e-41
WP_081569808.1|554985_559374_+	tape measure protein	NA	A0A0R6PJ22	Moraxella_phage	100.0	0.0e+00
WP_080567272.1|559506_559836_+|tail	phage tail protein	tail	A0A0R6PIV4	Moraxella_phage	99.1	2.3e-60
WP_003663113.1|559961_560222_-	hypothetical protein	NA	A0A0R6PE97	Moraxella_phage	100.0	6.6e-39
WP_003663112.1|560383_560935_+	KilA-N domain-containing protein	NA	A0A0R6PE81	Moraxella_phage	100.0	9.9e-101
WP_081569809.1|561077_561470_+	hypothetical protein	NA	A0A0R6PE27	Moraxella_phage	96.2	1.4e-64
WP_003660031.1|561568_562237_+|tail	phage minor tail protein L	tail	A0A0R6PDY9	Moraxella_phage	100.0	1.9e-130
WP_013107943.1|562438_562708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569810.1|562765_563545_+	C40 family peptidase	NA	A0A0R6PHD1	Moraxella_phage	95.0	1.2e-152
WP_003660026.1|563536_563944_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	100.0	2.7e-71
WP_003660025.1|563976_564159_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PJD4	Moraxella_phage	100.0	5.7e-29
WP_081569811.1|564258_564870_+|tail	tail assembly protein	tail	A0A0R6PIF0	Moraxella_phage	99.0	4.5e-110
WP_065249113.1|564873_566376_+	host specificity protein J	NA	A0A0R6PHV5	Moraxella_phage	100.0	6.7e-301
WP_003662311.1|566424_566565_-	hypothetical protein	NA	A0A0R6PDK1	Moraxella_phage	100.0	3.6e-15
WP_081569812.1|566710_567904_-|integrase	integrase family protein	integrase	A0A0R6PDI8	Moraxella_phage	100.0	4.6e-228
WP_003660020.1|568129_568612_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
567921:567942	attR	TATGTACACAATTATGTACACA	NA	NA	NA	NA
WP_003660019.1|568634_568955_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	40.6	9.1e-14
WP_003673216.1|568970_569276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660017.1|569285_569663_-	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_003666497.1|569779_572593_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_003664502.1|572762_573695_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003666498.1|573847_574033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003660013.1|574467_575544_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.0	8.8e-85
WP_038519359.1|576385_577735_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003660009.1|577759_578137_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_003660008.1|578198_579875_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_120649186.1|580050_581643_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003660002.1|581786_582200_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_036332061.1|582548_583769_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	27.2	9.8e-08
WP_003659996.1|584896_585196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662331.1|585258_585471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659995.1|585536_586046_+	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_081569813.1|586084_589321_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003659991.1|589601_590078_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003659989.1|590093_590456_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_038519365.1|590723_591692_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_081569814.1|591821_593126_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003668239.1|593277_596058_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003662346.1|596347_597388_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003669516.1|597384_598104_+	nucleotidyltransferase family protein	NA	E3T4Y6	Cafeteria_roenbergensis_virus	30.8	3.2e-06
WP_003657873.1|598625_599537_+	bestrophin	NA	NA	NA	NA	NA
WP_003668242.1|599666_600542_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_003671239.1|600725_602294_-	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.4e-37
WP_003657882.1|602465_603332_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003659972.1|603632_606029_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.6	1.0e-178
WP_003657885.1|606145_607297_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_081569815.1|607337_610145_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	28.4	1.7e-15
WP_003659966.1|610148_611282_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	65.8	1.1e-90
WP_003657890.1|611362_611824_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003657892.1|612107_612314_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.3	1.2e-14
WP_081569816.1|612486_614352_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	27.4	6.0e-41
>prophage 38
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	617452	619057	1954607		Indivirus(100.0%)	1	NA	NA
WP_081569817.1|617452_619057_-	glycosyltransferase family 2 protein	NA	A0A1V0SEC5	Indivirus	23.1	1.9e-06
>prophage 39
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	625367	629530	1954607		Burkholderia_virus(50.0%)	3	NA	NA
WP_003657921.1|625367_626897_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	2.7e-15
WP_003657922.1|627129_628758_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_003659947.1|628924_629530_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	69.8	5.5e-68
>prophage 40
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	635170	664981	1954607	protease	Moraxella_phage(27.27%)	25	NA	NA
WP_004463003.1|635170_636943_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	29.5	6.0e-14
WP_003669541.1|636920_638651_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	37.1	1.4e-15
WP_003657946.1|638655_639816_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_081569820.1|639834_640335_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003671259.1|640601_641915_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	100.0	1.3e-218
WP_003657951.1|641993_642581_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	99.4	1.6e-85
WP_003663723.1|642826_644389_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003659915.1|644413_645670_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.2	2.5e-14
WP_003657958.1|645732_646374_-	response regulator	NA	NA	NA	NA	NA
WP_003657959.1|646558_646825_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003657961.1|646848_646995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003665779.1|647114_647813_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003657965.1|648060_650727_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	29.9	1.7e-92
WP_003659910.1|650748_651501_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003657969.1|651529_651724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569821.1|651763_653851_-	toprim domain-containing protein	NA	A0A0K1LMQ9	Caulobacter_phage	35.4	8.6e-36
WP_003657972.1|653959_655030_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003668270.1|655275_656343_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	26.2	1.4e-05
WP_003657975.1|656329_657169_+	laccase domain-containing protein	NA	NA	NA	NA	NA
WP_003665773.1|657253_658021_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_081569822.1|658170_660381_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	54.1	1.6e-205
WP_036378316.1|660507_661269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663483.1|661377_661743_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_003663482.1|661770_664071_+	AAA family ATPase	NA	A0A223W0B1	Agrobacterium_phage	41.9	2.2e-154
WP_081569823.1|664129_664981_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.6	4.4e-23
>prophage 41
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	671131	672649	1954607		Salmonella_phage(100.0%)	1	NA	NA
WP_081570058.1|671131_672649_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	44.1	5.7e-98
>prophage 42
