The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	639919	718674	3055892	holin,integrase,transposase,terminase,head,tail,portal,capsid	Lactobacillus_phage(68.97%)	87	643603:643618	715904:715919
WP_071252206.1|639919_640333_-|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	99.3	8.9e-46
WP_003581984.1|640347_640623_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_032779081.1|640678_640810_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_081528585.1|640802_641078_-	hypothetical protein	NA	NA	NA	NA	NA
643603:643618	attL	AGAAAAAGCTGTTCAT	NA	NA	NA	NA
WP_081528586.1|644653_646807_-|tail	phage tail family protein	tail	A0A0P0IZA1	Lactobacillus_phage	59.7	3.7e-236
WP_081528587.1|646809_649899_-	tape measure protein	NA	A0A0N7IR83	Lactobacillus_phage	91.4	5.5e-265
WP_003575574.1|649891_650245_-	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	94.0	4.5e-54
WP_003575575.1|650349_650682_-|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	100.0	7.9e-53
WP_003575577.1|650819_651419_-|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	96.5	3.1e-100
WP_003605840.1|651430_651835_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	97.8	8.7e-70
WP_003605842.1|651835_652201_-	hypothetical protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	6.9e-58
WP_003605843.1|652197_652500_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	90.0	1.2e-47
WP_003605845.1|652504_652879_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	98.4	4.3e-63
WP_019895378.1|652878_653757_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	98.6	3.2e-178
WP_003605849.1|653760_654138_-	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	100.0	7.4e-31
WP_003605851.1|654267_655308_-|capsid	major capsid protein	capsid	A0A0P0I7J2	Lactobacillus_phage	99.4	4.4e-190
WP_019892302.1|655321_655636_-	hypothetical protein	NA	A0A0P0HRE3	Lactobacillus_phage	96.2	1.5e-48
WP_081528588.1|655648_656287_-	DUF4355 domain-containing protein	NA	A0A0P0IQJ5	Lactobacillus_phage	94.8	1.2e-81
WP_081528589.1|656411_657404_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	97.9	1.7e-183
WP_081528872.1|657369_658797_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	97.5	3.9e-258
WP_081528590.1|658801_660055_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.0	8.5e-249
WP_003575605.1|660038_660728_-	helix-turn-helix domain-containing protein	NA	A0A1S5SAA7	Streptococcus_phage	48.9	8.2e-44
WP_016375254.1|660796_660958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071252591.1|661113_662262_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	96.9	4.9e-219
WP_016375957.1|662722_663346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071253136.1|663797_664226_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012491447.1|664400_664598_-	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	100.0	2.8e-29
WP_003595403.1|664739_665000_-	hypothetical protein	NA	C1KFT6	Lactobacillus_virus	86.0	3.8e-34
WP_003605864.1|665106_665265_-	hypothetical protein	NA	A8YQM9	Lactobacillus_phage	90.4	4.2e-20
WP_019892349.1|665544_665910_-	hypothetical protein	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	6.9e-66
WP_019892351.1|665906_666161_-	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	98.8	5.9e-40
WP_060417213.1|666207_666657_-	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	98.7	1.3e-71
WP_003595416.1|666653_666986_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	79.1	1.5e-40
WP_003585034.1|666982_667765_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.9	1.1e-132
WP_081528591.1|667751_668603_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	94.4	1.5e-103
WP_016380253.1|668618_669419_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	93.6	9.5e-145
WP_081528592.1|669399_670263_-	recombinase RecT	NA	A0A1B0YA63	Lactobacillus_phage	98.3	1.1e-157
WP_003594180.1|670275_670683_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	98.5	1.2e-74
WP_081528593.1|670675_670927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003594176.1|671055_671277_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	100.0	1.8e-37
WP_060417208.1|671255_671804_-	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
WP_081528594.1|671869_672595_-	antA/AntB antirepressor family protein	NA	U5U413	Lactobacillus_phage	53.2	6.6e-44
WP_081528595.1|672587_672935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528596.1|672934_673138_-	helix-turn-helix transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	47.5	3.1e-07
WP_081528873.1|673283_673517_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	34.2	2.4e-08
WP_081528597.1|673513_674197_+	hypothetical protein	NA	A0A1L2JZ52	Aeribacillus_phage	25.1	2.0e-05
WP_081528598.1|674590_674833_-	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	54.4	2.7e-10
WP_003607004.1|674968_675400_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	39.9	9.4e-22
WP_081528599.1|675400_675847_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_149349896.1|675892_676696_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_081528601.1|676775_677132_+	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	95.7	9.1e-55
WP_081528602.1|677214_678558_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	96.6	6.4e-194
WP_081528603.1|678610_679387_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_081528604.1|679360_679519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574518.1|679655_680081_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
WP_060611504.1|680104_680308_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	97.0	5.5e-33
WP_081528605.1|680397_681582_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
WP_003566494.1|681707_683048_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003566496.1|683261_684119_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003569888.1|684290_684896_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003569886.1|685361_687617_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.7	9.5e-158
WP_003585070.1|687702_688449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566504.1|688458_689028_+	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003566506.1|689149_690445_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	4.2e-17
WP_003569875.1|690514_691624_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003566511.1|691644_692973_-	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_016368445.1|693206_694223_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.1e-35
