The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	13207	69489	2397042	tRNA,transposase	Bacillus_phage(25.0%)	47	NA	NA
WP_011675087.1|13207_13774_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_063280587.1|13774_17263_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011675089.1|17579_17849_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_021165758.1|17879_18254_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_032951484.1|18253_18577_+	S1 RNA-binding domain protein	NA	NA	NA	NA	NA
WP_021165759.1|18717_20055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165760.1|20051_21320_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011675094.1|21300_21852_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	1.4e-09
WP_021165762.1|22057_24145_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G8DDJ2	Micromonas_pusilla_virus	49.2	1.6e-106
WP_063282465.1|25211_26996_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003331414.1|27036_27795_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|27806_29030_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_032950607.1|29264_31199_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_032950610.1|31245_31677_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_032950612.1|31825_32992_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_032940659.1|33651_34389_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003138385.1|34513_35689_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950618.1|36445_36811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675105.1|37743_38097_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_011675106.1|38218_38377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153041275.1|38436_39548_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_011675108.1|40030_40483_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675109.1|40567_40810_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014571770.1|40903_42526_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_011675112.1|42735_43257_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	42.1	1.0e-30
WP_015081831.1|43718_44894_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011675114.1|44991_45747_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_021165938.1|45898_47317_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	2.3e-40
WP_032950622.1|47535_49122_-	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_011834176.1|49114_50095_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011675118.1|50097_51222_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011675119.1|51310_52312_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_011675120.1|52504_53359_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.4	7.8e-12
WP_011675122.1|54137_54464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196043.1|54520_55411_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032950628.1|55562_56588_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011675125.1|57086_57524_+	OsmC family protein	NA	NA	NA	NA	NA
WP_032950631.1|57685_58999_+	APC family permease	NA	NA	NA	NA	NA
WP_011675127.1|59077_60073_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_032950633.1|60175_60988_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032950637.1|61513_63151_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	4.8e-50
WP_063280668.1|63650_63845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153041276.1|63826_65198_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	7.1e-55
WP_011675132.1|65258_65840_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950651.1|66696_67866_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_011675141.1|67876_68467_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_031559015.1|68553_69489_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
>prophage 2
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	86080	139729	2397042	protease,tRNA,bacteriocin,transposase	unidentified_phage(50.0%)	50	NA	NA
WP_011675157.1|86080_86536_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014571846.1|86528_87533_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011675159.1|87535_88159_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_011675160.1|88292_89690_+	amino acid permease	NA	NA	NA	NA	NA
WP_011675161.1|89859_90501_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_014571848.1|90531_91050_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950669.1|92026_94624_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_011834223.1|94753_95791_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.8	1.2e-46
WP_031559015.1|95875_96811_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011834224.1|97114_97381_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_011675166.1|97383_99111_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_032950672.1|99285_99594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675168.1|99683_99983_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011675169.1|100087_100375_+	serine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_032950700.1|100654_101590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032950701.1|102357_103140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032950703.1|103325_103646_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011675174.1|103768_104932_+	MFS transporter	NA	NA	NA	NA	NA
WP_101961446.1|105314_106425_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_032950708.1|106869_108306_+	permease	NA	NA	NA	NA	NA
WP_032950711.1|109261_110455_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_021165999.1|110483_111863_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011675183.1|111879_113076_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011675184.1|113268_113844_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031286668.1|113985_114354_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_011675186.1|114350_115160_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_081196044.1|115247_116162_+	protein jag	NA	NA	NA	NA	NA
WP_003131818.1|116293_116428_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_011675188.1|116604_117516_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_031559015.1|117676_118612_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_063280608.1|118705_118975_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011675190.1|119151_119310_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_032950716.1|119392_120073_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003131820.1|120367_120634_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_011675192.1|120633_121065_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003131822.1|121165_121489_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_032950719.1|121518_122070_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_032950722.1|122159_122945_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021166007.1|122964_123276_-	DUF2316 family protein	NA	NA	NA	NA	NA
WP_011675197.1|123285_124071_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675198.1|124189_124735_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950724.1|124800_126744_-	1,4-alpha-glucan-branching protein	NA	NA	NA	NA	NA
WP_014571867.1|126863_127184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675201.1|128019_128559_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063280609.1|129014_134420_+	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_031559015.1|134512_135448_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011677192.1|136204_136537_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_032951303.1|136886_137621_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.0	2.0e-16
WP_011677190.1|137620_138424_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011677189.1|138442_139729_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 3
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	169808	295530	2397042	protease,transposase,tRNA,terminase,integrase	Lactococcus_phage(52.94%)	132	282498:282521	296087:296110