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	682565	689817	1954607	tRNA	Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_003659876.1|682565_683051_+	DUF1643 domain-containing protein	NA	A0A2D2W2H2	Stenotrophomonas_phage	41.2	3.2e-26
WP_081569827.1|683075_684146_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003659871.1|684234_684681_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_003658034.1|684872_685688_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_003659869.1|686033_687557_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.8	8.9e-91
WP_081569828.1|687570_689817_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.8	1.1e-39
>prophage 43
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	695269	697735	1954607		Erythrobacter_phage(50.0%)	2	NA	NA
WP_003659862.1|695269_696430_+	peptidase S11	NA	A0A1P8VVG5	Erythrobacter_phage	29.6	1.2e-10
WP_003658054.1|696598_697735_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.5	9.4e-37
>prophage 44
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	702464	705344	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_081569831.1|702464_705344_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	35.4	2.9e-18
>prophage 45
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	709091	717412	1954607	tRNA	Moraxella_phage(50.0%)	10	NA	NA
WP_003658078.1|709091_709811_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	2.8e-26
WP_003659849.1|709903_710743_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_003659848.1|710787_711666_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_003658085.1|712015_712456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669594.1|712486_713662_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	28.5	7.7e-42
WP_065249022.1|713675_714851_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003658093.1|714932_715073_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_003658094.1|715320_715866_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003658099.1|715981_716197_-	hypothetical protein	NA	A0A0R6PJ49	Moraxella_phage	75.8	6.3e-19
WP_003658103.1|717214_717412_-	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	47.7	9.2e-09
>prophage 46
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	726595	730768	1954607		Catovirus(100.0%)	1	NA	NA
WP_081569835.1|726595_730768_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	2.8e-46
>prophage 47
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	736677	746469	1954607	capsid	Moraxella_phage(100.0%)	15	NA	NA
WP_003662923.1|736677_737091_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJC0	Moraxella_phage	97.8	1.2e-69
WP_081569841.1|737070_737862_-	C40 family peptidase	NA	A0A0R6PH08	Moraxella_phage	92.4	4.8e-149
WP_081569842.1|737978_738632_-	DUF4065 domain-containing protein	NA	A0A0R6PK62	Moraxella_phage	96.3	6.9e-109
WP_003658158.1|738832_739033_+	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	100.0	6.9e-28
WP_003658160.1|739029_739377_-	HK97 gp10 family phage protein	NA	A0A0R6PH46	Moraxella_phage	96.5	5.7e-62
WP_081569843.1|739366_739732_-	glutamate 5-kinase	NA	A0A0R6PH70	Moraxella_phage	86.3	4.3e-52
WP_081569844.1|739733_740093_-	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	92.4	4.1e-55
WP_064622225.1|740153_740357_-	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	98.5	9.8e-30
WP_081569739.1|740367_741384_-	hypothetical protein	NA	A0A0R6PHI9	Moraxella_phage	97.6	1.1e-185
WP_081569738.1|741386_742025_-	hypothetical protein	NA	A0A0R6PHK3	Moraxella_phage	100.0	6.5e-88
WP_081569845.1|742242_743997_-|capsid	minor capsid protein	capsid	A0A0R6PHM5	Moraxella_phage	81.9	2.4e-273
WP_003658173.1|744299_744668_-	hypothetical protein	NA	A0A0R6PKG5	Moraxella_phage	100.0	5.7e-60
WP_081569846.1|744707_744890_-	helix-turn-helix domain-containing protein	NA	A0A0R6PKC6	Moraxella_phage	96.7	4.3e-29
WP_081569847.1|744870_745521_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHA8	Moraxella_phage	94.9	2.8e-118
WP_049155881.1|745572_746469_+	DUF4393 domain-containing protein	NA	A0A0R6PH66	Moraxella_phage	79.4	1.1e-130
>prophage 48
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	751974	754032	1954607		Brevibacillus_phage(100.0%)	1	NA	NA
WP_081569850.1|751974_754032_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	3.4e-29
>prophage 49
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	762560	771365	1954607		Mollivirus(20.0%)	7	NA	NA
WP_003664333.1|762560_764090_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.1	1.3e-78
WP_003658194.1|764155_764668_-	CvpA family protein	NA	NA	NA	NA	NA
WP_003658196.1|764672_765698_-	quinone-dependent dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	23.6	2.4e-07
WP_003673115.1|765755_766349_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.1	6.2e-16
WP_081569853.1|766345_767287_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	32.7	3.8e-15
WP_081569854.1|767414_769538_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_081569855.1|769952_771365_+	insulinase family protein	NA	A0A2P1EIE5	Megavirus	25.7	2.0e-20
>prophage 50
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	777642	781120	1954607		Pithovirus(33.33%)	5	NA	NA
WP_003658211.1|777642_778371_-	LPS export ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.5	3.5e-21
WP_003658213.1|778380_778908_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003664322.1|778939_779515_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003666214.1|779524_780046_-	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	43.2	8.7e-22
WP_081569858.1|780100_781120_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0U4K4N6	Escherichia_phage	37.6	1.5e-22
>prophage 51
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	788091	791086	1954607		Pseudomonas_phage(33.33%)	3	NA	NA
WP_003658236.1|788091_788403_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	G9IAA2	Pseudomonas_phage	38.2	3.0e-06
WP_003658237.1|788481_789612_-	ribonucleotide-diphosphate reductase subunit beta	NA	M4M9S3	Vibrio_phage	68.5	2.8e-150
WP_003658238.1|789850_791086_-	O-succinylhomoserine sulfhydrylase	NA	A0A2I2L687	Orpheovirus	24.7	4.2e-14
>prophage 52
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	799512	802260	1954607		Tupanvirus(100.0%)	1	NA	NA
WP_003658245.1|799512_802260_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	A0A2K9L6P9	Tupanvirus	25.8	1.6e-05
>prophage 53
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	811419	816178	1954607		Tetraselmis_virus(50.0%)	4	NA	NA
WP_003669717.1|811419_812787_+	AarF/ABC1/UbiB kinase family protein	NA	A0A2P0VMP1	Tetraselmis_virus	24.6	6.0e-14
WP_003659719.1|812863_814072_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_003658266.1|814077_814749_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_081569865.1|814879_816178_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.5e-33
>prophage 54
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	822265	828710	1954607	tRNA	Cellulophaga_phage(25.0%)	8	NA	NA
WP_003666257.1|822265_822964_+	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	37.2	1.3e-28
WP_081569868.1|823029_823722_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003671087.1|823851_824253_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003658286.1|824271_824571_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	38.5	3.1e-08
WP_162837132.1|824783_826460_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_081570059.1|826690_827404_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_100190769.1|827447_827993_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	35.3	3.1e-06
WP_081569869.1|828002_828710_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	46.0	1.3e-47