WP_016367160.1|694940_695582_-	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	46.4	3.2e-26
WP_003569870.1|695581_696064_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003566521.1|696305_696506_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_003569868.1|697189_697402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566523.1|697465_698431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003606991.1|698558_699197_+	YkyA family protein	NA	NA	NA	NA	NA
WP_003569858.1|699283_700213_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	48.1	6.0e-74
WP_016380556.1|700564_702304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528606.1|702613_705277_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003604899.1|705942_706773_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003569847.1|706860_708714_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003569846.1|708794_710243_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_081528607.1|710435_711680_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	9.7e-11
WP_003586346.1|711930_712791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568913.1|713245_713593_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003568915.1|713582_713768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156876492.1|713963_714623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|714658_715579_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574021.1|716389_717310_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
715904:715919	attR	ATGAACAGCTTTTTCT	NA	NA	NA	NA
WP_003574021.1|717753_718674_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 2
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	815562	907264	3055892	tRNA,holin,integrase,terminase,head,protease,tail,portal,capsid	Lactobacillus_phage(69.23%)	97	826442:826469	889199:889226
WP_003569677.1|815562_816024_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003587532.1|816020_816998_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003590301.1|817119_817806_-	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	41.7	1.2e-39
WP_003569675.1|817925_818819_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_081528614.1|819031_819538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569672.1|819848_820430_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003593952.1|820799_821861_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	48.9	3.1e-18
WP_003564323.1|821850_822744_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003569669.1|822759_823581_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081528615.1|823590_824904_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003569666.1|825032_826274_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
826442:826469	attL	CGGTCTCGAAGTCGCCTAACAACATCAG	NA	NA	NA	NA
WP_003569664.1|826667_826856_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003569662.1|826845_827148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569588.1|827655_828348_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_052915981.1|828340_830602_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003569585.1|830731_832477_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_003590296.1|832473_834150_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003569579.1|834354_835308_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003564285.1|835705_836179_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	60.5	1.2e-46
WP_003564282.1|836210_838580_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	3.0e-93
WP_003569577.1|838581_839316_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003564279.1|839558_839795_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003564276.1|839980_841552_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003569575.1|841640_841997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587522.1|842002_843283_-	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	34.9	3.6e-61
WP_003564271.1|843594_844899_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.1	4.4e-163
WP_003564269.1|844947_845703_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003564267.1|845777_846968_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003564265.1|847158_848181_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003564263.1|848217_849255_-	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_081528616.1|850029_851004_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	99.7	2.6e-197
WP_012491267.1|850990_851179_-	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
WP_081528617.1|851178_851613_-|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	88.7	5.3e-41
WP_081528618.1|851602_851896_-	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	96.9	9.7e-47
WP_081528619.1|851941_852211_-	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	97.8	3.4e-38
WP_081528620.1|852213_852639_-	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	99.3	3.3e-72
WP_081528621.1|852667_856936_-|tail	phage tail protein	tail	A0A1B0Y2S0	Lactobacillus_phage	74.4	0.0e+00
WP_081528622.1|856932_857628_-|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	97.4	1.7e-126
WP_081528623.1|857634_860805_-|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	92.5	0.0e+00
WP_191982445.1|860824_860986_-	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	98.1	9.8e-25
WP_081528625.1|861066_861432_-	hypothetical protein	NA	A0A1B0Y865	Lactobacillus_phage	99.2	1.0e-61
WP_081528626.1|861508_862156_-|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	93.5	3.3e-111
WP_016387125.1|862167_862551_-	phage protein	NA	A0A0P0IQS9	Lactobacillus_phage	98.4	2.2e-67
WP_019875902.1|862540_862870_-	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	99.1	2.6e-56
WP_012491255.1|862853_863192_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
WP_003582271.1|863130_863457_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
WP_016382022.1|863470_863719_-	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
WP_081528627.1|863792_865025_-|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	95.1	1.6e-215
WP_081528628.1|865029_865737_-|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	98.7	6.1e-127
WP_081528629.1|865714_866950_-|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	99.0	1.1e-232
