The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	13889	80293	2373708	integrase,transposase,tRNA	Bacillus_phage(20.0%)	58	NA	NA
WP_011675087.1|13889_14456_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_081196391.1|14456_17945_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_162494667.1|18261_18531_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_021165758.1|18561_18936_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_081196393.1|18935_19259_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_021165759.1|19399_20737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165760.1|20733_22002_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011675094.1|21982_22534_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	1.4e-09
WP_021165762.1|22739_24827_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	49.2	1.6e-106
WP_081196394.1|25893_27717_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_081196395.1|27776_29711_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_061777958.1|29757_30189_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_061777957.1|30337_31504_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_032940659.1|32163_32901_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021165768.1|33636_34002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675105.1|34934_35288_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_011675106.1|35409_35568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152023958.1|35627_36739_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_011675108.1|37221_37674_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675109.1|37758_38001_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014571770.1|38094_39717_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_011675112.1|39926_40448_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	42.1	1.0e-30
WP_015081831.1|40909_42085_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011675114.1|42182_42938_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_021165938.1|43089_44508_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	2.3e-40
WP_081196396.1|44726_46292_-	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_011834176.1|46284_47265_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011675118.1|47267_48392_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_081196397.1|48480_49482_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_011675120.1|49674_50529_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.4	7.8e-12
WP_081196398.1|51685_52576_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011834182.1|52728_53754_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011675125.1|54253_54691_+	OsmC family protein	NA	NA	NA	NA	NA
WP_081196399.1|54852_56166_+	APC family permease	NA	NA	NA	NA	NA
WP_011675127.1|56244_57240_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_081196400.1|57342_58155_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032950637.1|58605_60243_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	4.8e-50
WP_081196401.1|60743_60998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675131.1|61116_61941_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675132.1|62100_62682_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081196402.1|62875_63766_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196403.1|63876_64359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021036527.1|64615_65896_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	26.5	4.2e-09
WP_011675135.1|66148_66982_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081196398.1|67330_68221_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675137.1|68393_68861_+	universal stress protein	NA	NA	NA	NA	NA
WP_021036528.1|68987_69185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196404.1|69220_69841_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081196405.1|69908_71078_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_011675141.1|71088_71679_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_014571790.1|71887_73153_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	35.0	2.7e-53
WP_023163579.1|73240_73492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196406.1|73621_74842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571793.1|75132_75396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127093928.1|75492_75744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571795.1|76093_77179_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_152023959.1|78267_78975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152023960.1|79146_80293_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.9e-46
>prophage 2
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	433975	446132	2373708	tRNA	uncultured_virus(30.0%)	14	NA	NA
WP_011675460.1|433975_434293_+	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_011675461.1|434398_435025_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_021216210.1|435186_436527_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021165898.1|436617_437007_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	47.4	2.0e-23
WP_011675464.1|437125_437410_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_021213999.1|437496_439125_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.4	1.7e-156
WP_011675466.1|439176_439989_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_011675468.1|440178_441606_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_003131580.1|441598_442300_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_015082045.1|442477_443113_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	1.6e-73
WP_011675470.1|443245_444106_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_011834464.1|444155_444938_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_011675472.1|444930_445257_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_011834466.1|445256_446132_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.4	7.1e-101
>prophage 3
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	550850	657044	2373708	protease,head,holin,portal,terminase,transposase,tRNA	Lactococcus_phage(40.54%)	86	NA	NA
WP_003130410.1|550850_551798_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_011675560.1|552108_552300_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_011675561.1|552475_553759_+	trigger factor	NA	NA	NA	NA	NA
WP_081196509.1|560618_562532_+	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	33.5	3.9e-43
WP_011675564.1|562608_563952_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	7.2e-36
WP_081196511.1|566494_567364_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032951356.1|567373_568639_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_021166304.1|568867_569212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196512.1|569257_571504_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	3.3e-126
WP_011675569.1|571629_572100_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166305.1|572324_573338_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_081196513.1|573561_574197_-	peptide deformylase	NA	Q6VSW0	Vibrio_phage	35.7	3.8e-11
WP_011675572.1|574351_574756_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011675573.1|574817_576896_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011675575.1|579083_579539_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011675576.1|579815_580568_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011675577.1|580753_581716_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_081196514.1|581890_582649_-	HAD-IIB family hydrolase	NA	A0A2P1EM96	Moumouvirus	25.9	4.7e-08
WP_063283777.1|582743_583334_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014573068.1|583350_583887_-	phosphopantothenoylcysteine decarboxylase	NA	Q9J5A8	Fowlpox_virus	34.9	6.8e-22
WP_021166323.1|583879_584575_-	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.7	1.0e-17
WP_011675581.1|584721_584907_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011675583.1|587451_587895_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152023965.1|588104_589215_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	3.6e-49
WP_014573151.1|589295_589718_+	DUF722 domain-containing protein	NA	Q9AYX5	Lactococcus_phage	100.0	5.5e-75
WP_081196515.1|590570_591023_+|terminase	phage terminase small subunit P27 family	terminase	Q9AZM7	Lactococcus_phage	98.7	4.2e-81
WP_081196516.1|591022_592837_+|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	98.5	0.0e+00
WP_081196518.1|593006_594086_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	98.6	1.9e-196
WP_021166232.1|594085_594673_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	98.5	8.4e-106
WP_021166230.1|595986_596292_+	hypothetical protein	NA	Q9AZM1	Lactococcus_phage	97.0	2.9e-49
WP_021166229.1|596278_596614_+|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	94.6	1.4e-52