>prophage 55
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	835783	854954	1954607	tRNA	Acinetobacter_phage(33.33%)	18	NA	NA
WP_003658311.1|835783_837727_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-47
WP_003658313.1|837775_838819_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	31.4	1.8e-34
WP_003658315.1|838848_839232_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_003671094.1|839457_840081_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.2	3.4e-73
WP_081569870.1|840213_841305_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.6	1.7e-99
WP_003658320.1|841337_842162_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.3	2.5e-55
WP_003658321.1|842203_843265_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003663566.1|843261_844119_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_081569871.1|844191_844758_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.1	5.0e-15
WP_003668436.1|844908_845895_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_077656087.1|846362_848639_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.7	4.2e-312
WP_003658329.1|848815_849148_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_049155945.1|849148_849745_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_049155948.1|849764_850988_+	HRDC domain-containing protein	NA	NA	NA	NA	NA
WP_003658333.1|850996_851632_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	38.8	1.1e-21
WP_003658335.1|851835_852258_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003658336.1|852270_853614_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003658338.1|853856_854954_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	51.7	6.0e-49
>prophage 56
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	860693	861125	1954607		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003658352.1|860693_861125_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.5e-19
>prophage 57
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	864279	865110	1954607		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_036331804.1|864279_865110_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	27.9	4.6e-25
>prophage 58
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	868894	874579	1954607		Streptococcus_phage(33.33%)	7	NA	NA
WP_003656804.1|868894_869866_-	DNA polymerase III subunit	NA	M1NSC1	Streptococcus_phage	32.9	2.8e-13
WP_003656802.1|869862_870444_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081569872.1|870452_871214_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003673081.1|871324_872362_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003656797.1|872395_873436_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	28.9	2.0e-09
WP_003668450.1|873505_873787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081569873.1|873793_874579_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.8	1.7e-13
>prophage 59
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	881778	883068	1954607		Megavirus(100.0%)	1	NA	NA
WP_003656780.1|881778_883068_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.2	1.8e-68
>prophage 60
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	889743	892206	1954607		Moraxella_phage(100.0%)	1	NA	NA
WP_003669757.1|889743_892206_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	99.8	0.0e+00
>prophage 61
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	900408	901488	1954607		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003656748.1|900408_901488_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	51.7	6.0e-09
>prophage 62
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	910000	910930	1954607		Moraxella_phage(100.0%)	1	NA	NA
WP_081569891.1|910000_910930_-	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	73.6	1.2e-18
>prophage 63
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	916167	917118	1954607		Moraxella_phage(100.0%)	1	NA	NA
WP_081569881.1|916167_917118_-	hemolysin	NA	A0A0R6PJK4	Moraxella_phage	62.0	1.6e-05
>prophage 64
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	920239	921031	1954607		Moraxella_phage(100.0%)	1	NA	NA
WP_081570061.1|920239_921031_-	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	45.3	4.6e-14
>prophage 65
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	938288	961895	1954607		Moraxella_phage(100.0%)	20	NA	NA
WP_081569888.1|938288_943955_-	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	95.0	0.0e+00
WP_003666808.1|944322_944607_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_042510287.1|944634_944844_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003669938.1|944877_945189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003656612.1|945245_945431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656609.1|945913_946135_+	hypothetical protein	NA	A0A0R6PHZ1	Moraxella_phage	100.0	1.5e-31
WP_081569889.1|946170_948207_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	99.0	7.5e-303
WP_081569890.1|948351_953157_+	DUF637 domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	96.6	0.0e+00
WP_003659549.1|953158_953581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569891.1|953816_954746_+	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	73.6	1.2e-18
WP_081569879.1|954753_955125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003665073.1|956092_956494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569892.1|956626_957829_+	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	96.4	1.3e-20
WP_003668581.1|957841_958519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172830163.1|958610_958826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003657704.1|959025_959319_+	barstar family protein	NA	NA	NA	NA	NA
WP_003657703.1|959424_959586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569893.1|959619_960246_+	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	80.0	1.8e-05
WP_003657701.1|960248_960806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081569894.1|960983_961895_+	VENN motif pre-toxin domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	78.6	2.9e-20
>prophage 66
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	968298	968955	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_003657693.1|968298_968955_+	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	29.9	9.9e-07
>prophage 67
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	975475	976093	1954607		Planktothrix_phage(100.0%)	1	NA	NA
WP_036350853.1|975475_976093_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.1	2.5e-15
>prophage 68
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	980162	981701	1954607		Escherichia_phage(100.0%)	1	NA	NA
WP_003659504.1|980162_981701_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.3	2.8e-20
>prophage 69
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1004320	1008087	1954607	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_003672328.1|1004320_1006048_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.1	1.2e-86
WP_081569900.1|1006259_1007081_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_003659471.1|1007337_1008087_+	glutathione peroxidase	NA	M1TUY3	Synechococcus_phage	53.1	4.7e-45
>prophage 70
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1025505	1028819	1954607		uncultured_virus(50.0%)	4	NA	NA
WP_003664410.1|1025505_1025718_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.8	2.9e-08
WP_003659445.1|1025742_1026624_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003659443.1|1026662_1027298_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003656566.1|1027463_1028819_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.6	9.8e-17