WP_031559015.1|169808_170744_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032951276.1|171048_171357_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_032951274.1|171375_171999_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_011677162.1|172024_172651_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_011836026.1|172650_172944_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_011677160.1|172959_173790_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_011677159.1|173949_174228_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_010906302.1|174243_174591_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_003129960.1|174603_175257_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_063280538.1|175260_175674_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_003129957.1|175673_175883_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_003129955.1|175903_176164_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_003129953.1|176186_176555_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_003129951.1|176688_176994_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_003129948.1|177013_177556_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_003129946.1|177574_177760_+	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_011677156.1|177910_178510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011677155.1|178714_179113_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_011677154.1|179329_179866_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_011677153.1|180134_180482_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_032951271.1|180500_181007_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_003129921.1|181017_181197_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_011677151.1|181492_181936_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_032951269.1|182013_183333_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_011677149.1|183472_184120_+	adenylate kinase	NA	NA	NA	NA	NA
WP_003130554.1|184422_184641_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001808836.1|184694_184811_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_003130555.1|184828_185194_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_010906297.1|185214_185598_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_003130557.1|185646_186585_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_003130558.1|186603_186984_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_063280539.1|187695_188886_+	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_021164992.1|188892_189873_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.3	2.0e-11
WP_032951257.1|190859_191849_+	alpha-1,2-fucosyltransferase	NA	E3SJA0	Synechococcus_phage	30.2	1.1e-12
WP_011677142.1|194338_194914_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	32.3	7.8e-24
WP_011677141.1|194910_195456_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011677138.1|196619_197981_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_081196046.1|198081_198972_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280748.1|199028_199712_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003138385.1|199905_201081_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032951248.1|201299_202385_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_011677135.1|202442_203072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011677134.1|203193_203550_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011677133.1|203542_203881_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_011677132.1|203877_204201_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_014573309.1|204291_204786_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032951246.1|205938_206823_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032951245.1|206931_207474_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	28.6	9.7e-08
WP_032951243.1|207477_207972_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_032951242.1|208113_209565_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032951241.1|209676_210999_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.3	5.5e-113
WP_011677124.1|211087_211930_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021165010.1|212793_215085_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_011677122.1|215256_216126_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_032951238.1|216161_216944_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_153041277.1|217575_218687_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_032951233.1|218807_219770_-	D-2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	32.7	3.7e-34
WP_061778365.1|220029_220992_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_061778324.1|221190_221580_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003331415.1|221750_222974_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_003331414.1|222985_223744_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_081196048.1|223819_224716_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017865109.1|225196_225406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951226.1|225466_225958_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032951223.1|225981_226476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595613.1|226570_227635_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_063280540.1|227649_229695_-	MnhB domain-containing protein	NA	NA	NA	NA	NA
WP_081196049.1|232353_233244_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032951212.1|234408_237513_+	DEAD/DEAH box helicase family protein	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_011677112.1|237729_238329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951210.1|238529_239861_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_004254487.1|240020_240479_-	arginine repressor	NA	NA	NA	NA	NA
WP_011677109.1|240546_242241_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
WP_081196050.1|243676_244525_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021165021.1|244948_246013_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_021213427.1|246144_247725_+	amino acid permease	NA	NA	NA	NA	NA
WP_032951208.1|248714_249659_+	carbamate kinase	NA	NA	NA	NA	NA
WP_021165024.1|249922_251053_+	aminotransferase	NA	NA	NA	NA	NA
WP_032951207.1|251242_252736_+	amino acid permease	NA	NA	NA	NA	NA
WP_011677102.1|252811_253303_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_032951206.1|253378_254473_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_014573269.1|254423_255089_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_032951204.1|255254_255701_+	DNA starvation/stationary phase protection protein	NA	A0A2K9VDB4	Lactobacillus_phage	33.1	3.2e-17
WP_011677097.1|255816_256203_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_032951202.1|256205_257177_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_011677095.1|257210_257432_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_031286281.1|257624_258353_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014573264.1|258692_259307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165027.1|259321_259780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196051.1|259840_260731_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_031286284.1|261881_263714_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	9.2e-18
WP_011677086.1|263814_264066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951195.1|264153_265092_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677084.1|265283_266471_+	acetate kinase	NA	NA	NA	NA	NA
WP_032951192.1|266629_267817_+	acetate kinase	NA	NA	NA	NA	NA
WP_021165032.1|267946_268399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004254608.1|268483_269200_+	UMP kinase	NA	NA	NA	NA	NA