WP_032950353.1|596610_597096_+	HK97 gp10 family phage protein	NA	Q9AZL9	Lactococcus_phage	98.1	4.8e-83
WP_010905383.1|597092_597488_+	DUF806 family protein	NA	Q9AZL8	Lactococcus_phage	100.0	1.4e-67
WP_063283916.1|597489_598095_+	hypothetical protein	NA	Q9AZL7	Lactococcus_phage	95.0	1.4e-103
WP_021166227.1|598154_598499_+	hypothetical protein	NA	Q9AZL6	Lactococcus_phage	98.2	1.6e-27
WP_014573136.1|598546_598687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081146292.1|598668_600867_+	tape measure protein	NA	Q9AZL5	Lactococcus_phage	91.2	1.3e-289
WP_021212325.1|603039_603276_+	hypothetical protein	NA	A0A1P8BKU6	Lactococcus_phage	93.6	4.2e-32
WP_081196519.1|603288_603516_+|holin	holin	holin	Q9AZR4	Lactococcus_phage	95.8	2.0e-31
WP_081196520.1|603528_604596_+|holin	phage holin	holin	A0A1P8BKR7	Lactococcus_phage	97.3	1.5e-124
WP_081196521.1|606139_607741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031286545.1|607658_608597_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	50.6	7.9e-82
WP_011676899.1|609112_610387_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011676898.1|610509_611286_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_081196522.1|611285_613163_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	32.4	9.8e-23
WP_010906184.1|613333_613603_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_021165717.1|613686_614478_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.2	2.4e-31
WP_021165716.1|614695_616072_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	35.7	5.5e-31
WP_011835788.1|616173_616758_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021165715.1|616750_617029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676892.1|617056_617737_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_014572089.1|617873_618377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676890.1|618394_619069_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_031286544.1|619197_620508_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	31.3	6.3e-61
WP_021165713.1|621999_623325_+	MFS transporter	NA	NA	NA	NA	NA
WP_081196523.1|623336_624182_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	33.3	6.8e-32
WP_081196524.1|624319_625432_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_081196525.1|625508_626399_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572097.1|626591_627320_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	A0A2D1A6G0	Rhodococcus_phage	27.7	4.6e-05
WP_021165708.1|627436_628306_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	8.5e-14
WP_011835775.1|628468_629839_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_081196526.1|629868_631122_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_021165705.1|631125_631803_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_081196527.1|631836_632427_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_011676877.1|632426_632702_+	YggT family protein	NA	NA	NA	NA	NA
WP_011676876.1|632698_633490_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_021165703.1|633546_634482_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_011676874.1|634931_637730_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.1	1.9e-83
WP_011835767.1|637789_637906_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_021165701.1|637964_638147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003132374.1|638390_639578_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.4	2.0e-34
WP_014572106.1|639666_640011_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_031286538.1|640036_641161_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.1	4.0e-32
WP_011676870.1|641460_641892_+	universal stress protein	NA	NA	NA	NA	NA
WP_081196528.1|641996_642962_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	32.8	1.0e-36
WP_021165699.1|643326_644472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165698.1|644752_647062_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_011676866.1|647330_648101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196529.1|648206_648806_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_021165696.1|648819_649413_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_021211905.1|649425_650772_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	30.7	1.0e-50
WP_011676862.1|650764_651166_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_011835756.1|651280_651649_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_011676860.1|651781_652345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165694.1|652728_654606_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_081196530.1|656153_657044_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	849904	972989	2373708	integrase,transposase	Bacillus_phage(20.0%)	112	955602:955620	978797:978815
WP_015082326.1|849904_850795_-|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
WP_021166087.1|850925_851801_+	ROK family protein	NA	NA	NA	NA	NA
WP_021166086.1|852010_853552_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.3	7.0e-19
WP_081196571.1|853884_854775_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_081196572.1|854785_855649_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081196573.1|855720_857355_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_021166083.1|857474_858173_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_081196574.1|858195_860610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196575.1|860653_862033_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011676436.1|863213_863633_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166080.1|863893_865693_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_081196494.1|868084_868975_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032940184.1|869155_869545_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_081196576.1|869668_870358_+	VIT family protein	NA	NA	NA	NA	NA
WP_011834953.1|870357_871038_+	VIT family protein	NA	NA	NA	NA	NA
WP_014572455.1|871113_871857_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011834955.1|871966_872386_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031286704.1|872397_873036_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_021166076.1|873050_873410_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015082578.1|873863_875234_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_011676425.1|875285_875867_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.1	5.5e-33
WP_021166075.1|875871_876879_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.9	8.6e-50
WP_021212238.1|877076_877571_+	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_011676422.1|877624_877879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116368841.1|878222_878495_+	DUF3977 family protein	NA	NA	NA	NA	NA
WP_021166281.1|878487_878856_+	VOC family protein	NA	NA	NA	NA	NA
WP_011676418.1|878862_879657_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.5	1.7e-29
WP_014572463.1|879646_880705_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_021166279.1|880694_881213_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011676415.1|881311_882517_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_021166278.1|882516_883278_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_162494675.1|883453_884296_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_081196577.1|884396_886307_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_021166276.1|886354_887791_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011676410.1|887957_888578_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676409.1|888789_890013_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	5.0e-28
WP_011676408.1|890005_891727_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_011834970.1|891917_892088_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_152023968.1|892460_893833_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	4.6e-54
WP_081196578.1|893884_894487_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	80.0	8.3e-93
WP_014572475.1|895155_895698_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.1	5.8e-61
WP_011676403.1|895727_896030_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	51.7	6.0e-07
WP_021166271.1|896311_897256_+	cation transporter	NA	NA	NA	NA	NA
WP_011676401.1|897309_897741_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_061778303.1|897811_898732_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	37.7	1.9e-32
WP_011834977.1|898920_899517_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011676397.1|900845_901034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676396.1|901046_901709_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_011676395.1|901695_902088_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_011676394.1|902355_903411_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.5	5.1e-61