>prophage 71
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1047823	1055946	1954607	protease	Pandoravirus(33.33%)	7	NA	NA
WP_036350848.1|1047823_1048714_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.8	3.7e-20
WP_003672298.1|1048817_1050227_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003661477.1|1050286_1051192_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003656667.1|1051373_1052285_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	61.8	6.4e-36
WP_003656668.1|1052526_1053219_-	LrgB family protein	NA	NA	NA	NA	NA
WP_003656669.1|1053218_1053632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656671.1|1054065_1055946_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	4.1e-37
>prophage 72
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1063618	1064714	1954607		Pseudomonas_phage(100.0%)	1	NA	NA
WP_100185532.1|1063618_1064714_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	8.8e-08
>prophage 73
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1068615	1079115	1954607	tRNA	Acinetobacter_phage(16.67%)	10	NA	NA
WP_081569911.1|1068615_1070472_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	36.7	2.0e-68
WP_003671548.1|1070608_1072366_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.9	4.2e-169
WP_003656692.1|1072567_1073077_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.4	9.4e-13
WP_003656695.1|1073078_1073876_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_003659394.1|1073976_1074555_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_003656697.1|1074896_1075484_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.6	1.6e-24
WP_003656698.1|1075668_1076331_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_003661486.1|1076657_1077818_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	3.2e-125
WP_003659388.1|1078037_1078382_+	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_081569912.1|1078437_1079115_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.1	4.0e-35
>prophage 74
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1084087	1084498	1954607	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_003668001.1|1084087_1084498_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.2	1.1e-43
>prophage 75
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1088159	1101477	1954607		Rhodococcus_phage(16.67%)	12	NA	NA
WP_003659373.1|1088159_1089053_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	31.3	7.1e-32
WP_003666078.1|1089085_1089961_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003666076.1|1090004_1091066_-	TIGR02584 family CRISPR-associated protein	NA	A0A2K9L4C1	Tupanvirus	38.9	2.8e-27
WP_003659370.1|1091487_1092105_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	56.0	2.3e-58
WP_003659368.1|1092508_1093366_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_003666073.1|1093362_1094007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003660612.1|1094027_1095668_+	2-octaprenylphenol hydroxylase	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	24.9	3.7e-26
WP_003659362.1|1095697_1096204_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	37.7	3.1e-16
WP_003660615.1|1096356_1096647_-	YeaC family protein	NA	NA	NA	NA	NA
WP_081569913.1|1096677_1097655_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_081569914.1|1098008_1098728_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_081569915.1|1098831_1101477_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	26.0	3.7e-52
>prophage 76
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1115593	1126224	1954607		Lake_Baikal_phage(33.33%)	10	NA	NA
WP_003659336.1|1115593_1117192_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	6.7e-65
WP_065248915.1|1117311_1119165_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003659331.1|1119329_1119602_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	58.9	3.2e-20
WP_003659328.1|1120077_1120755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659326.1|1120950_1121457_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003659325.1|1121453_1122677_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.3	5.6e-27
WP_003659322.1|1122853_1123237_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.8	2.9e-51
WP_003659320.1|1123346_1123667_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.7e-23
WP_003660641.1|1123693_1124212_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003667971.1|1124364_1126224_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.4	2.3e-96
>prophage 77
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1133424	1146964	1954607	tRNA,transposase	Bodo_saltans_virus(16.67%)	13	NA	NA
WP_003659300.1|1133424_1134813_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	8.6e-101
WP_003660657.1|1134917_1135133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667960.1|1135425_1138107_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	6.0e-82
WP_003660664.1|1138406_1139972_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	51.1	6.7e-142
WP_003659287.1|1140293_1140578_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003659286.1|1140909_1142193_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003659285.1|1142408_1142660_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	1.0e-12
WP_003659283.1|1142674_1143022_+	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_003659282.1|1143282_1143519_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003659281.1|1143558_1143714_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_081569920.1|1143794_1144550_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_003659279.1|1145249_1145918_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	4.1e-24
WP_003659278.1|1145917_1146964_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.2	2.2e-80
>prophage 78
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1154114	1157200	1954607		Tupanvirus(50.0%)	2	NA	NA
WP_081569922.1|1154114_1154315_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	48.4	7.7e-11
WP_081569923.1|1155055_1157200_-	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	28.4	1.6e-58
>prophage 79
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1160515	1161267	1954607	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_120649228.1|1160515_1161267_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.5	7.1e-25
>prophage 80
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1185005	1185752	1954607		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003663268.1|1185005_1185752_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.5	8.9e-20
>prophage 81
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1189613	1204059	1954607	tRNA	uncultured_Mediterranean_phage(20.0%)	17	NA	NA
WP_003660708.1|1189613_1190882_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	4.6e-93
WP_003663271.1|1191111_1191765_+	YcxB family protein	NA	NA	NA	NA	NA
WP_081569926.1|1191764_1192181_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_003659204.1|1192365_1193481_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.6	1.6e-44
WP_003659203.1|1193558_1193942_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003659201.1|1193978_1194179_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_081569927.1|1194417_1195272_+	carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
WP_003663276.1|1195312_1195987_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_003659197.1|1195983_1196742_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	30.3	1.4e-07
WP_172830164.1|1196933_1197659_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_081569928.1|1197694_1198600_+	histone deacetylase	NA	NA	NA	NA	NA