WP_081528630.1|866968_868699_-|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.3	0.0e+00
WP_081528875.1|868701_869076_-	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	97.6	2.6e-60
WP_019884709.1|869145_869526_-	HNH endonuclease	NA	A0A0P0HRY0	Lactobacillus_phage	97.6	4.8e-70
WP_016364250.1|869750_870200_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	92.6	4.9e-74
WP_016364251.1|870278_870602_-	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
WP_156876495.1|870598_870751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528631.1|870747_870966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528633.1|871284_871503_-	helix-turn-helix transcriptional regulator	NA	U5U738	Lactobacillus_phage	45.8	8.1e-06
WP_081528634.1|871505_871688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528635.1|871684_872506_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	96.3	6.1e-147
WP_156876509.1|872543_873290_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	44.8	3.2e-41
WP_081528636.1|873391_873877_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	71.4	2.9e-56
WP_081528637.1|873891_874680_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	31.2	5.0e-21
WP_081528638.1|874866_875106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191982446.1|875251_875419_-	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	84.0	7.8e-17
WP_012491308.1|875479_875791_+	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	100.0	8.2e-52
WP_081528639.1|876058_876382_-	DUF771 domain-containing protein	NA	A0A1B0Y6D5	Lactobacillus_phage	98.1	2.3e-57
WP_081528640.1|876823_877024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156876496.1|877696_877873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528641.1|877943_878510_+	nucleoside 2-deoxyribosyltransferase	NA	C9E2Q0	Enterococcus_phage	29.0	4.7e-13
WP_081528642.1|878604_878850_-	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	96.3	6.9e-38
WP_156876497.1|878916_879255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528644.1|879168_879462_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_032789902.1|879720_880062_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	42.2	7.2e-17
WP_081528645.1|880054_880477_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	39.6	1.1e-22
WP_081528646.1|880601_881267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528647.1|881263_882055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528648.1|882389_883541_+|integrase	site-specific integrase	integrase	Q8W767	Lactobacillus_phage	98.2	1.3e-214
WP_003564255.1|883945_884536_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003569571.1|884652_885108_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564251.1|885493_886441_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564250.1|886445_887474_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564248.1|887470_888358_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003569568.1|888520_889060_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_081528649.1|889410_892302_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	2.4e-307
889199:889226	attR	CGGTCTCGAAGTCGCCTAACAACATCAG	NA	NA	NA	NA
WP_003569565.1|892461_894477_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_003564240.1|894682_895330_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_081528650.1|895613_897980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081528651.1|897985_898651_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	4.1e-32
WP_081528652.1|898750_899761_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003569557.1|899753_900401_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003564230.1|900635_902363_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	55.1	5.0e-183
WP_003564228.1|902869_903817_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.2	3.6e-82
WP_003564226.1|903882_904938_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003578277.1|904948_905776_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003564222.1|905777_906737_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003564220.1|906928_907264_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	1242818	1319479	3055892	integrase,holin,transposase	Lactobacillus_phage(45.45%)	84	1284450:1284463	1321901:1321914
WP_156876501.1|1242818_1243739_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	4.0e-22
WP_060417290.1|1243789_1245115_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003567800.1|1245120_1246080_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
WP_081528680.1|1246079_1247612_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_101511947.1|1247886_1248671_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003581973.1|1251033_1252356_+	MFS transporter	NA	NA	NA	NA	NA
WP_003581971.1|1252463_1253234_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_016368446.1|1253230_1253881_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	4.3e-18
WP_003574021.1|1254001_1254922_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016386656.1|1255713_1256397_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_003582109.1|1257057_1258353_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.0e-144
WP_003582108.1|1258389_1258725_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004563097.1|1258747_1259164_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
WP_016386656.1|1260134_1260818_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_191982449.1|1261687_1261864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582348.1|1261991_1262420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582350.1|1262688_1263957_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
WP_003582352.1|1263967_1264576_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
WP_003582354.1|1264722_1265640_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_016367615.1|1267702_1267933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076652107.1|1268065_1268737_-	class A sortase	NA	NA	NA	NA	NA
WP_081528681.1|1268813_1269173_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081528682.1|1269838_1270285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528683.1|1270297_1270747_+	nitroreductase	NA	NA	NA	NA	NA
WP_003587058.1|1270739_1270883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982450.1|1270885_1271137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063558002.1|1271613_1272819_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	44.5	2.4e-91