WP_011676393.1|903597_904305_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166266.1|904312_904753_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_011676391.1|904850_906404_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.3	1.0e-33
WP_011676390.1|906393_907104_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	30.1	5.3e-06
WP_011676389.1|907287_907623_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_014572291.1|908466_909357_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676387.1|909416_909947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010890648.1|910856_911537_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_081196579.1|912298_913261_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_081196580.1|913851_914742_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011834991.1|914966_915521_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_088793343.1|915974_917085_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_011675801.1|917189_918020_-	SP_1767 family glycosyltransferase	NA	NA	NA	NA	NA
WP_014572862.1|918325_919744_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_011675803.1|919872_920232_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011675804.1|920275_921379_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	6.3e-30
WP_011675805.1|921539_921968_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011675806.1|922106_923414_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675807.1|923542_924460_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	9.0e-22
WP_081196581.1|928134_928638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165395.1|928647_929025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031286442.1|929315_929600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196582.1|929576_930452_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196583.1|930640_932581_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.7	8.2e-57
WP_011835499.1|932769_933627_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.0	2.6e-39
WP_031286477.1|933797_935051_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_011675817.1|935053_935293_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_081196584.1|936468_937620_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.5	1.1e-45
WP_081196952.1|937844_938702_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_021165631.1|938702_939203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021165632.1|939278_940085_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_011675823.1|940081_940528_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011675824.1|940707_942375_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015082274.1|943068_943635_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011835491.1|943729_944251_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_101944709.1|944272_945181_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_032940916.1|945443_946385_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011675830.1|946540_946921_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_021214282.1|946917_949215_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011835486.1|949289_950279_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_011675833.1|950477_950762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196585.1|950915_952433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081196586.1|952540_953203_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.5e-22
WP_011675836.1|953562_954450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
955602:955620	attL	AACTAGCAATTCGGGTATT	NA	NA	NA	NA
WP_011675837.1|956912_957587_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_011675838.1|957746_958091_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011675839.1|958266_958683_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011675840.1|959019_959481_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081196588.1|959734_960244_+	cell division protein	NA	NA	NA	NA	NA
WP_014572838.1|960236_961565_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011835479.1|961795_962353_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_011675844.1|962415_962661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675845.1|962933_963659_+	nicotinamide mononucleotide transporter	NA	A0A2P0ZKW0	Lactobacillus_phage	28.7	1.4e-14
WP_014572836.1|964211_964637_+	universal stress protein	NA	NA	NA	NA	NA
WP_015082285.1|964804_965167_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_011675849.1|965228_965762_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081196589.1|966433_967324_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196590.1|967458_969330_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003131392.1|969517_969850_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_021165730.1|969984_970959_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.4	7.3e-30
WP_021165731.1|971583_971826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152023969.1|971877_972989_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.8e-49
978797:978815	attR	AATACCCGAATTGCTAGTT	NA	NA	NA	NA
>prophage 5
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	978889	1053387	2373708	transposase	Streptococcus_phage(25.0%)	56	NA	NA
WP_081196525.1|978889_979780_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196591.1|979933_981178_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021165126.1|983813_985364_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	23.6	1.3e-25
WP_011675866.1|988876_989776_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011835457.1|989898_990663_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	4.5e-27
WP_081196592.1|990643_992224_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014572814.1|992398_993244_+	VOC family protein	NA	NA	NA	NA	NA
WP_081196593.1|993309_993957_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011675870.1|994110_996066_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	3.7e-142
WP_011675871.1|996164_996350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165134.1|996573_997311_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.3	1.2e-80
WP_021165135.1|997483_998125_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_015082299.1|998282_998747_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021165138.1|1000284_1001004_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_081196594.1|1001282_1002173_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165141.1|1002336_1003245_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_152023963.1|1005285_1006396_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_081196595.1|1006481_1009589_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_081196596.1|1009689_1010580_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032949918.1|1011944_1012865_+	LCP family protein	NA	NA	NA	NA	NA
WP_011675881.1|1013051_1014287_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_021165163.1|1014344_1014614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675883.1|1014684_1015389_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_081196597.1|1016645_1017092_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_011675885.1|1017175_1017502_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011675886.1|1017661_1019329_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_081196598.1|1019437_1020031_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	44.7	1.3e-16
WP_021165167.1|1020173_1021022_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011675889.1|1021290_1022178_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021165168.1|1022189_1022942_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.8e-28
WP_011675891.1|1022943_1023171_+	DUF4059 family protein	NA	NA	NA	NA	NA
WP_014572788.1|1023368_1024295_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	2.0e-85
WP_081196599.1|1024435_1024684_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_081196600.1|1024925_1027379_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	44.2	1.3e-104
WP_041168338.1|1027397_1027985_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_021165171.1|1028062_1029121_+	endonuclease	NA	NA	NA	NA	NA
WP_081196601.1|1029144_1030086_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_011675898.1|1030239_1030503_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011675899.1|1030619_1031957_+	PFL family protein	NA	NA	NA	NA	NA
WP_081196525.1|1032257_1033148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675901.1|1033608_1034304_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081196602.1|1034300_1035047_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011675903.1|1035061_1035466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675904.1|1035613_1036657_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014572780.1|1036686_1037226_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_081196603.1|1037297_1039121_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	44.4	9.8e-129