WP_081569929.1|1198596_1198974_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_064621273.1|1198963_1199236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081569930.1|1199305_1199920_-	DUF4326 domain-containing protein	NA	A0A0A0YQT2	Escherichia_phage	36.2	2.0e-09
WP_081569931.1|1199916_1200372_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_081569932.1|1200385_1201063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081569933.1|1201131_1204059_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.2	4.4e-147
>prophage 82
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1208719	1209307	1954607		Roseobacter_phage(100.0%)	1	NA	NA
WP_003669210.1|1208719_1209307_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0UZW5	Roseobacter_phage	47.8	4.9e-05
>prophage 83
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1215485	1216793	1954607		Enterobacteria_phage(100.0%)	1	NA	NA
WP_070472794.1|1215485_1216793_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	60.9	1.8e-140
>prophage 84
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1220151	1223439	1954607	tRNA	Megavirus(100.0%)	1	NA	NA
WP_081569937.1|1220151_1223439_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	23.8	5.4e-69
>prophage 85
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1230305	1231778	1954607		Klosneuvirus(100.0%)	1	NA	NA
WP_003659156.1|1230305_1231778_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.7	7.3e-90
>prophage 86
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1235628	1240418	1954607	tRNA	Streptococcus_phage(20.0%)	6	NA	NA
WP_081569938.1|1235628_1236465_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.2	1.1e-50
WP_003673648.1|1236490_1236937_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	41.8	1.1e-14
WP_064601942.1|1237030_1237291_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.9	5.8e-19
WP_003659143.1|1237295_1238036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660765.1|1238010_1238994_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0K1LQ98	Klebsiella_phage	32.0	3.3e-38
WP_003672143.1|1239008_1240418_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	61.4	1.8e-122
>prophage 87
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1254200	1255901	1954607		Vibrio_phage(100.0%)	1	NA	NA
WP_003659108.1|1254200_1255901_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.5	3.8e-26
>prophage 88
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1259546	1260806	1954607		Tupanvirus(100.0%)	1	NA	NA
WP_003659102.1|1259546_1260806_-	EstA family serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	25.8	1.2e-05
>prophage 89
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1264939	1265929	1954607		uncultured_virus(100.0%)	1	NA	NA
WP_003660790.1|1264939_1265929_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	1.7e-05
>prophage 90
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1270562	1281394	1954607	tRNA	Escherichia_phage(20.0%)	10	NA	NA
WP_003659089.1|1270562_1271732_+|tRNA	tRNA nucleotidyltransferase	tRNA	A0A076G5T8	Escherichia_phage	34.4	1.7e-49
WP_003659088.1|1271748_1272516_+	pteridine reductase	NA	M1NMS3	Moumouvirus	32.6	2.6e-06
WP_081569941.1|1272815_1274204_+	APC family permease	NA	NA	NA	NA	NA
WP_172830165.1|1274337_1274940_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003659082.1|1275438_1276617_+	fatty acid desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	33.1	5.2e-30
WP_081569943.1|1276710_1278207_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.4	7.0e-40
WP_003666384.1|1278358_1278541_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_003672915.1|1278537_1279392_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003660807.1|1279432_1280263_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003663311.1|1280275_1281394_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.1e-32
>prophage 91
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1284932	1286867	1954607		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003660815.1|1284932_1286867_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.8	9.8e-111
>prophage 92
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1290586	1295128	1954607		Bathycoccus_sp._RCC1105_virus(50.0%)	5	NA	NA
WP_003665239.1|1290586_1292482_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	47.2	1.9e-106
WP_003659062.1|1292602_1293235_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003659060.1|1293377_1293695_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_003659059.1|1293703_1294360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003660818.1|1294450_1295128_-	CHAP domain-containing protein	NA	D5GW25	Campylobacter_virus	38.5	9.9e-10
>prophage 93
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1300025	1300382	1954607		Rhodobacter_phage(100.0%)	1	NA	NA
WP_081570063.1|1300025_1300382_-	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	35.3	7.0e-07
>prophage 94
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1310398	1310947	1954607		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003659025.1|1310398_1310947_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.7	2.8e-18
>prophage 95
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1313995	1315051	1954607		Streptococcus_phage(100.0%)	1	NA	NA
WP_081569947.1|1313995_1315051_+	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.1	5.1e-13
>prophage 96
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1318859	1321129	1954607		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_081569951.1|1318859_1319879_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	31.8	2.9e-29
WP_003659009.1|1320130_1321129_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	2.4e-44
>prophage 97
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1327697	1329251	1954607		Catovirus(100.0%)	1	NA	NA
WP_081569953.1|1327697_1329251_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	7.9e-79
>prophage 98
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1337253	1341168	1954607		Bacillus_phage(100.0%)	3	NA	NA
WP_003660872.1|1337253_1338684_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.3	2.7e-09
WP_003660874.1|1338670_1340443_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003658977.1|1340454_1341168_-	response regulator	NA	W8CYM9	Bacillus_phage	35.9	1.2e-37
>prophage 99
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1351140	1351917	1954607		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003658950.1|1351140_1351917_+	metal ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.3	5.5e-12
>prophage 100
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1358711	1376528	1954607		Erysipelothrix_phage(20.0%)	14	NA	NA
WP_003669361.1|1358711_1360256_-	aspartate aminotransferase family protein	NA	M1HBY3	Acanthocystis_turfacea_Chlorella_virus	25.3	2.0e-05
WP_081569958.1|1360318_1362913_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.1	5.3e-136
WP_081569959.1|1362928_1364902_-	PT domain-containing protein	NA	A0A2K5B2C1	Erysipelothrix_phage	39.9	1.7e-110
WP_003657856.1|1365027_1366404_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.3	1.2e-22
WP_003662729.1|1366890_1367607_+	7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	35.7	1.1e-22
WP_003657851.1|1367716_1368358_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_081569960.1|1368396_1370166_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.8	3.8e-61
WP_003658904.1|1370165_1371107_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_003658903.1|1371273_1371903_+	guanylate kinase	NA	G0XXC0	Cowpox_virus	29.6	6.6e-16
WP_003657843.1|1371990_1372263_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003662724.1|1372548_1374735_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	40.2	2.4e-12