WP_063558001.1|1273019_1273163_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_081528684.1|1273502_1276061_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_191982454.1|1276047_1276293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528686.1|1276334_1277579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528687.1|1277571_1278006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528688.1|1278044_1278290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528689.1|1278330_1278510_-	plasmid replication protein	NA	NA	NA	NA	NA
WP_081528690.1|1279102_1279924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528691.1|1279913_1280321_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_081528692.1|1280317_1280962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528693.1|1280977_1281988_-	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.3	1.2e-14
WP_003582237.1|1281989_1283918_-	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_003583424.1|1283898_1284495_-	hypothetical protein	NA	NA	NA	NA	NA
1284450:1284463	attL	CTTTTTGGCGTTTA	NA	NA	NA	NA
WP_003582234.1|1284478_1284814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528694.1|1284819_1286877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019897698.1|1286873_1289330_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016381672.1|1289356_1289935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016368618.1|1289943_1290363_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_019891186.1|1290372_1291923_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003582223.1|1291900_1293142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|1293184_1293412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|1293413_1293590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|1293608_1293875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582220.1|1293886_1294165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016383324.1|1294846_1295710_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
WP_014951815.1|1295755_1296697_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	3.1e-17
WP_081528695.1|1296630_1297359_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	1.7e-31
WP_076626284.1|1297388_1297721_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010493173.1|1297840_1298176_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_003573729.1|1299708_1299927_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003583407.1|1300122_1301121_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
WP_156876502.1|1301765_1302686_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.0	7.6e-21
WP_010493154.1|1303593_1304037_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_032786488.1|1304551_1304884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1304892_1305813_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_010493149.1|1306008_1306296_-	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_016368116.1|1306307_1307045_-	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.6	3.8e-47
WP_003597560.1|1307046_1307469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574016.1|1307515_1308034_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003589925.1|1308033_1308858_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.1	6.6e-117
WP_003589923.1|1308872_1309619_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_003661649.1|1309611_1309926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|1310106_1310652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572201.1|1310634_1310838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572199.1|1310922_1311279_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572196.1|1311344_1311596_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_016368112.1|1311768_1312527_-	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	48.9	7.1e-41
WP_003572188.1|1312587_1313421_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_003572187.1|1313391_1313592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574003.1|1313633_1313882_-	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572184.1|1314125_1314479_+	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003572182.1|1314471_1314894_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003574021.1|1314990_1315911_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003572177.1|1317006_1317243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368286.1|1317226_1317847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003573997.1|1317936_1318197_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003577897.1|1318309_1319479_+|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	4.3e-218
1321901:1321914	attR	TAAACGCCAAAAAG	NA	NA	NA	NA
>prophage 4
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	1481805	1526838	3055892	protease,transposase	unidentified_phage(55.56%)	38	NA	NA
WP_013245353.1|1481805_1482726_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016363278.1|1482785_1484081_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003586723.1|1487155_1487563_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003586720.1|1487590_1488100_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003586718.1|1488125_1488893_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586715.1|1488896_1489739_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003586712.1|1489749_1490553_+	tributyrin esterase	NA	NA	NA	NA	NA
WP_003586710.1|1490714_1491839_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_003586708.1|1491852_1492632_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016363280.1|1492634_1493489_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	28.7	8.4e-14
WP_003586704.1|1493478_1494966_-	arylsulfatase	NA	A0A1V0SA98	Catovirus	22.7	3.2e-08