WP_081196604.1|1039283_1041128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196605.1|1041297_1043061_+	oleate hydratase	NA	NA	NA	NA	NA
WP_032949940.1|1043127_1044267_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011675960.1|1044388_1045090_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_081196606.1|1045172_1046090_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_031286338.1|1046089_1047994_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_152023970.1|1048077_1049447_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	5.1e-53
WP_081196953.1|1049694_1051020_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011675965.1|1051483_1051885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010890648.1|1052706_1053387_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
>prophage 6
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	1065637	1187237	2373708	transposase,protease,tRNA	Bacillus_phage(17.39%)	98	NA	NA
WP_081196612.1|1065637_1066528_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196613.1|1066801_1067482_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.2	1.2e-108
WP_081196614.1|1067996_1068887_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676155.1|1070614_1071406_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_081196615.1|1073004_1073961_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_081196616.1|1074740_1076048_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_081196617.1|1076048_1076657_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_162494689.1|1076758_1077439_+	phosphotransferase	NA	A0A193CJY5	Infectious_laryngotracheitis_virus	25.6	3.2e-08
WP_021165363.1|1078332_1079112_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_081196619.1|1079108_1079747_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_031286434.1|1079747_1080533_+	histidinol-phosphatase HisJ family protein	NA	NA	NA	NA	NA
WP_011835164.1|1080566_1081526_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_081196620.1|1081948_1083490_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.5	3.1e-06
WP_011676141.1|1083525_1084011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196621.1|1084037_1084829_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_081196622.1|1084969_1086001_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_081196623.1|1086002_1086461_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_021165356.1|1086503_1086956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196624.1|1087012_1088389_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015082459.1|1088388_1088922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572613.1|1088964_1089540_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_081196625.1|1089553_1090336_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	7.7e-14
WP_081196626.1|1090455_1092168_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_021037263.1|1093878_1094355_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_021211415.1|1094400_1095423_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_014572605.1|1095481_1096732_+	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_011676302.1|1096866_1097577_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014572603.1|1097616_1097997_+	RidA family protein	NA	NA	NA	NA	NA
WP_081196627.1|1098145_1098994_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_015082465.1|1099259_1101386_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.4	4.2e-99
WP_081196628.1|1101457_1102804_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014572599.1|1102853_1103924_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_021165347.1|1104550_1105258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572597.1|1105436_1105583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061777907.1|1106836_1107754_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_081196629.1|1108429_1108762_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011676291.1|1108924_1109992_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.5	1.2e-54
WP_152023971.1|1110394_1111505_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.8	1.5e-50
WP_021214324.1|1111922_1112780_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_081196630.1|1112769_1115043_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014572659.1|1115202_1115856_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_081196631.1|1115948_1118681_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	1.1e-43
WP_081196632.1|1119155_1120442_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011676184.1|1120431_1120671_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_021165340.1|1120706_1121930_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	2.4e-22
WP_015082475.1|1121929_1123429_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	30.0	1.8e-40
WP_021212171.1|1123453_1123585_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_021212172.1|1125230_1125983_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_081196633.1|1126975_1129054_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.4	8.2e-63
WP_081196634.1|1129265_1130156_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011869580.1|1130159_1130741_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011869578.1|1131201_1132125_-	DMT family transporter	NA	NA	NA	NA	NA
WP_021211028.1|1133302_1134163_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_081196635.1|1134329_1134986_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_081196634.1|1135127_1136018_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082999.1|1136646_1137843_-	amidohydrolase	NA	NA	NA	NA	NA
WP_081196636.1|1138508_1139192_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	80.9	5.4e-96
WP_152023972.1|1139173_1140545_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	2.7e-54
WP_152023973.1|1140602_1141750_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.6	7.2e-45
WP_061777887.1|1142167_1142659_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_081196637.1|1142977_1144981_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	3.2e-80
WP_011676161.1|1145185_1145518_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081196638.1|1146097_1146988_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572641.1|1147304_1147703_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021165383.1|1147810_1148956_+	MFS transporter	NA	NA	NA	NA	NA
WP_011835185.1|1149062_1150727_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_061778299.1|1150881_1152138_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011676167.1|1152165_1153338_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_101913726.1|1153309_1154023_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021165386.1|1154024_1155632_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011676170.1|1155676_1157047_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	56.0	3.8e-141
WP_021165388.1|1157109_1157931_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572649.1|1158068_1158773_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_088793343.1|1159112_1160224_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_081196639.1|1160260_1162606_-	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_021037230.1|1163046_1163292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088793343.1|1164057_1165168_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_081196640.1|1166070_1167252_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_081196641.1|1167548_1168742_+	MFS transporter	NA	NA	NA	NA	NA
WP_011676287.1|1168741_1169641_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021212201.1|1169950_1171018_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021212202.1|1171065_1171866_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165292.1|1171867_1172656_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081196642.1|1172652_1173933_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.1	2.7e-32
WP_015082419.1|1174392_1175292_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_162494582.1|1175334_1176003_-	niacin ECF transporter S component NiaX	NA	NA	NA	NA	NA
WP_011676280.1|1176186_1177077_-	homoserine kinase	NA	NA	NA	NA	NA
WP_021165288.1|1177081_1178368_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_032940951.1|1178548_1179190_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.7	1.3e-48
WP_081196643.1|1179315_1180599_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014572580.1|1180614_1181115_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_021165285.1|1181117_1182191_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_011676274.1|1182187_1183237_-	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	45.1	8.7e-37