WP_011677081.1|269355_269913_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011677080.1|269997_270456_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032951191.1|270500_271358_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011677078.1|271532_272054_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011677077.1|272087_272297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951189.1|272363_273242_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.4	2.5e-05
WP_032951185.1|273241_274006_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011677074.1|274141_274567_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_011677073.1|274953_275643_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_031559015.1|275761_276697_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_014573252.1|276796_277141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011677071.1|277152_277374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677070.1|277388_277787_-	HIT family protein	NA	NA	NA	NA	NA
WP_011677068.1|279876_280647_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	4.9e-29
WP_021165037.1|280639_281659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021216177.1|281691_282318_-	hypothetical protein	NA	NA	NA	NA	NA
282498:282521	attL	TTTTAACGCTTTTTACTACGTTCG	NA	NA	NA	NA
WP_011677065.1|282530_283712_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	45.2	4.9e-89
WP_032951175.1|284237_285560_-	deoxyribonuclease	NA	NA	NA	NA	NA
WP_011677061.1|285688_285883_-	hypothetical protein	NA	Q9AZK1	Lactococcus_phage	96.9	3.9e-28
WP_011834155.1|285955_286186_-	hypothetical protein	NA	Q9AZK0	Lactococcus_phage	85.5	1.2e-15
WP_032951173.1|286611_287475_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032951171.1|287949_288459_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	98.2	7.3e-90
WP_032951169.1|288707_288902_+	DUF1655 domain-containing protein	NA	Q9AZF2	Lactococcus_phage	93.8	4.3e-27
WP_032951168.1|288905_289427_+	hypothetical protein	NA	Q9AZJ3	Lactococcus_phage	77.5	2.4e-72
WP_021212079.1|289423_289642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951167.1|289638_289920_+	hypothetical protein	NA	Q9AZJ1	Lactococcus_phage	94.6	1.1e-44
WP_032951166.1|289962_290202_+	hypothetical protein	NA	Q9AZJ0	Lactococcus_phage	97.5	6.1e-39
WP_025017252.1|290449_290644_+	hypothetical protein	NA	Q9AZE8	Lactococcus_phage	98.4	8.7e-28
WP_032951164.1|290630_290966_+	hypothetical protein	NA	Q9AZI7	Lactococcus_phage	93.5	4.0e-52
WP_032951161.1|290962_291757_+	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	90.9	4.0e-143
WP_032951159.1|291767_293396_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	95.0	5.4e-304
WP_032951156.1|293631_294213_+	hypothetical protein	NA	Q9AZI4	Lactococcus_phage	90.7	2.2e-90
WP_032951179.1|294333_294774_+|terminase	terminase small subunit	terminase	Q9AZI3	Lactococcus_phage	87.7	1.6e-56
WP_032951154.1|294773_295106_+	hypothetical protein	NA	Q9AZE0	Lactococcus_phage	88.9	6.9e-49
WP_032951152.1|295206_295530_+	sigma-70 family RNA polymerase sigma factor	NA	Q9AZI1	Lactococcus_phage	86.0	1.0e-44
296087:296110	attR	TTTTAACGCTTTTTACTACGTTCG	NA	NA	NA	NA
>prophage 4
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	416632	483410	2397042	protease,transposase	unidentified_phage(21.05%)	56	NA	NA
WP_003130410.1|416632_417580_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_014573100.1|418685_419342_+	DUF2140 family protein	NA	NA	NA	NA	NA
WP_010905402.1|419446_419722_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.4	1.6e-22
WP_081196057.1|419831_420329_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021165946.1|420511_421021_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	44.5	5.1e-27
WP_021165947.1|421035_421584_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_011675543.1|422545_423355_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	5.3e-18
WP_015082100.1|423351_424077_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014573095.1|424138_424597_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675546.1|424593_424971_+	DUF3021 family protein	NA	NA	NA	NA	NA
WP_021165952.1|425079_426225_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_032951420.1|426374_427253_+	gamma-glutamyl-diamino acid-endopeptidase	NA	NA	NA	NA	NA
WP_021165954.1|427309_428959_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063280768.1|429150_430083_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	71.1	1.8e-118
WP_031559015.1|430214_431150_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032951424.1|431376_432462_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.1	2.1e-09
WP_032951425.1|432497_433130_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	45.8	2.7e-49
WP_161940334.1|433130_435212_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_021165958.1|435198_435840_-	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_014573088.1|435920_436445_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_063280739.1|436604_436991_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011675557.1|437215_437497_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_011834553.1|437480_438242_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_081196058.1|438336_439617_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011675560.1|439616_439808_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_011675561.1|439983_441267_+	trigger factor	NA	NA	NA	NA	NA
WP_032951358.1|448126_450040_+	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	33.5	3.9e-43
WP_080683464.1|450116_451460_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	3.2e-36
WP_031559015.1|452398_453334_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_015082114.1|453543_454923_+	MFS transporter	NA	NA	NA	NA	NA
WP_014573078.1|455078_455948_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032951356.1|455957_457223_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011834562.1|457451_457796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675568.1|457841_460088_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	3.3e-126
WP_032951355.1|460213_460684_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_021166306.1|461285_461921_-	peptide deformylase	NA	Q6VSW0	Vibrio_phage	36.4	3.8e-11
WP_011675572.1|462075_462480_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032951352.1|462541_464620_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011675574.1|464801_465623_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011675575.1|466808_467264_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011675576.1|467539_468292_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011675577.1|468477_469440_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_011675578.1|469614_470373_-	HAD-IIB family hydrolase	NA	A0A2P1EM96	Moumouvirus	25.9	6.1e-08
WP_011675579.1|470467_471058_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014573068.1|471074_471611_-	phosphopantothenoylcysteine decarboxylase	NA	Q9J5A8	Fowlpox_virus	34.9	6.8e-22
WP_011675580.1|471603_472299_-	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.7	1.7e-17
WP_011675581.1|472445_472631_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_032951347.1|472816_475144_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.0	3.3e-44
WP_011675583.1|475176_475620_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032951345.1|475846_476443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153041279.1|476504_477616_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	6.1e-49
WP_011675590.1|477946_478990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573057.1|478995_479205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280755.1|480827_481598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280754.1|481863_482238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|482474_483410_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
>prophage 5
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	513387	587072	2397042	protease,tRNA,integrase,transposase	Bacillus_phage(19.05%)	60	554261:554320	589696:589804
WP_096824164.1|513387_514308_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	32.8	1.7e-20