WP_003657840.1|1374830_1375010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003657838.1|1375038_1375419_+	RidA family protein	NA	A0A0B5J199	Pandoravirus	42.4	7.0e-05
WP_003657836.1|1375622_1376528_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.0	3.2e-19
>prophage 101
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1384871	1386563	1954607		Agrobacterium_phage(100.0%)	1	NA	NA
WP_081569962.1|1384871_1386563_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	6.4e-90
>prophage 102
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1391878	1394947	1954607	tRNA	Moraxella_phage(100.0%)	2	NA	NA
WP_081569964.1|1391878_1393525_-	YadA-like family protein	NA	A0A0R6PIA9	Moraxella_phage	56.8	2.7e-45
WP_081569965.1|1393900_1394947_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	99.7	1.2e-200
>prophage 103
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1399343	1403262	1954607		Moraxella_phage(50.0%)	4	NA	NA
WP_003671647.1|1399343_1399544_-	hypothetical protein	NA	A0A0R6PCD3	Moraxella_phage	92.4	2.0e-27
WP_003658862.1|1399602_1400568_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003657797.1|1401099_1402164_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003668336.1|1402323_1403262_+	alpha/beta fold hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	23.5	4.4e-08
>prophage 104
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1410091	1411141	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_003658848.1|1410091_1411141_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.8	2.5e-113
>prophage 105
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1431871	1435090	1954607		Planktothrix_phage(50.0%)	3	NA	NA
WP_081569975.1|1431871_1432891_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.3e-25
WP_003656432.1|1432949_1433147_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_081569976.1|1433533_1435090_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.9	2.6e-37
>prophage 106
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1455329	1470746	1954607		Moraxella_phage(33.33%)	7	NA	NA
WP_003656479.1|1455329_1455488_+	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	100.0	3.5e-19
WP_003656482.1|1455614_1457789_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	100.0	0.0e+00
WP_065249085.1|1458024_1459098_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_081569979.1|1459337_1460708_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.5e-38
WP_003658761.1|1460895_1462122_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	45.1	1.4e-94
WP_003663189.1|1462336_1466575_-	DNA-directed RNA polymerase subunit beta'	NA	A0A0N9QZ01	Chrysochromulina_ericina_virus	62.8	7.1e-05
WP_003656492.1|1466654_1470746_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	30.0	3.3e-23
>prophage 107
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1474953	1485570	1954607		Moraxella_phage(28.57%)	13	NA	NA
WP_003656211.1|1474953_1476144_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.5	6.2e-31
WP_003656274.1|1477049_1477307_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003658746.1|1477407_1478298_+	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	99.7	6.6e-171
WP_065249161.1|1478300_1479233_+	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	99.3	1.0e-150
WP_003658744.1|1479229_1479589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658741.1|1479590_1479998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003656268.1|1479997_1480477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003658739.1|1480529_1482041_-	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	31.4	8.9e-35
WP_003658736.1|1482394_1482715_-	NIF3 1	NA	A0A2P1EK93	Megavirus	41.6	3.6e-18
WP_003656263.1|1482754_1483465_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	35.5	5.9e-37
WP_003656261.1|1483518_1483791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656259.1|1483863_1484769_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003663695.1|1484949_1485570_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.7	3.5e-30
>prophage 108
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1491533	1496059	1954607		Orpheovirus(33.33%)	3	NA	NA
WP_013107689.1|1491533_1492484_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	3.4e-64
WP_003656211.1|1492621_1493812_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	26.5	6.2e-31
WP_003656379.1|1493932_1496059_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.2	3.0e-52
>prophage 109
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1501301	1504493	1954607		Pandoravirus(50.0%)	2	NA	NA
WP_003661780.1|1501301_1502681_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	37.6	3.7e-27
WP_003661782.1|1502696_1504493_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	47.2	1.0e-162
>prophage 110
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1518235	1519540	1954607		Klosneuvirus(100.0%)	1	NA	NA
WP_081569987.1|1518235_1519540_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	25.7	8.6e-10
>prophage 111
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1525024	1526152	1954607		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003667007.1|1525024_1526152_-	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	37.5	4.4e-63
>prophage 112
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1530064	1530835	1954607		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003665033.1|1530064_1530835_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	25.2	1.2e-11
>prophage 113
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1542811	1549357	1954607		Tupanvirus(33.33%)	6	NA	NA
WP_003656314.1|1542811_1543765_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	8.1e-42
WP_003664055.1|1543811_1544327_-	cytochrome b	NA	NA	NA	NA	NA
WP_003656310.1|1544540_1545545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003656306.1|1545739_1546462_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	1.6e-34
WP_003656304.1|1546597_1548163_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_065249180.1|1548310_1549357_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.3	2.7e-30
>prophage 114
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1553468	1558456	1954607		Ralstonia_phage(33.33%)	3	NA	NA
WP_003671435.1|1553468_1554620_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	48.0	1.5e-98
WP_003669976.1|1554710_1555421_-	single-stranded DNA-binding protein	NA	A0A0R6PHK0	Moraxella_phage	66.9	4.8e-39
WP_003663425.1|1555582_1558456_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.5	8.9e-302
>prophage 115
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1568094	1576707	1954607		Hokovirus(25.0%)	6	NA	NA
WP_049156429.1|1568094_1571061_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.3	7.9e-43
WP_003656842.1|1571178_1572108_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.6	1.5e-48
WP_003656844.1|1572116_1572890_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003656846.1|1572901_1573126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081569993.1|1573412_1574906_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.9	1.2e-31
WP_003656854.1|1574961_1576707_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.0	5.8e-54
>prophage 116
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1579777	1586424	1954607	tRNA	Bacillus_virus(33.33%)	6	NA	NA
WP_003670694.1|1579777_1580686_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	32.2	3.3e-32
WP_003656862.1|1580732_1581701_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_003656864.1|1582025_1582286_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003656865.1|1582498_1582795_-	integration host factor subunit alpha	NA	A3E2K9	Sodalis_phage	39.5	1.3e-11