WP_011676273.1|1183316_1183667_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011676272.1|1183720_1184308_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011676271.1|1184304_1185540_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	2.4e-134
WP_081196956.1|1185788_1186295_-	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	29.8	3.7e-09
WP_011676268.1|1186727_1187237_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	1244719	1369023	2373708	protease,holin,portal,integrase,transposase,tail,tRNA,capsid	Lactococcus_phage(57.14%)	132	1241596:1241619	1357384:1357407
1241596:1241619	attL	ACGAGCTTCGGTATAACGCATTGC	NA	NA	NA	NA
WP_152023974.1|1244719_1245831_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.6e-49
WP_021165252.1|1245867_1246254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196596.1|1246402_1247293_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196958.1|1247355_1250412_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_098404858.1|1250401_1250959_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021165248.1|1251169_1252678_-	APC family permease	NA	NA	NA	NA	NA
WP_011676116.1|1252824_1253460_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011676115.1|1253526_1255350_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.8	9.8e-20
WP_011676114.1|1255622_1256288_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_032951080.1|1256386_1257736_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_021165245.1|1257736_1258522_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_081196664.1|1258586_1261193_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011676110.1|1261196_1261898_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.9e-36
WP_081196665.1|1262099_1262924_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.7	3.8e-72
WP_021165243.1|1262980_1263469_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011676107.1|1263465_1264938_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.8	3.6e-97
WP_063283889.1|1265520_1266114_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_081196666.1|1266128_1267340_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	45.6	3.3e-88
WP_011676103.1|1267743_1267986_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_011676102.1|1268093_1270115_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_021165239.1|1270114_1271068_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011676100.1|1271067_1271715_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011676099.1|1271951_1272719_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_032951092.1|1272827_1273847_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	43.1	2.0e-54
WP_081196667.1|1273912_1274413_-	glycopeptide antibiotics resistance protein	NA	NA	NA	NA	NA
WP_011676097.1|1274454_1275090_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.5	6.6e-56
WP_081196668.1|1276440_1277091_+	ComF family protein	NA	NA	NA	NA	NA
WP_011676095.1|1277148_1277727_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_011676094.1|1277743_1278199_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_081196669.1|1278182_1278671_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011676092.1|1278761_1279256_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021165232.1|1279325_1280294_-	phosphate starvation-inducible protein PhoH	NA	H6X2N1	Pseudomonas_phage	48.4	2.0e-48
WP_081196670.1|1280367_1281900_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_003130646.1|1282172_1282457_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011676089.1|1282458_1282794_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003130644.1|1282796_1283111_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_081196671.1|1283280_1284456_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011676087.1|1284448_1284847_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_081196672.1|1285019_1286363_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.6	5.5e-28
WP_021165230.1|1286415_1287231_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_011676084.1|1287369_1287735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676083.1|1287769_1288543_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_015082362.1|1288539_1289229_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_021165229.1|1289221_1289878_-	endonuclease III	NA	NA	NA	NA	NA
WP_011676080.1|1289899_1290568_-	DnaD domain-containing protein	NA	C5J987	Streptococcus_phage	31.4	1.1e-05
WP_081196673.1|1290832_1293262_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_014572507.1|1293792_1294398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165227.1|1294394_1294991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196674.1|1295317_1296208_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080513955.1|1296398_1297421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061778003.1|1297722_1298994_-	dihydroorotase	NA	NA	NA	NA	NA
WP_021165209.1|1299146_1299776_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	26.2	8.9e-05
WP_014572500.1|1299893_1300034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021212223.1|1300196_1302104_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	4.0e-48
WP_081196675.1|1302276_1302669_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_081196676.1|1302890_1303541_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_081196677.1|1303721_1305011_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1P8BLG2	Lactococcus_phage	97.4	9.7e-240
WP_015974072.1|1305007_1305274_-|holin	phage holin	holin	A0A1B1IMU0	Lactococcus_phage	100.0	1.6e-40
WP_011676503.1|1307593_1307818_-|holin	holin	holin	A0A1B1IMU8	Lactococcus_phage	100.0	6.1e-33
WP_081196678.1|1307831_1308863_-	hypothetical protein	NA	Q77MU1	Lactococcus_phage	99.4	2.6e-195
WP_081196679.1|1308859_1310017_-	hypothetical protein	NA	A0A1B1IMY7	Lactococcus_phage	99.7	5.5e-218
WP_015974099.1|1310021_1310918_-|tail	phage tail family protein	tail	Q77MU3	Lactococcus_phage	100.0	1.8e-168
WP_081196680.1|1310930_1313585_-|tail	phage tail protein	tail	A0A1B1IMY1	Lactococcus_phage	67.1	7.5e-178
WP_081196681.1|1313569_1313959_-	DUF5361 domain-containing protein	NA	A0A1P8BMT6	Lactococcus_phage	99.2	1.5e-63
WP_015968441.1|1313973_1314234_-	hypothetical protein	NA	A0A1B1IMY4	Lactococcus_phage	100.0	2.7e-40
WP_081196682.1|1314276_1314834_-|tail	phage tail protein	tail	A0A1P8BMS0	Lactococcus_phage	96.2	5.7e-96
WP_081196683.1|1314844_1315180_-	hypothetical protein	NA	A0A1B1IMY2	Lactococcus_phage	99.1	1.6e-53
WP_004254320.1|1315180_1315417_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	100.0	4.8e-36
WP_081196684.1|1315409_1315748_-	hypothetical protein	NA	Q38120	Lactococcus_phage	98.2	1.5e-59
WP_081196685.1|1315734_1316133_-	hypothetical protein	NA	A0A1B1IMX8	Lactococcus_phage	97.7	2.4e-64
WP_021211847.1|1316134_1316434_-	hypothetical protein	NA	Q38118	Lactococcus_phage	98.0	9.0e-48
WP_081196686.1|1316448_1317345_-|capsid	phage major capsid protein	capsid	A0A1B1IMW9	Lactococcus_phage	99.7	3.7e-169
WP_015968434.1|1317348_1317813_-	DUF4355 domain-containing protein	NA	A0A1B1IMS4	Lactococcus_phage	100.0	4.0e-79
WP_063283936.1|1317885_1319295_-	hypothetical protein	NA	A0A1B1IMV1	Lactococcus_phage	100.0	5.2e-279
WP_081196687.1|1319351_1319585_-	hypothetical protein	NA	D2J059	Enterococcus_phage	37.0	3.0e-06
WP_081196688.1|1319584_1320352_-	hypothetical protein	NA	Q38114	Lactococcus_phage	98.8	5.6e-142
WP_081196959.1|1320351_1321518_-|portal	phage portal protein	portal	O64275	Lactococcus_phage	99.0	2.8e-222
WP_031299190.1|1321727_1322060_-	HNH endonuclease	NA	O64273	Lactococcus_phage	100.0	3.9e-60
WP_081196689.1|1322185_1322617_-	transcriptional regulator	NA	A0A1P8BMU8	Lactococcus_phage	99.3	1.5e-80
WP_021166237.1|1322701_1322944_-	hypothetical protein	NA	A6MA87	Lactococcus_virus	69.6	8.7e-25
WP_081196690.1|1323186_1323873_-	hypothetical protein	NA	Q38108	Lactococcus_phage	98.2	4.8e-129
WP_081196691.1|1323869_1324175_-	hypothetical protein	NA	A0A1P8BKN7	Lactococcus_phage	99.0	5.2e-51
WP_081196692.1|1324171_1324597_-	dUTP diphosphatase	NA	A0A1P8BKN6	Lactococcus_phage	98.6	8.0e-74
WP_081196693.1|1324593_1325166_-	DUF1642 domain-containing protein	NA	A0A1P8BLD2	Lactococcus_phage	83.8	9.1e-65
WP_081196694.1|1325158_1325554_-	hypothetical protein	NA	Q9XJF2	Lactococcus_phage	96.2	9.4e-69
WP_081196695.1|1325564_1326158_-	DUF658 family protein	NA	A0A1B1IMX5	Lactococcus_phage	98.0	2.1e-96
WP_081196696.1|1326150_1326327_-	DUF1497 domain-containing protein	NA	A0A1B1IMW4	Lactococcus_phage	100.0	1.0e-22
WP_015966805.1|1326438_1326678_-	DUF1031 family protein	NA	Q9XJF0	Lactococcus_phage	100.0	5.2e-38
WP_011676027.1|1326681_1327071_-	RusA family crossover junction endodeoxyribonuclease	NA	R9QLL1	Lactococcus_phage	99.2	9.2e-69