WP_021166332.1|514540_515788_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.0e-98
WP_003138385.1|515934_517110_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032951334.1|517237_517840_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	38.2	2.0e-22
WP_011675604.1|517966_519064_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	61.4	1.9e-127
WP_032951332.1|519060_520257_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	51.5	6.9e-115
WP_011675606.1|520302_520965_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_011675742.1|521001_521295_-	acylphosphatase	NA	NA	NA	NA	NA
WP_015082133.1|521406_522165_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_032951330.1|522376_522766_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011675746.1|523071_523419_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014573050.1|523432_523759_+	inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_011675748.1|523934_524378_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	32.5	3.2e-09
WP_011675750.1|526242_526872_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082136.1|527151_528006_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011675752.1|528028_528934_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011675753.1|529036_529483_-	GtrA family protein	NA	NA	NA	NA	NA
WP_021211719.1|529628_530360_+	TIM44-like domain-containing protein	NA	NA	NA	NA	NA
WP_032951327.1|530391_530667_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_011675756.1|530769_530946_+	DUF3272 family protein	NA	NA	NA	NA	NA
WP_011834603.1|531078_532011_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_081196069.1|532072_532858_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011675759.1|533024_533444_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_011675760.1|533473_534034_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_014573039.1|534167_535586_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	33.0	8.4e-35
WP_032951324.1|535767_537789_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	34.1	1.4e-64
WP_011675763.1|538003_540019_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.8	2.6e-58
WP_080683462.1|540071_540242_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_011675765.1|540436_541102_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.8	2.3e-19
WP_011675766.1|541233_542118_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_011675767.1|542263_542932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675768.1|543096_543999_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.2	1.8e-35
WP_011675770.1|545372_545720_-	XRE family transcriptional regulator	NA	A0A182BQC8	Lactococcus_phage	75.4	1.6e-43
WP_015082147.1|546484_547408_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_011675772.1|547400_548102_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032951320.1|548274_550503_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	6.7e-79
WP_011834623.1|550626_551139_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	5.3e-32
WP_021166354.1|551354_551918_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_032951319.1|552053_553694_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014573028.1|553754_554225_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
554261:554320	attL	TGTAGTGACCCCCAAAATATAGACTTTTCAAATCTATATTTCGGAGGTCTTTTCTTATGG	NA	NA	NA	NA
WP_011834627.1|555904_556360_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675609.1|556349_558800_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	1.3e-123
WP_011834629.1|558934_559492_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010905473.1|559679_560981_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
WP_032951316.1|561069_562005_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.1	8.0e-26
WP_011675617.1|563553_563730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|563976_564912_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_063280860.1|564986_565850_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_021036847.1|566110_568474_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	31.8	3.6e-107
WP_011675632.1|568602_569262_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_032951433.1|569264_570482_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003129585.1|570478_570625_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_032951434.1|571002_572265_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021166367.1|572369_575783_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_032951436.1|579796_581035_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011834647.1|581074_581674_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.1e-52
WP_032951437.1|581869_582400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129597.1|582569_582968_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_063280878.1|583349_584513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153041280.1|586217_587072_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
589696:589804	attR	CCATAAGAAAAGACCTCCGAAATATAGATTTGAAAAGTCTATATTTTGGGGGTCACTACACTCTTTTATTTATTTGTGATTCTTTTTAAAAAGTGGACTAAACAACCGA	NA	NA	NA	NA
>prophage 6
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	599493	656515	2397042	integrase,bacteriocin,transposase	Lactococcus_phage(33.33%)	47	599394:599426	659502:659534
599394:599426	attL	CGCAAATTGTAAAATGAAGTTAGCCACCTTGAG	NA	NA	NA	NA
WP_031559015.1|599493_600429_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_063280649.1|600447_601896_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_021213515.1|601996_603139_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_063280648.1|603128_604268_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_032951444.1|604351_605794_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_042748819.1|605877_608280_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.9e-10
WP_032951447.1|608510_610313_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_011675661.1|610388_610646_+	helix-turn-helix transcriptional regulator	NA	S5MAC0	Brevibacillus_phage	42.4	1.6e-05
WP_011675662.1|610745_610895_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_032951448.1|611775_613269_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.0	1.3e-73
WP_032951450.1|613989_615465_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011675669.1|615464_616460_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_050595621.1|616682_618434_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.7	1.5e-20
WP_011675671.1|618433_620155_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.7	2.3e-18
WP_015082174.1|620488_621376_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003331415.1|621522_622746_+|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_063280872.1|623583_624060_+	flavodoxin	NA	NA	NA	NA	NA
WP_021166169.1|624075_624750_+	lysophospholipase	NA	NA	NA	NA	NA
WP_011675676.1|626587_627244_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_081196072.1|627317_627962_-	DedA family protein	NA	NA	NA	NA	NA
WP_014572963.1|628236_630231_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.2	1.1e-32
WP_032949716.1|630297_630516_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_015082180.1|630726_631389_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_021166165.1|631417_632404_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_032949719.1|634020_634221_+	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	55.8	2.6e-06
WP_011675684.1|634343_634544_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	60.9	3.0e-15
WP_011675685.1|634812_635013_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.8	2.3e-23
WP_011675686.1|635339_636092_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011675688.1|636929_637397_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_032949721.1|637737_637941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949723.1|637960_639127_-|integrase	site-specific integrase	integrase	A0A2H4J5L5	uncultured_Caudovirales_phage	28.6	2.8e-20