WP_003667269.1|1582943_1585340_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003656869.1|1585392_1586424_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.7	5.2e-34
>prophage 117
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1600476	1601964	1954607		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004460820.1|1600476_1601964_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	34.1	2.8e-73
>prophage 118
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1609606	1613551	1954607		Burkholderia_phage(100.0%)	1	NA	NA
WP_081569997.1|1609606_1613551_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	48.7	1.8e-98
>prophage 119
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1619615	1621133	1954607		Klosneuvirus(50.0%)	2	NA	NA
WP_003672797.1|1619615_1620161_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	31.6	4.0e-17
WP_156878896.1|1620422_1621133_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.3	2.3e-09
>prophage 120
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1627646	1630025	1954607		Catovirus(50.0%)	2	NA	NA
WP_081570003.1|1627646_1628951_-	50S ribosome-binding GTPase	NA	A0A1V0SA87	Catovirus	26.5	2.3e-18
WP_003661064.1|1629101_1630025_-	sulfate adenylyltransferase subunit CysD	NA	M4W6M9	Bacillus_phage	23.1	1.4e-06
>prophage 121
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1637465	1639445	1954607	protease	Bacillus_virus(50.0%)	2	NA	NA
WP_081570006.1|1637465_1638782_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	7.1e-129
WP_003661044.1|1638791_1639445_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.0	3.5e-60
>prophage 122
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1642839	1648077	1954607		Klosneuvirus(100.0%)	3	NA	NA
WP_003667294.1|1642839_1644963_+	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	25.2	4.2e-46
WP_003661034.1|1644967_1645201_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003661030.1|1645389_1648077_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.6	1.5e-45
>prophage 123
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1655580	1657029	1954607		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003661018.1|1655580_1657029_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	4.0e-40
>prophage 124
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1667423	1671546	1954607		uncultured_virus(50.0%)	3	NA	NA
WP_003662116.1|1667423_1668122_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	57.2	1.7e-44
WP_081570008.1|1668182_1670549_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_141562004.1|1670832_1671546_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	4.5e-29
>prophage 125
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1676276	1680153	1954607		Streptococcus_phage(50.0%)	4	NA	NA
WP_003670064.1|1676276_1676870_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.9	2.1e-19
WP_003662138.1|1677038_1677743_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003662140.1|1677756_1678758_+	DsbC family protein	NA	NA	NA	NA	NA
WP_003662144.1|1679001_1680153_+	molecular chaperone DnaJ	NA	A0A2K9V7V1	Bandra_megavirus	54.5	1.0e-14
>prophage 126
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1684439	1687236	1954607		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_077655965.1|1684439_1685279_-	DnaJ domain-containing protein	NA	Q8QNB4	Ectocarpus_siliculosus_virus	39.6	1.1e-05
WP_081570011.1|1685286_1687236_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.2	1.4e-67
>prophage 127
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1693175	1694515	1954607		Bacillus_virus(50.0%)	2	NA	NA
WP_003662165.1|1693175_1694036_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	1.6e-28
WP_003662167.1|1694182_1694515_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.4	3.2e-22
>prophage 128
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1700227	1708105	1954607		Vibrio_phage(100.0%)	5	NA	NA
WP_081570014.1|1700227_1701235_-	type I-F CRISPR-associated protein Csy3	NA	A0A2I7RCY7	Vibrio_phage	36.6	5.7e-46
WP_003662185.1|1701269_1702205_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_077655961.1|1702201_1703572_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_003667349.1|1703739_1707153_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.6	4.9e-81
WP_081570015.1|1707154_1708105_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	36.6	1.4e-49
>prophage 129
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1712828	1714736	1954607		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003669031.1|1712828_1714736_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.2	2.1e-150
>prophage 130
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1719682	1721524	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_081570018.1|1719682_1721524_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.1e-25
>prophage 131
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1726828	1737349	1954607		Only_Syngen_Nebraska_virus(20.0%)	8	NA	NA
WP_003664140.1|1726828_1728004_-	type III PLP-dependent enzyme	NA	A0A1J0F9F1	Only_Syngen_Nebraska_virus	32.6	8.8e-38
WP_003662217.1|1728145_1728505_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003664138.1|1728518_1729013_-	septal ring lytic transglycosylase RlpA family protein	NA	A0A0R6PCU3	Moraxella_phage	76.4	6.7e-40
WP_003669017.1|1729279_1730497_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_003672771.1|1730649_1732209_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.8	1.8e-22
WP_081570021.1|1732382_1734842_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	2.4e-114
WP_081570022.1|1734979_1736188_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_003664128.1|1736191_1737349_-	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	27.3	1.3e-33
>prophage 132
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1744336	1747496	1954607	tRNA	Orpheovirus(33.33%)	3	NA	NA
WP_081570024.1|1744336_1745389_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	36.1	2.5e-52
WP_003666743.1|1745671_1746340_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.9	7.2e-29
WP_063453862.1|1746470_1747496_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.0	5.7e-09
>prophage 133
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1750568	1755356	1954607		Thermus_phage(33.33%)	5	NA	NA
WP_003664100.1|1750568_1751813_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	2.5e-30
WP_065249223.1|1751799_1752414_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_003662260.1|1752481_1752742_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003666749.1|1752908_1754003_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	33.6	3.2e-50
WP_081570027.1|1754117_1755356_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.5	4.8e-79
>prophage 134
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1759597	1771822	1954607	tRNA	Oenococcus_phage(33.33%)	12	NA	NA
WP_064602417.1|1759597_1760530_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	31.8	3.8e-28
WP_003664074.1|1760571_1761825_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.7e-29
WP_081570067.1|1761994_1762471_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_081570029.1|1762740_1763541_-	cation transporter	NA	NA	NA	NA	NA
WP_081570030.1|1763711_1764824_-	NgoFVII family restriction endonuclease	NA	V5US45	Oenococcus_phage	27.9	2.8e-33
WP_081570031.1|1764816_1765773_-	DNA (cytosine-5-)-methyltransferase	NA	V5URQ5	Oenococcus_phage	51.8	1.6e-77
WP_155733607.1|1765862_1766012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570032.1|1766075_1767311_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003662295.1|1767472_1768693_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	28.0	1.2e-26