WP_003586703.1|1494990_1495827_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003586701.1|1495813_1496638_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586699.1|1496996_1497980_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003586697.1|1498063_1498774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573459.1|1498870_1499713_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003563277.1|1501729_1502101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563273.1|1502213_1502612_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003574021.1|1505505_1506426_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003577615.1|1507470_1508466_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_081528718.1|1508505_1509375_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003563255.1|1509367_1510198_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003577611.1|1510484_1511126_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563251.1|1511239_1512100_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003563248.1|1512121_1512544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563247.1|1512560_1513847_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563244.1|1513988_1514300_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003587755.1|1514300_1516397_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_081528719.1|1516667_1518194_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.4e-53
WP_003577590.1|1518796_1519585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577587.1|1519574_1520255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|1520385_1521306_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_081528720.1|1521327_1521930_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	1.5e-22
WP_003577580.1|1521919_1522444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577579.1|1522475_1522865_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003577577.1|1522947_1523634_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003574021.1|1523828_1524749_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574021.1|1525917_1526838_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 5
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	2373686	2495457	3055892	bacteriocin,protease,transposase	Streptococcus_phage(13.64%)	118	NA	NA
WP_081528786.1|2373686_2374607_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_003585628.1|2375296_2376067_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_081528787.1|2376070_2376850_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003596135.1|2377144_2377960_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567460.1|2377956_2378658_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.8	9.6e-32
WP_003585621.1|2378654_2379887_+	acyltransferase	NA	NA	NA	NA	NA
WP_081528788.1|2379843_2381376_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	30.3	1.5e-29
WP_003567453.1|2382716_2383520_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003576383.1|2383516_2384299_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_081528789.1|2384298_2385072_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003567447.1|2385131_2386079_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081528790.1|2386460_2388716_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.1	1.2e-38
WP_032786947.1|2388821_2390108_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.6	2.2e-106
WP_013246073.1|2390285_2390573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591860.1|2391163_2391574_+	CrcB family protein	NA	NA	NA	NA	NA
WP_081528791.1|2391567_2391924_+	CrcB family protein	NA	NA	NA	NA	NA
WP_003576369.1|2392307_2392472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016382238.1|2392855_2393374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016367858.1|2393465_2394338_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_081528792.1|2394505_2395267_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_052916113.1|2395600_2398168_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003585597.1|2398952_2399633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016367420.1|2399713_2400733_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003567431.1|2400877_2401027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003585593.1|2401270_2402173_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016367419.1|2402323_2404237_-	outer membrane protein	NA	NA	NA	NA	NA
WP_016367418.1|2404499_2405024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567423.1|2405181_2405814_+	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003567422.1|2405931_2406573_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003576335.1|2406812_2407730_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_156876505.1|2407930_2408104_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003567416.1|2408134_2408404_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003580910.1|2408604_2410071_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567413.1|2410346_2411090_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003567411.1|2411086_2411983_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567408.1|2411979_2412921_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567405.1|2413041_2413374_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567403.1|2413394_2414033_-	cation transporter	NA	NA	NA	NA	NA
WP_003567401.1|2414161_2414353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003585581.1|2414479_2416009_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003585579.1|2416048_2417422_+	MFS transporter	NA	NA	NA	NA	NA
WP_003580900.1|2417575_2417941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016380888.1|2418241_2420959_-	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.0	2.6e-61
WP_003567390.1|2421346_2422954_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003567386.1|2423245_2424004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016381946.1|2424136_2425513_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016380884.1|2425774_2426938_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003580891.1|2426963_2427698_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016380549.1|2427902_2428856_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	3.7e-10