WP_081196698.1|1327233_1328124_-	ATP-binding protein	NA	R9QM21	Lactococcus_phage	99.0	1.5e-162
WP_081196699.1|1328133_1328880_-	DNA replication protein	NA	A0A1P8BK94	Lactococcus_phage	92.3	2.4e-126
WP_011834781.1|1329012_1329516_-	hypothetical protein	NA	A0A059NT72	Lactococcus_phage	100.0	9.1e-93
WP_081196700.1|1329515_1330235_-	AAA family ATPase	NA	A0A059NT47	Lactococcus_phage	98.7	1.1e-131
WP_081196701.1|1330243_1330762_-	hypothetical protein	NA	A0A059NT60	Lactococcus_phage	95.3	1.8e-83
WP_081196702.1|1330861_1331104_-	hypothetical protein	NA	Q38336	Lactococcus_phage	96.2	3.2e-35
WP_081196703.1|1331105_1331438_-	DUF771 domain-containing protein	NA	Q8LTN9	Lactococcus_phage	97.3	1.5e-56
WP_081196704.1|1331450_1332251_-	phage antirepressor	NA	Q38330	Lactococcus_phage	98.1	5.1e-146
WP_015966780.1|1332262_1332505_-	hypothetical protein	NA	Q77JL3	Lactococcus_phage	100.0	5.2e-38
WP_081196705.1|1332734_1333571_+	helix-turn-helix domain-containing protein	NA	Q38089	Lactococcus_phage	98.6	3.3e-156
WP_081196706.1|1333630_1334152_+	hypothetical protein	NA	Q77S00	Lactococcus_phage	98.8	7.5e-66
WP_081196707.1|1334271_1335396_+|integrase	site-specific integrase	integrase	A0A1B1IME4	Lactococcus_phage	98.9	3.4e-212
WP_021165206.1|1335695_1336379_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_081196708.1|1336497_1338315_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.0	1.8e-90
WP_081196709.1|1338496_1339153_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_081196710.1|1339162_1340488_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.4	1.6e-24
WP_081196711.1|1340491_1341007_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011676007.1|1341027_1341714_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.5e-32
WP_021165202.1|1341841_1342798_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	38.1	1.8e-49
WP_081196497.1|1343274_1343955_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	1.9e-109
WP_011676004.1|1345399_1345843_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_011676003.1|1346000_1346906_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	6.0e-10
WP_011676002.1|1346968_1347421_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_014572493.1|1347709_1348090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165201.1|1348189_1349092_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_088793343.1|1349124_1350236_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_014572751.1|1350417_1350882_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.3	1.4e-39
WP_081196713.1|1350908_1352105_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.5	5.1e-110
WP_021165198.1|1352116_1352764_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.7	7.2e-42
WP_081196714.1|1352763_1353852_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.0	1.3e-51
WP_011835375.1|1354343_1355249_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_081196715.1|1355274_1357749_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.3e-96
1357384:1357407	attR	ACGAGCTTCGGTATAACGCATTGC	NA	NA	NA	NA
WP_081196716.1|1358020_1358470_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675992.1|1358466_1359300_-	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	40.0	5.3e-21
WP_081196717.1|1359292_1359829_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_021165194.1|1359935_1361870_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.4	3.1e-125
WP_011675988.1|1362148_1362790_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_011675987.1|1362963_1363182_+	redoxin NrdH	NA	C3U2K9	Lactococcus_phage	47.6	5.8e-12
WP_011675986.1|1363183_1363606_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.7e-12
WP_081196718.1|1363742_1365911_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	1.1e-256
WP_011675984.1|1366315_1367293_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_081196719.1|1367402_1368338_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675982.1|1368330_1369023_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
>prophage 8
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	1610085	1679059	2373708	holin,bacteriocin,transposase,tRNA	Bacillus_phage(26.67%)	57	NA	NA
WP_021165518.1|1610085_1611123_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015082639.1|1611194_1611797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011834866.1|1612043_1613357_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_081196781.1|1613506_1614673_-	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_011676626.1|1614673_1615747_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_081196782.1|1615989_1617339_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011676628.1|1617507_1617849_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_015082643.1|1617933_1619175_-	ammonium transporter	NA	NA	NA	NA	NA
WP_081196783.1|1619360_1620833_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	5.1e-27
WP_011676631.1|1620845_1621538_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	5.3e-35
WP_011834860.1|1621694_1622225_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_011676633.1|1622357_1622603_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021165524.1|1624529_1625366_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_021165525.1|1625477_1625882_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	47.4	9.7e-29
WP_081196784.1|1626627_1626930_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_152023977.1|1627485_1628597_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	1.4e-48
WP_021165529.1|1628783_1629434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196785.1|1629541_1630312_+	glycoside hydrolase, family 25	NA	Q38326	Lactococcus_phage	73.6	8.0e-64
WP_152023978.1|1630454_1631824_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	3.9e-53
WP_081196786.1|1631956_1633030_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.5e-60
WP_011676640.1|1633117_1634050_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.5	1.3e-23
WP_101944708.1|1634298_1635561_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	6.7e-60
WP_011676642.1|1635691_1636213_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_081196787.1|1636488_1637187_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_011676644.1|1637291_1637591_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021037569.1|1637580_1638498_+	cation transporter	NA	NA	NA	NA	NA
WP_061778247.1|1638735_1639977_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	3.4e-109
WP_032950319.1|1640087_1640894_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	1.1e-39
WP_015082654.1|1642507_1642750_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_015082655.1|1642865_1643192_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_081196788.1|1643178_1643886_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_021211949.1|1644080_1644653_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_011834841.1|1644737_1645280_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011676655.1|1645313_1646870_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_081196789.1|1646948_1649675_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011834838.1|1649723_1651436_-	ribonuclease J	NA	NA	NA	NA	NA
WP_081196790.1|1651785_1652457_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.5	1.4e-19
WP_011676659.1|1652496_1653390_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011676660.1|1653717_1654173_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	38.9	1.0e-26
WP_011676661.1|1654182_1655259_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015082666.1|1656565_1656817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165544.1|1656984_1658961_-	transketolase	NA	NA	NA	NA	NA
WP_081196791.1|1659128_1660529_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_021165546.1|1660581_1660881_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_032950333.1|1660882_1662823_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_011676669.1|1662997_1663639_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_081196792.1|1664588_1666007_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_081196793.1|1666960_1668487_-	MFS transporter	NA	NA	NA	NA	NA
WP_021165547.1|1668672_1669749_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_081196794.1|1671923_1672604_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021165548.1|1672668_1674099_-	MFS transporter	NA	NA	NA	NA	NA
WP_011834820.1|1674457_1674763_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_021165549.1|1674767_1674992_-|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_081196795.1|1675206_1676097_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676499.1|1676078_1676279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196796.1|1677506_1678796_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1P8BLG2	Lactococcus_phage	97.4	1.1e-240