WP_050595582.1|639123_640320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949725.1|640706_641531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139949727.1|641546_642047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063282460.1|642236_643586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949727.1|643586_643838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949728.1|643858_644236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676499.1|644553_644754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196073.1|644735_645626_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032950344.1|645840_646065_+|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011834820.1|646069_646375_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_032950343.1|646733_648164_+	MFS transporter	NA	NA	NA	NA	NA
WP_011676494.1|648228_648909_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950341.1|651082_652159_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_032950339.1|652344_653871_+	MFS transporter	NA	NA	NA	NA	NA
WP_031288657.1|653930_654812_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_081196074.1|655624_656515_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
659502:659534	attR	CGCAAATTGTAAAATGAAGTTAGCCACCTTGAG	NA	NA	NA	NA
>prophage 7
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	714756	782166	2397042	integrase,tRNA,bacteriocin,transposase	unidentified_phage(10.0%)	63	707959:707976	780532:780549
707959:707976	attL	TGATAAGTCTGTCAGTAA	NA	NA	NA	NA
WP_021212493.1|714756_715800_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011676611.1|715935_717054_-|integrase	site-specific integrase	integrase	A0A1S5S8R9	Streptococcus_phage	30.2	7.1e-37
WP_032950295.1|717171_717510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950287.1|718800_718983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032950285.1|719329_719512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082636.1|721058_721766_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_063280606.1|721826_722981_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_031286480.1|723285_724425_+	thiolase family protein	NA	NA	NA	NA	NA
WP_021165514.1|724472_725705_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_011834878.1|725789_726062_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011676598.1|726157_726397_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_015082632.1|726596_727553_+	ferrochelatase	NA	NA	NA	NA	NA
WP_015082631.1|727578_728424_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011676595.1|728608_729124_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_081196164.1|729128_729872_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011834883.1|729997_730390_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_015082629.1|730406_731252_+	DegV family protein	NA	NA	NA	NA	NA
WP_021165512.1|731381_732164_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_021165511.1|732229_732772_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011834887.1|732971_734180_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.8	1.8e-41
WP_161631173.1|734309_735728_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_021165509.1|735837_736356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165508.1|736460_737540_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011834890.1|737623_738577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950272.1|738724_740596_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	1.9e-55
WP_032950270.1|740602_740785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161631172.1|740842_741628_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032950268.1|741638_742190_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011676580.1|742330_743266_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.7	1.5e-64
WP_021165504.1|743390_744098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676578.1|744157_744427_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_032950264.1|744539_745586_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_032950262.1|745678_746677_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950261.1|747537_747990_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_032950259.1|748038_749403_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	25.7	9.6e-28
WP_081196077.1|749576_750467_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032950252.1|752514_753354_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	55.0	2.1e-86
WP_031559015.1|753389_754325_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032950249.1|754700_755573_+	hypothetical protein	NA	A0A1P8BMN5	Lactococcus_phage	54.5	5.5e-13
WP_011834907.1|755836_756283_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032950248.1|756279_757653_+	MFS transporter	NA	NA	NA	NA	NA
WP_011834909.1|757873_758626_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032950247.1|758642_759011_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_015082612.1|759045_759360_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011676481.1|759372_759666_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011676480.1|759681_760089_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015082611.1|760227_760938_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.2	9.0e-46
WP_011676478.1|760992_761259_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011676477.1|761255_761936_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011676476.1|762152_764372_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.0	6.5e-151
WP_050574197.1|764422_765877_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	1.2e-55
WP_015082608.1|765989_766613_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_153041297.1|767960_769108_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.2	5.5e-45
WP_153041282.1|769185_770579_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.0	7.7e-57
WP_021166106.1|770592_770742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950237.1|770952_771759_+	hypothetical protein	NA	A0A1P8BMN5	Lactococcus_phage	47.6	2.2e-11
WP_015082606.1|771945_774549_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.7	1.4e-123
WP_014734994.1|774738_775755_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.5	1.9e-60
WP_011676469.1|775784_776333_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.0	1.5e-19
WP_081196078.1|776523_778113_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	34.1	1.9e-11
WP_015082602.1|778164_778695_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676466.1|779890_780433_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.6	4.7e-10
WP_021166101.1|780609_782166_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.5	1.6e-71
780532:780549	attR	TTACTGACAGACTTATCA	NA	NA	NA	NA
>prophage 8
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	806801	921151	2397042	integrase,transposase	Staphylococcus_phage(20.0%)	95	838378:838437	895828:897141
WP_081196080.1|806801_807977_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950214.1|808060_809860_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_081146222.1|809969_810701_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.8	5.5e-06
WP_081196081.1|812251_813142_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032945982.1|813322_813712_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_011834952.1|813858_814548_+	VIT family protein	NA	NA	NA	NA	NA
WP_011834953.1|814547_815228_+	VIT family protein	NA	NA	NA	NA	NA
WP_032950210.1|815303_816047_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011834955.1|816156_816576_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031286704.1|816587_817226_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_032950206.1|818085_818850_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_081196082.1|818913_819804_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032950203.1|820028_820583_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_101961446.1|821036_822147_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_011675801.1|822251_823082_-	SP_1767 family glycosyltransferase	NA	NA	NA	NA	NA