WP_003673441.1|1769198_1770041_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003658715.1|1770077_1770920_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003664066.1|1770916_1771822_-	metal ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.9	8.9e-14
>prophage 135
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1782871	1786846	1954607		Bacillus_virus(50.0%)	4	NA	NA
WP_003664013.1|1782871_1784761_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.5	6.2e-94
WP_003660400.1|1784841_1785468_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_162837176.1|1785477_1786071_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003657187.1|1786291_1786846_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.9	6.2e-18
>prophage 136
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1790515	1791439	1954607		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003657196.1|1790515_1791439_+	site-specific tyrosine recombinase XerD	NA	A0A0F6SJK8	Mycobacterium_phage	30.9	5.9e-21
>prophage 137
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1794875	1805171	1954607		Streptococcus_phage(28.57%)	10	NA	NA
WP_003657203.1|1794875_1795733_+	SPFH/Band 7/PHB domain protein	NA	A0A1V0SB59	Catovirus	29.3	2.7e-12
WP_003657205.1|1795801_1797226_-	phosphomannomutase/phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	23.5	7.9e-09
WP_003657210.1|1797731_1798661_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	56.5	2.2e-84
WP_003671881.1|1798731_1799571_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003660410.1|1799560_1799899_+	ComEA family DNA-binding protein	NA	A0A2P1N0L0	Streptomyces_phage	45.1	8.2e-05
WP_003664785.1|1800077_1801877_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	35.6	1.7e-24
WP_003657217.1|1801873_1802362_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003657219.1|1802508_1803351_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	35.0	1.8e-37
WP_003660414.1|1803360_1804203_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003657222.1|1804283_1805171_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	2.1e-07
>prophage 138
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1815666	1817178	1954607		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003657249.1|1815666_1817178_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.5	5.2e-51
>prophage 139
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1824990	1825857	1954607		Bacillus_phage(100.0%)	1	NA	NA
WP_003663458.1|1824990_1825857_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	41.4	1.7e-46
>prophage 140
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1831055	1834045	1954607		Tupanvirus(50.0%)	2	NA	NA
WP_081570040.1|1831055_1832126_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.4	6.4e-88
WP_065251986.1|1832206_1834045_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	45.1	3.3e-132
>prophage 141
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1837876	1839535	1954607		Indivirus(100.0%)	1	NA	NA
WP_081570042.1|1837876_1839535_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SEE0	Indivirus	28.1	1.7e-34
>prophage 142
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1842883	1844315	1954607		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003662899.1|1842883_1843378_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	50.0	4.4e-31
WP_003657285.1|1843541_1844315_-	imidazole glycerol phosphate synthase subunit HisF	NA	A0A1V0SIZ6	Klosneuvirus	24.3	2.0e-06
>prophage 143
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1862203	1864942	1954607		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_081570044.1|1862203_1864942_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	22.9	1.8e-25
>prophage 144
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1878417	1881766	1954607		Klosneuvirus(50.0%)	3	NA	NA
WP_003657345.1|1878417_1879074_+	ATP phosphoribosyltransferase	NA	A0A1V0SIZ6	Klosneuvirus	25.2	5.8e-07
WP_003660486.1|1879272_1880580_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_003660488.1|1880668_1881766_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	24.2	3.2e-18
>prophage 145
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1886480	1886801	1954607		Streptomyces_phage(100.0%)	1	NA	NA
WP_003657354.1|1886480_1886801_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	1.2e-21
>prophage 146
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1891939	1897909	1954607		Bacillus_phage(75.0%)	6	NA	NA
WP_003660498.1|1891939_1893079_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	36.0	1.4e-43
WP_003657367.1|1893186_1894149_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003660500.1|1894159_1895032_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003657370.1|1895133_1895940_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.8	4.2e-15
WP_003657372.1|1896170_1896863_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.6	3.3e-37
WP_003657373.1|1896862_1897909_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	36.0	2.9e-32
>prophage 147
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1904027	1905023	1954607		Bacillus_virus(100.0%)	1	NA	NA
WP_003660511.1|1904027_1905023_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	6.7e-31
>prophage 148
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1909586	1915712	1954607		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_081570049.1|1909586_1911662_+	NAD-dependent DNA ligase LigA	NA	A0A1Y0SVC9	Pseudomonas_phage	39.8	2.3e-126
WP_003657390.1|1911664_1912549_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003663623.1|1912584_1913229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660526.1|1913269_1913734_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.7	2.5e-28
WP_003657395.1|1914014_1914797_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_003657396.1|1914957_1915452_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.7	9.7e-31
WP_003657397.1|1915460_1915712_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.8	7.9e-21
>prophage 149
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1923919	1927689	1954607		Streptococcus_phage(50.0%)	3	NA	NA
WP_003657149.1|1923919_1925734_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.0	1.3e-19
WP_003658710.1|1925791_1926886_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003658709.1|1926900_1927689_+	ribonuclease III	NA	A9YW43	Ostreococcus_tauri_virus	36.9	3.0e-18
>prophage 150
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1932206	1935635	1954607		Tupanvirus(100.0%)	2	NA	NA
WP_003657135.1|1932206_1934051_+	translational GTPase TypA	NA	A0A2K9L6L3	Tupanvirus	34.2	6.2e-22
WP_081570050.1|1934273_1935635_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	34.6	1.2e-33
>prophage 151
NZ_CP018059	Moraxella catarrhalis strain CCRI-195ME chromosome, complete genome	1954607	1939855	1952497	1954607		Planktothrix_phage(20.0%)	7	NA	NA
WP_003657123.1|1939855_1940629_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.8	1.1e-28
WP_081570052.1|1941008_1943609_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	45.0	4.0e-75
WP_003657119.1|1943618_1944215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003657116.1|1944371_1946999_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	35.3	6.0e-95
WP_081570053.1|1947333_1950213_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	31.2	2.1e-69
WP_003662663.1|1950317_1950626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003657110.1|1950910_1952497_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.8	1.8e-30