WP_003567376.1|2429127_2429361_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567374.1|2429357_2429573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659595.1|2429708_2430017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580888.1|2430287_2430884_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003580886.1|2431002_2431338_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003576306.1|2431656_2431848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580874.1|2432099_2432432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580872.1|2432989_2433802_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567359.1|2434602_2434827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567358.1|2435148_2435337_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_032675994.1|2435371_2435545_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003580868.1|2435804_2436044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2436174_2437095_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016383118.1|2437645_2437843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567351.1|2438204_2439011_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081528793.1|2439015_2440314_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003571414.1|2440514_2440652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585566.1|2441117_2443310_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	1.1e-36
WP_003585563.1|2443320_2444700_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003567340.1|2444873_2445224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982453.1|2445296_2445608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567335.1|2445913_2447269_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580847.1|2447370_2447667_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2447859_2448144_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567328.1|2448167_2448446_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580842.1|2448490_2449279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580841.1|2449331_2450120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567322.1|2450116_2450446_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003580838.1|2450581_2451229_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.7e-06
WP_003585559.1|2451499_2452555_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003580834.1|2452763_2453960_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2454054_2454612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585557.1|2454889_2457895_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580827.1|2457896_2459219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580826.1|2459215_2460775_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003580824.1|2460781_2461609_+	class C sortase	NA	NA	NA	NA	NA
WP_003580823.1|2462197_2463421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003580821.1|2463609_2464146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567298.1|2464399_2464594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003585549.1|2464910_2465744_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	5.6e-47
WP_003580815.1|2465832_2467089_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.0	6.2e-106
WP_081528881.1|2467167_2468400_-	MFS transporter	NA	NA	NA	NA	NA
WP_003567290.1|2468727_2468979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2469203_2469410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567286.1|2469480_2469738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567284.1|2469869_2470076_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003585543.1|2470263_2471379_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567280.1|2471569_2471854_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003580809.1|2471867_2472989_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003576240.1|2473501_2474173_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003576237.1|2474672_2475296_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016381637.1|2475457_2478088_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	8.4e-89
WP_081528795.1|2478245_2480300_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	5.6e-64
WP_003576231.1|2480461_2481340_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003580803.1|2481402_2482599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003580801.1|2482595_2483696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576225.1|2483923_2485270_-	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003571381.1|2485502_2486822_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003567260.1|2487066_2487444_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003567258.1|2487558_2487849_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567256.1|2488070_2488613_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003580798.1|2488629_2489994_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_081528796.1|2490015_2491131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2491250_2492171_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003580795.1|2492289_2493186_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016366635.1|2493466_2494372_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	1.6e-34
WP_003577837.1|2494375_2495152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080596037.1|2495189_2495300_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003577835.1|2495343_2495457_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP014985	Lacticaseibacillus paracasei strain IIA chromosome, complete genome	3055892	2801144	2871087	3055892	tRNA,protease,transposase	Burkholderia_virus(17.65%)	53	NA	NA
WP_081528839.1|2801144_2802389_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.3e-10
WP_016385130.1|2802593_2803487_-	LCP family protein	NA	NA	NA	NA	NA
WP_003570845.1|2803664_2804429_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_081528840.1|2804810_2806961_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.6	1.2e-120
WP_081528841.1|2807595_2807997_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_156876508.1|2808347_2809268_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	1.4e-22
WP_081528843.1|2809485_2811417_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_003580111.1|2811884_2812715_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.5	2.4e-18
WP_081528844.1|2813072_2813987_+	sortase	NA	NA	NA	NA	NA
WP_003566632.1|2814253_2815285_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003659327.1|2817756_2818899_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_081528846.1|2818895_2820065_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_003566617.1|2820057_2821503_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_081528847.1|2821718_2824127_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.0	1.2e-12
WP_003566613.1|2824376_2826155_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003566602.1|2826602_2827532_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003566600.1|2827706_2828042_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566598.1|2828216_2829161_+	cation transporter	NA	NA	NA	NA	NA