WP_014572862.1|823387_824806_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_011675803.1|824934_825294_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011675804.1|825337_826441_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	6.3e-30
WP_031559015.1|826938_827874_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_031559015.1|828151_829087_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_081196083.1|829192_830083_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196084.1|830208_831099_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032949837.1|831278_833321_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.9	1.2e-61
WP_032949839.1|833509_834367_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.0	2.6e-39
WP_031286477.1|834537_835791_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_011675817.1|835793_836033_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_081196085.1|836259_837150_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280633.1|837208_838354_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	2.0e-47
838378:838437	attL	TGATACTGTCAATAATTATGTGTAAACACTCAAGTAGAGTTGAAGAATATTAATCAAATA	NA	NA	NA	NA
WP_081196086.1|838426_839602_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.9	5.5e-32
WP_014572853.1|839899_840757_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_021165631.1|840757_841258_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021165632.1|841333_842140_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_011675823.1|842136_842583_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011675824.1|842762_844430_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_133265005.1|844546_845693_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	8.6e-46
WP_153041283.1|845748_846672_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	5.6e-56
WP_081196088.1|846563_847124_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031559015.1|847219_848155_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_015082274.1|848954_849521_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011835491.1|849615_850137_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_032940916.1|851327_852269_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011675830.1|852424_852805_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_081196089.1|852801_855099_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011835486.1|855173_856163_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_032949842.1|856361_856646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949846.1|858421_859084_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
WP_032949848.1|859443_860331_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081196090.1|860589_861480_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_153041284.1|861603_862619_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.4	4.2e-36
WP_011675837.1|862697_863372_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_011675838.1|863531_863876_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011675839.1|864051_864468_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011675840.1|864805_865267_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021037017.1|865520_866030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280607.1|866022_867351_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003138385.1|867375_868551_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032949860.1|868902_869460_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_011675844.1|869522_869768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675845.1|870040_870766_+	nicotinamide mononucleotide transporter	NA	A0A2P0ZKW0	Lactobacillus_phage	28.7	1.4e-14
WP_014572836.1|871318_871744_+	universal stress protein	NA	NA	NA	NA	NA
WP_015082285.1|871911_872274_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_011675849.1|872335_872869_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081196092.1|873540_874431_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_031559015.1|875218_876154_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_003131392.1|877701_878034_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_032949873.1|878168_879143_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.3	7.3e-30
WP_021165731.1|879767_880010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153041285.1|880061_881173_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.1e-49
WP_032949877.1|882354_882984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949879.1|882980_883979_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_021165122.1|884006_884636_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011675857.1|884706_885513_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014572825.1|885612_886203_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	45.5	3.2e-28
WP_011675859.1|886204_886636_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032949881.1|886632_887238_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	36.4	1.5e-28
WP_011835464.1|887449_888694_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_063280777.1|890025_890787_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_021165126.1|891331_892882_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	23.6	1.3e-25
WP_011835459.1|893292_894915_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_081196086.1|895876_897052_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.9	5.5e-32
WP_011675866.1|897169_898069_+	EamA family transporter	NA	NA	NA	NA	NA
895828:897141	attR	TGATACTGTCAATAATTATGTGTAAACACTCAAGTAGAGTTGAAGAATATTAATCAAATAAGCTTTCAAGTGTGTCAGCACATTGGCCAAACCCTTTATGGATGCGTTGACTTTGCTTGAAATTATAATCTTCAAACAAAGTAACTAAGTAACGTTCCAGAGCCTCCTCGTTAGGAAAAAGAACCTTCTTTTTCGTTTGACGTTTGATTTCTTTGTTAAGAGACTCAATGAGGTTTGTCGAATAAATGCTGTGCCAAATCTGGTAGGGAAACTGATAAAAAGTTAAAAGATTATCCGTATTCTCCAGACTTTCCATGACTTTCCTATACTTTGGTTTCCATTCGGCGATAAAGTTCTCTAAAGCTTGCACTGCCATTTCTAAATTTTCAGCACGATAAATCGTTTTAAATTGCTCCAGAATAACCGCTCTATCTGCTCGTTTCACTTTACTAGCTAGATTTCGACTAATATGAATTAAGCAACGTTGTTGTTTAGCTAATGGGTAAGCCTGACTGATAATCTGTTCAAGCCCCTTGAAGCCATCGGTCACTACAAGAGAAACCTGTTGGATTCCTTGGTTTTGAAGCTTGTCTAACAGGGTGGACCAAGAAGCATTGTTTTCATTTGGGGCGATTTCATATCCAAGAACAGCCTTCTGTCCTTCTGGTGTAATGCCAAGTGCGATATGAATACATTCTTTACTAACGGTTCCACGTCTTAATGGAAGATAGGTTCCGTCAAGAAATAAAACAGAGTAATTGGCTTCTAAGCTTCGCTCATGAAAAGTAGCGACATTCTCCTGAGTTGCTTTTGAGATATTAGAAATTGTGGCAGGACTATAGTGATGACCATACATTCGCTCGATGATATCACAAATTTCTCGAGTCGTTACACCGGTTTGATAGAGTTTGATAACCATCTCTTCCAAGTGGTCATCTCGACGTCCATAAGCGGGAAGCAAAGCTGGACTAAAGTTCCCATTACGATCTCTAGGAATGCTCAACTGAACAGTCCCATATTTGGTTTCAAATTGCCGTGAATAGCTTCCGTTACGACTATTCCCAGAATTATAGCCTACTTTATCGTAAGGTTCATACCCTAAAAAGGCTGATAACTCTGCTTGAAGCAGATCATTCATAGCAGTTTCAAGAGAAGTACGGAAAAATTCATCAATATCTTGCTTTTGGGCTAGGAAGTTAAGTAGTTCTGTGGTAAACTGAGTCATAGGAATAAATCTCTTTCTAGTAATGTTTCGCAACTCTACTATAACGGATTTATTCCTTTTTGTGTTTACACAACTTATTTTACACTACC	NA	NA	NA	NA
WP_011835457.1|898191_898956_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	4.5e-27
WP_014572815.1|898936_900517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572814.1|900691_901537_+	VOC family protein	NA	NA	NA	NA	NA
WP_011675869.1|901602_902250_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011675870.1|902375_904331_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	3.7e-142
WP_011675871.1|904429_904615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949893.1|904838_905576_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.3	5.3e-81
WP_081196095.1|905660_906110_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.4	1.8e-28
WP_015082299.1|906653_907118_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050595588.1|908654_909383_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_081196096.1|909661_910552_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280659.1|910715_911624_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_032949909.1|914859_917967_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_081196086.1|919975_921151_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.9	5.5e-32