WP_015966839.1|1678792_1679059_-|holin	phage holin	holin	Q38613	Lactococcus_phage	100.0	4.3e-41
>prophage 9
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	1817378	1887457	2373708	integrase,transposase,protease	Bacillus_phage(17.65%)	51	1877850:1877909	1882820:1882931
WP_081196833.1|1817378_1818269_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196834.1|1818269_1820270_-	type VII secretion protein EsaA	NA	NA	NA	NA	NA
WP_031286518.1|1820332_1820692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835707.1|1820699_1821170_-	type VII secretion protein EssA	NA	NA	NA	NA	NA
WP_011676794.1|1821277_1821568_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_021165659.1|1821915_1823328_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011676796.1|1823423_1823882_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MM29	uncultured_virus	32.1	4.5e-06
WP_031286519.1|1824015_1824498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021213770.1|1824499_1825720_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.7	1.7e-105
WP_021165660.1|1825719_1826976_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011676800.1|1827115_1827886_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.7	4.7e-08
WP_081196835.1|1828061_1829387_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_011676802.1|1829389_1830091_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_021165663.1|1830219_1830954_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	8.7e-36
WP_014572148.1|1830953_1831640_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014572147.1|1831785_1832694_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_162494678.1|1832817_1836441_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.4	1.5e-72
WP_081196836.1|1836548_1840139_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	24.5	8.3e-39
WP_011676808.1|1840407_1841007_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_021165666.1|1841242_1841917_+	helix-turn-helix transcriptional regulator	NA	S4TZZ1	uncultured_phage	43.1	3.5e-07
WP_011676811.1|1843660_1843966_-	MGMT family protein	NA	NA	NA	NA	NA
WP_011676812.1|1844035_1845709_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_021165669.1|1845919_1847371_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011676814.1|1847452_1847713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165671.1|1847733_1848756_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.2	2.2e-29
WP_011676817.1|1848975_1850757_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	36.5	2.8e-72
WP_011676818.1|1851136_1851319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152023974.1|1851525_1852637_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.6e-49
WP_011675640.1|1854079_1855243_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003129597.1|1855624_1856023_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_011675638.1|1856192_1856723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011834647.1|1856918_1857518_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.1e-52
WP_081196837.1|1857557_1858796_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_081196838.1|1858815_1861362_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_021166367.1|1862809_1866223_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_081196839.1|1866327_1867590_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003129585.1|1867967_1868114_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_021166366.1|1868110_1869328_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_081196840.1|1869330_1869990_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_081196841.1|1870118_1872482_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	31.9	4.3e-108
WP_021216088.1|1872656_1873574_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_081196842.1|1873767_1875291_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_014573008.1|1875477_1876047_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081146204.1|1876058_1877132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021166361.1|1877133_1877814_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.3e-29
1877850:1877909	attL	TAAACCTTATTTTTTAAGGTTGTAGAATGCTTTAAGACCTTTGTATTGAGCCACTTCAGC	NA	NA	NA	NA
WP_152023981.1|1878159_1879271_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_155724258.1|1880490_1880649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675611.1|1881802_1882738_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.8	3.0e-25
WP_010905473.1|1882825_1884127_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
1882820:1882931	attR	TAAACCTTATTTTTTAAGGTTGTAGAATGCTTTAAGACCTTTGTATTGAGCCACTTCAGCCAATTGGTCTTCGATACGAAGCAATTGGTTGTATTTAGCCATACGGTCTGTA	NA	NA	NA	NA
WP_011834629.1|1884314_1884872_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_011675609.1|1885006_1887457_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	1.3e-123
>prophage 10
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	2046358	2106146	2373708	transposase,protease,tRNA	Streptococcus_phage(22.22%)	47	NA	NA
WP_081196497.1|2046358_2047039_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	1.9e-109
WP_011677073.1|2047389_2048079_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011677074.1|2048465_2048891_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_021165035.1|2049026_2049791_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021165034.1|2049790_2050669_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.4	2.5e-05
WP_011677077.1|2050735_2050945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165033.1|2050978_2051500_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011677079.1|2051674_2052532_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011677080.1|2052576_2053035_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011677081.1|2053119_2053677_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_021464089.1|2053832_2054549_-	UMP kinase	NA	NA	NA	NA	NA
WP_021165032.1|2054633_2055086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014573258.1|2055215_2056403_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677084.1|2056561_2057749_-	acetate kinase	NA	NA	NA	NA	NA
WP_021165031.1|2057940_2058879_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677086.1|2058966_2059218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031286284.1|2059318_2061151_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	9.2e-18
WP_152023984.1|2061667_2062779_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_081196634.1|2063528_2064419_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165027.1|2064479_2064938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196874.1|2064952_2065567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031286281.1|2065906_2066635_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011677095.1|2066827_2067049_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_081196875.1|2067082_2068054_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_011677097.1|2068056_2068443_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011677098.1|2068558_2069005_-	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	33.6	2.5e-17
WP_014573269.1|2069170_2069836_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_081196876.1|2069786_2070881_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011677102.1|2070956_2071448_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_081196877.1|2071523_2073017_-	amino acid permease	NA	NA	NA	NA	NA
WP_021165024.1|2073206_2074337_-	aminotransferase	NA	NA	NA	NA	NA
WP_081196878.1|2074600_2075545_-	carbamate kinase	NA	NA	NA	NA	NA
WP_021213427.1|2076534_2078115_-	amino acid permease	NA	NA	NA	NA	NA
WP_021165021.1|2078246_2079311_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011677109.1|2081010_2082705_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
WP_004254487.1|2082772_2083231_+	arginine repressor	NA	NA	NA	NA	NA
WP_021165020.1|2083390_2084722_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_011677112.1|2084922_2085522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677113.1|2085738_2088843_-	DEAD/DEAH box helicase family protein	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_081196879.1|2090006_2090897_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196880.1|2093555_2095601_+	MnhB domain-containing protein	NA	NA	NA	NA	NA
WP_152023984.1|2097047_2098158_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_081196881.1|2098649_2100377_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	25.9	5.3e-31
WP_015082898.1|2100626_2101583_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011677117.1|2101655_2102435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677119.1|2102896_2103226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165011.1|2105363_2106146_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP015900	Lactococcus lactis subsp. cremoris strain JM2 chromosome, complete genome	2373708	2303744	2316026	2373708	integrase	Lactococcus_phage(92.86%)	17	2306262:2306287	2316320:2316345