WP_081528848.1|2829694_2830969_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.9	3.9e-84
WP_003566585.1|2831274_2832477_+	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	37.0	8.5e-12
WP_003566583.1|2832583_2832991_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003566581.1|2833107_2833710_+	guanylate kinase	NA	U5J9X2	Bacillus_phage	30.3	8.0e-11
WP_003566579.1|2833779_2833893_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003566577.1|2834001_2834448_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003566574.1|2834739_2835180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566572.1|2835200_2836181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004561979.1|2836603_2837335_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.7e-37
WP_003566568.1|2837468_2838293_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003566566.1|2838294_2838939_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566562.1|2838954_2839617_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566560.1|2839760_2840711_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	1.5e-35
WP_003566559.1|2840795_2841551_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003566557.1|2841572_2842313_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.4	2.2e-10
WP_003566555.1|2842443_2843844_+	sugar transferase	NA	NA	NA	NA	NA
WP_081528849.1|2843984_2845229_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	1.7e-10
WP_003566356.1|2845456_2846323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566354.1|2846584_2847727_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.6	5.2e-27
WP_003566352.1|2847798_2848791_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	35.4	6.5e-42
WP_003566350.1|2848918_2849959_-	acyltransferase	NA	NA	NA	NA	NA
WP_003566349.1|2850209_2851697_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003566347.1|2851835_2853917_+	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_003566345.1|2854112_2855852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566343.1|2856006_2857680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566341.1|2858090_2859056_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	3.9e-07
WP_003566340.1|2859110_2860247_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003570792.1|2860261_2861701_+	histidine kinase	NA	NA	NA	NA	NA
WP_003566338.1|2861944_2862637_+	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_003566336.1|2862694_2863330_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003566334.1|2863407_2864457_+	EpsG family protein	NA	NA	NA	NA	NA
WP_081528850.1|2864744_2867069_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_016368445.1|2867411_2868428_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.1e-35
WP_003566331.1|2868569_2869568_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_003577841.1|2869842_2871087_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
>prophage 1
NZ_CP014988	Lacticaseibacillus paracasei strain IIA plasmid unnamed3, complete sequence	80927	7951	47524	80927	transposase,holin	Lactococcus_phage(20.0%)	40	NA	NA
WP_021353390.1|7951_8041_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003592338.1|8507_9857_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.7	8.6e-122
WP_071799104.1|9898_10093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099973776.1|10440_11227_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003606765.1|11214_11538_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003589800.1|11881_12760_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003606766.1|12880_14614_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589794.1|14640_16065_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|16113_16449_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_156876514.1|16981_17769_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003590051.1|17955_18513_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003590049.1|18478_19663_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_004559989.1|19704_20616_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	40.8	7.7e-58
WP_003590045.1|21246_21912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049152541.1|22273_23170_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049152543.1|23182_24640_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_049152545.1|24652_25714_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_076653377.1|25713_26604_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_049152548.1|26622_27483_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016381832.1|27517_28009_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_081528906.1|28620_28908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081528907.1|29488_31249_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_081528908.1|31384_33319_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E0YIY3	Lactococcus_phage	46.3	1.6e-65
WP_081528909.1|33856_34543_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	2.3e-62
WP_081528910.1|34566_34998_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_081528911.1|35462_36197_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_081528937.1|36213_37470_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_081528912.1|37483_37765_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_081528913.1|37770_38208_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_081528938.1|38208_39843_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_156876515.1|40021_40707_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.2	1.6e-63
WP_003660057.1|40828_41278_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	43.8	3.1e-28
WP_134799400.1|41554_42475_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	7.6e-37
WP_081528914.1|42691_43009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528915.1|43200_43584_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_081528916.1|43580_44873_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	38.3	3.9e-79
WP_081528917.1|44865_45222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587083.1|45214_45448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081528918.1|45452_46241_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	37.3	7.7e-38
WP_081528919.1|46474_47524_+	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	39.8	1.8e-13