>prophage 9
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	939924	1105309	2397042	capsid,tail,protease,transposase,plate,head,tRNA,holin,terminase,integrase,portal	Lactococcus_phage(53.68%)	169	1006026:1006085	1105269:1106337
WP_031559015.1|939924_940860_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011675898.1|941005_941269_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011675899.1|941385_942723_+	PFL family protein	NA	NA	NA	NA	NA
WP_031559015.1|942788_943724_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032949932.1|943893_944373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675901.1|944443_945139_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011675902.1|945135_945882_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011675903.1|945896_946301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675904.1|946448_947492_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014572780.1|947521_948061_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011675956.1|948132_949956_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	45.8	3.4e-129
WP_032949936.1|950118_951963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949938.1|952132_953896_+	oleate hydratase	NA	NA	NA	NA	NA
WP_032949940.1|953962_955102_+	amidohydrolase	NA	NA	NA	NA	NA
WP_032949942.1|955223_955925_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032949944.1|956007_956925_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_032949946.1|956924_958829_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_153041286.1|958912_960285_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	2.1e-54
WP_011675965.1|962321_962723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196098.1|963282_964173_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196099.1|964361_966224_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.3	3.1e-98
WP_021165185.1|966293_966521_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011675969.1|966535_967075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949960.1|967950_969396_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011675972.1|969460_970348_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_032949962.1|970344_971328_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	65.2	1.3e-119
WP_011675974.1|971423_972341_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	43.9	2.2e-60
WP_011675975.1|972373_972931_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032949965.1|973219_974128_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.4e-21
WP_032949972.1|975884_976688_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003130958.1|976702_977233_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_014572762.1|977396_978302_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_032949978.1|978439_979537_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_011675982.1|979866_980559_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
WP_021165191.1|980551_981487_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675984.1|981596_982574_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_011675985.1|982978_985147_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	3.3e-256
WP_032949980.1|985283_985706_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.3e-12
WP_011675987.1|985707_985926_-	redoxin NrdH	NA	C3U2K9	Lactococcus_phage	47.6	5.8e-12
WP_011675988.1|986099_986741_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_011675989.1|987019_988954_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.4	1.8e-125
WP_015082341.1|989060_989597_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_032949983.1|989589_990423_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	39.4	2.0e-20
WP_014572756.1|990419_990869_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675994.1|991141_993616_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.0e-96
WP_032949986.1|993641_994547_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_031559015.1|995966_996902_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032949994.1|997202_997850_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.2	4.7e-41
WP_021165199.1|997861_999058_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.5	5.1e-110
WP_014572751.1|999084_999549_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.3	1.4e-39
WP_153041287.1|999730_1000841_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	2.3e-48
WP_063280861.1|1000874_1001777_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572493.1|1001876_1002257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676002.1|1002545_1002998_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011676003.1|1003060_1003966_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	6.0e-10
WP_011676004.1|1004123_1004567_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
1006026:1006085	attL	CGCAAATTGCAAGTCCAAGTTAGCCAGCCAAGCTCATCTCATATGAACTCTTATAGTTGA	NA	NA	NA	NA
WP_003130410.1|1006044_1006992_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_011835358.1|1007493_1009311_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	36.1	4.8e-91
WP_032950002.1|1009429_1010113_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_081196102.1|1010412_1011537_-|integrase	site-specific integrase	integrase	A0A1B1IME4	Lactococcus_phage	98.9	1.3e-211
WP_021211870.1|1011660_1012242_-	hypothetical protein	NA	A0A182BQD0	Lactococcus_phage	73.7	9.0e-44
WP_032950004.1|1012302_1013124_-	helix-turn-helix domain-containing protein	NA	Q9AZQ8	Lactococcus_phage	79.5	4.6e-118
WP_032950005.1|1013409_1014171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155723377.1|1014489_1014657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950007.1|1014765_1015014_+	helix-turn-helix transcriptional regulator	NA	J7KK54	Streptococcus_phage	51.7	2.9e-07
WP_032950008.1|1015024_1015753_+	hypothetical protein	NA	A0A1P8BLQ9	Lactococcus_phage	89.3	3.8e-116
WP_021212446.1|1015765_1016098_+	DUF771 domain-containing protein	NA	Q38331	Lactococcus_phage	100.0	2.4e-57
WP_015966882.1|1016099_1016348_+	hypothetical protein	NA	Q77K30	Lactococcus_phage	100.0	1.7e-36
WP_032950010.1|1016344_1016521_+	putative transcriptional regulator	NA	A0A059NT92	Lactococcus_phage	98.3	2.8e-25
WP_032950012.1|1016623_1017019_+	hypothetical protein	NA	Q6JM08	Lactococcus_phage	97.7	3.0e-67
WP_063280746.1|1017027_1017786_+	hypothetical protein	NA	Q0ILF6	Lactococcus_phage	96.8	1.3e-143
WP_032950018.1|1017778_1018204_+	single-stranded DNA-binding protein	NA	Q9AZV6	Lactococcus_phage	95.0	5.7e-72
WP_063282452.1|1018332_1019082_+	DNA replication protein	NA	A0A1P8BKE9	Lactococcus_phage	83.2	2.1e-114
WP_021165556.1|1019091_1019982_+	ATP-binding protein	NA	R9QM21	Lactococcus_phage	99.3	3.0e-163
WP_081196103.1|1020144_1020534_+	RusA family crossover junction endodeoxyribonuclease	NA	R9QLL1	Lactococcus_phage	97.7	1.7e-67
WP_032950022.1|1020537_1020774_+	DUF1031 family protein	NA	A0A1B1IMV7	Lactococcus_phage	89.9	7.1e-32
WP_014572169.1|1020885_1021065_+	DUF1497 domain-containing protein	NA	Q9AYU3	Lactococcus_phage	98.3	4.6e-23
WP_032950024.1|1021054_1021624_+	DUF658 family protein	NA	Q38104	Lactococcus_phage	95.2	1.3e-87
WP_014572171.1|1021634_1022024_+	hypothetical protein	NA	A0A1P8BKW8	Lactococcus_phage	99.2	2.6e-71
WP_011676933.1|1022020_1022227_+	DUF1125 domain-containing protein	NA	A0A1P8BL00	Lactococcus_phage	100.0	2.4e-31
WP_014572172.1|1022219_1022720_+	DUF1642 domain-containing protein	NA	Q9AYU5	Lactococcus_phage	55.6	1.5e-42
WP_032950026.1|1022716_1023136_+	dUTP diphosphatase	NA	A5GYP0	Lactococcus_phage	97.1	3.1e-70
WP_032950027.1|1023328_1023502_+	DUF1660 domain-containing protein	NA	A0A1P8BLJ5	Lactococcus_phage	96.4	1.7e-27
WP_032950029.1|1023540_1023732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572177.1|1024228_1024651_+	RinA family protein	NA	Q9AZ68	Lactococcus_phage	97.9	4.7e-50