WP_081196909.1|2303744_2305745_-	ATP-dependent DNA helicase RecG	NA	B2CRJ8	Acidianus_filamentous_virus	23.7	2.1e-07
WP_041931367.1|2305883_2306210_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
2306262:2306287	attL	TATTTTTTTACGCTTTTTACTACGTT	NA	NA	NA	NA
WP_081196910.1|2306298_2307477_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	46.3	1.8e-91
WP_162494685.1|2308953_2309151_+	hypothetical protein	NA	Q9AZJ6	Lactococcus_phage	81.2	1.4e-20
WP_081196911.1|2309154_2309403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196912.1|2309521_2309719_+	DUF1655 domain-containing protein	NA	Q9AZJ4	Lactococcus_phage	96.8	2.9e-26
WP_081196913.1|2309715_2310237_+	hypothetical protein	NA	Q9AZJ3	Lactococcus_phage	64.9	1.3e-54
WP_046781189.1|2310233_2310515_+	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	91.4	3.7e-43
WP_081196914.1|2310552_2310792_+	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	84.8	5.9e-34
WP_081196915.1|2310788_2311043_+	hypothetical protein	NA	Q9AZE9	Lactococcus_phage	85.5	1.3e-34
WP_081196916.1|2311039_2311375_+	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	95.4	1.9e-54
WP_081196917.1|2311371_2312166_+	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	94.7	1.3e-149
WP_081196918.1|2312176_2313805_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	93.0	1.2e-298
WP_081196919.1|2314032_2314575_+	hypothetical protein	NA	Q9AZI4	Lactococcus_phage	70.0	6.0e-58
WP_081196920.1|2314892_2315195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196921.1|2315268_2315679_+	DUF722 domain-containing protein	NA	Q9AZI2	Lactococcus_phage	94.1	1.0e-65
WP_081196978.1|2315702_2316026_+	sigma-70 family RNA polymerase sigma factor	NA	Q9AZI1	Lactococcus_phage	86.9	5.3e-46
2316320:2316345	attR	TATTTTTTTACGCTTTTTACTACGTT	NA	NA	NA	NA
>prophage 1
NZ_CP016744	Lactococcus lactis subsp. cremoris strain JM2 plasmid pJM2C, complete sequence	62261	45283	54973	62261		Staphylococcus_phage(33.33%)	7	NA	NA
WP_032489104.1|45283_48361_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.9	1.4e-18
WP_081196986.1|48360_49956_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.2	3.5e-122
WP_081196987.1|49945_51106_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.6	9.0e-27
WP_003132846.1|51386_51941_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.6	3.6e-42
WP_003132844.1|52290_52512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003132842.1|52546_52843_-	hypothetical protein	NA	A0A1S5SEW3	Streptococcus_phage	39.3	4.2e-05
WP_011669109.1|53089_54973_-	endopeptidase PepO	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.1	1.3e-72
>prophage 1
NZ_CP016745	Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence	113820	4406	75425	113820	transposase	Streptococcus_phage(33.33%)	54	NA	NA
WP_081196988.1|4406_5297_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196989.1|5349_6165_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_021166316.1|6286_6652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012898583.1|8404_8605_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	92.4	6.9e-28
WP_021166316.1|13943_14309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002360751.1|14846_15806_-|transposase	IS30-like element IS1062 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.3e-34
WP_012898583.1|16059_16260_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	92.4	6.9e-28
WP_081196221.1|16398_17079_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	5.5e-109
WP_063282456.1|17473_18511_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_011669063.1|18591_18843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572407.1|18971_19166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951467.1|19266_19848_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.4	6.9e-36
WP_021215358.1|19852_21778_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.6	5.7e-34
WP_010890648.1|22335_23016_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_003331352.1|23375_23672_+	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_155723511.1|24368_24710_+	cytochrome B	NA	NA	NA	NA	NA
WP_010891372.1|24900_25581_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	85.4	9.1e-112
WP_011669037.1|25680_26370_-	serine/threonine protein phosphatase	NA	A0A0C5JZB3	Enterococcus_phage	35.8	3.9e-30
WP_021213230.1|26470_26617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196222.1|27196_27565_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_003140158.1|28515_30315_+	excisionase	NA	A0A0U4J920	Pseudomonas_phage	30.4	7.9e-30
WP_032951462.1|31898_32411_-	RepB family protein	NA	NA	NA	NA	NA
WP_021164862.1|33873_34491_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	39.4	8.7e-21
WP_014573544.1|35014_36367_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_081196217.1|36744_37635_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573541.1|37920_38154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573540.1|38163_38922_+	AAA family ATPase	NA	H7BUL8	unidentified_phage	28.4	1.6e-16
WP_014573539.1|38925_39654_+	ParB N-terminal domain-containing protein	NA	Q4ZC37	Staphylococcus_virus	27.7	7.2e-06
WP_032951460.1|39683_40034_-	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	75.6	2.3e-10
WP_021213336.1|40023_41490_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	51.5	3.4e-124
WP_152023988.1|42971_44344_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	4.6e-54
WP_133265005.1|44401_45549_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	8.6e-46
WP_021165743.1|46424_47324_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_081196990.1|47652_53721_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_080683477.1|53849_54170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161485966.1|54186_54654_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.1	5.4e-23
WP_021215689.1|54924_55185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021212881.1|55699_55870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081146394.1|55942_56077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196991.1|56845_57421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063280555.1|57633_58212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063280554.1|58673_59195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063280553.1|59181_59985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152023989.1|60003_60825_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_152023990.1|60998_61244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280550.1|61362_63909_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_152023991.1|63991_64888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116368855.1|65698_67070_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	9.2e-55
WP_063280548.1|67418_68489_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	1.4e-05
WP_152023992.1|69452_70232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280545.1|70472_70784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063280544.1|70872_73338_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_063280543.1|73356_74469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010890648.1|74744_75425_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
>prophage 2
NZ_CP016745	Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence	113820	86565	99747	113820	transposase,integrase	Lactococcus_phage(30.0%)	12	98029:98053	100929:100953
WP_081196219.1|86565_87246_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.4	6.3e-105
WP_021164873.1|88465_88696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669083.1|88745_89042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152023993.1|89276_90424_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.2	7.2e-45
WP_011669084.1|90888_91089_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	97.0	9.6e-30
WP_003132324.1|91365_91566_-	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	1.6e-13
WP_021213567.1|91696_91897_-	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	54.9	2.8e-05
WP_081196995.1|92875_93556_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_081196204.1|94221_96024_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	24.2	2.3e-13
WP_021722469.1|96045_97557_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	30.3	9.5e-53
WP_081196996.1|97501_98686_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	37.1	3.6e-23
98029:98053	attL	GATAAATCATCATTTAGCTGAGATA	NA	NA	NA	NA
WP_081196211.1|98754_99747_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	7.7e-35
WP_081196211.1|98754_99747_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	7.7e-35
100929:100953	attR	TATCTCAGCTAAATGATGATTTATC	NA	NA	NA	NA