WP_011676523.1|1025078_1025489_+|terminase	terminase	terminase	Q9AZ67	Lactococcus_phage	100.0	1.4e-67
WP_032950031.1|1025481_1026870_+|terminase	phage terminase large subunit	terminase	Q8LTR4	Lactococcus_phage	97.2	7.2e-265
WP_032950051.1|1026906_1028277_+|portal	phage portal protein	portal	Q9AYX0	Lactococcus_phage	99.3	2.2e-237
WP_032950034.1|1028263_1028452_+	hypothetical protein	NA	A0A1P8BM11	Lactococcus_phage	96.8	3.3e-24
WP_032950037.1|1028455_1030150_+|capsid	minor capsid protein	capsid	Q9AZ64	Lactococcus_phage	97.3	0.0e+00
WP_014572181.1|1030164_1030392_+	hypothetical protein	NA	Q9AZ63	Lactococcus_phage	97.3	5.4e-37
WP_032950039.1|1030506_1031169_+	DUF4355 domain-containing protein	NA	B5SP30	Lactococcus_phage	98.6	2.1e-76
WP_032950041.1|1031170_1031989_+|capsid	N4-gp56 family major capsid protein	capsid	Q9AZ61	Lactococcus_phage	98.5	2.9e-141
WP_014570729.1|1031988_1032186_+	hypothetical protein	NA	B5SP32	Lactococcus_phage	100.0	2.8e-29
WP_014572184.1|1032172_1032505_+|head,tail	phage head-tail connector protein	head,tail	B5SP33	Lactococcus_phage	98.2	3.9e-52
WP_032950043.1|1032501_1032813_+	hypothetical protein	NA	A0A1P8BLL1	Lactococcus_phage	98.1	1.3e-54
WP_032950045.1|1032809_1033148_+	HK97 gp10 family phage protein	NA	Q77K21	Lactococcus_phage	97.3	1.6e-53
WP_032950048.1|1033144_1033540_+|capsid	phage capsid protein	capsid	A0A1P8BM84	Lactococcus_phage	96.9	3.7e-65
WP_063280537.1|1033550_1034060_+|tail	phage major tail protein, TP901-1 family	tail	Q77K19	Lactococcus_phage	96.4	1.1e-85
WP_015966829.1|1034175_1034511_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	100.0	1.5e-54
WP_032951117.1|1034606_1034870_+	hypothetical protein	NA	Q9AYV9	Lactococcus_phage	100.0	8.5e-42
WP_032951114.1|1034884_1037698_+|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	96.0	1.4e-291
WP_032951113.1|1037711_1038473_+	hypothetical protein	NA	Q9AYV7	Lactococcus_phage	98.0	2.6e-139
WP_050595610.1|1038472_1041319_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BMB8	Lactococcus_phage	84.9	0.0e+00
WP_133265003.1|1041331_1043458_+|plate	BppU family phage baseplate upper protein	plate	A0A1L2JXK8	Streptococcus_phage	71.0	1.5e-133
WP_032951112.1|1043632_1043884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032951111.1|1044159_1044510_+	hypothetical protein	NA	A0A1P8BKU2	Lactococcus_phage	96.6	1.7e-53
WP_032951110.1|1044522_1044729_+|holin	holin	holin	NA	NA	NA	NA
WP_081196104.1|1044725_1046015_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1B1IMZ6	Lactococcus_phage	98.4	1.0e-241
WP_161940336.1|1046203_1046458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280787.1|1046481_1047519_-	acyltransferase	NA	A0A0S2SXM2	Bacillus_phage	30.4	4.4e-17
WP_153041288.1|1047639_1048751_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_011676403.1|1048864_1049167_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	51.7	6.0e-07
WP_021037426.1|1049448_1050393_+	cation transporter	NA	NA	NA	NA	NA
WP_011676401.1|1050446_1050878_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_011676400.1|1050948_1051869_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	37.7	1.9e-32
WP_011834977.1|1052057_1052654_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032951108.1|1052688_1053981_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	53.5	1.2e-117
WP_011676397.1|1053982_1054171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676396.1|1054183_1054846_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_011676395.1|1054832_1055225_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_011676394.1|1055492_1056548_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	41.5	5.1e-61
WP_011676393.1|1056731_1057439_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676392.1|1057446_1057887_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_032951107.1|1057984_1059538_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	37.3	1.7e-33
WP_011676390.1|1059527_1060238_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	30.1	5.3e-06
WP_031559015.1|1060392_1061328_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011676389.1|1061497_1061833_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_032951106.1|1062447_1063527_-|integrase	site-specific integrase	integrase	A5GYP9	Lactococcus_phage	98.9	2.7e-203
WP_032951105.1|1063711_1064299_-	hypothetical protein	NA	Q9AZW4	Lactococcus_phage	99.0	1.7e-106
WP_032951104.1|1064308_1064797_-	helix-turn-helix domain-containing protein	NA	Q9AZW3	Lactococcus_phage	75.5	1.3e-35
WP_003138385.1|1065200_1066376_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_015966839.1|1067686_1067953_+|holin	phage holin	holin	Q38613	Lactococcus_phage	100.0	4.3e-41
WP_081196105.1|1067949_1069239_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1B1IMU2	Lactococcus_phage	96.5	2.4e-238
WP_081196106.1|1069456_1070071_+|protease	CAAX protease	protease	A0A059NT88	Lactococcus_phage	40.3	4.0e-34
WP_003130410.1|1070030_1070978_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_153041298.1|1071316_1071514_+	hypothetical protein	NA	A0A182BQ75	Lactococcus_phage	57.1	1.3e-10
WP_003132737.1|1072545_1073196_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011676069.1|1073418_1073811_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_014572500.1|1076054_1076195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165209.1|1076312_1076942_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	26.2	8.9e-05
WP_032951099.1|1077094_1078366_+	dihydroorotase	NA	NA	NA	NA	NA
WP_080683454.1|1078667_1079690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280786.1|1081316_1081922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138385.1|1081985_1083161_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032951097.1|1083773_1086359_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_011676080.1|1086623_1087292_+	DnaD domain-containing protein	NA	C5J987	Streptococcus_phage	31.4	1.1e-05
WP_011676081.1|1087313_1087970_+	endonuclease III	NA	NA	NA	NA	NA
WP_015082362.1|1087962_1088652_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_011676083.1|1088648_1089422_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011676084.1|1089456_1089822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165230.1|1089960_1090776_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_021165231.1|1090828_1092172_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.0	1.2e-27
WP_011676087.1|1092344_1092743_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011676088.1|1092735_1093911_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_003130644.1|1094080_1094395_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011676089.1|1094397_1094733_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003130646.1|1094734_1095019_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_015082368.1|1095291_1096824_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_021165232.1|1096897_1097866_+	phosphate starvation-inducible protein PhoH	NA	H6X2N1	Pseudomonas_phage	48.4	2.0e-48
WP_011676092.1|1097935_1098430_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032951096.1|1098520_1099009_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011676094.1|1098992_1099448_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011676095.1|1099464_1100043_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_032951095.1|1100100_1100751_-	ComF family protein	NA	NA	NA	NA	NA
WP_031559015.1|1101302_1102238_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011676097.1|1103177_1103813_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.5	6.6e-56
WP_063280772.1|1103854_1104313_+	glycopeptide antibiotics resistance protein	NA	NA	NA	NA	NA
WP_003130410.1|1104361_1105309_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
1105269:1106337	attR	TCAACTATAAGAGTTCATATGAGATGAGCTTGGCTGGCTAACTTGGACTTGCAATTTGCGAAACAAAAGTTAACATTGTTTTGATAAGTCTCTTTTGTCTCTTGCTAGGATTTGTTTTATTCTTTATTGGTCAGACCTTATTTTGGATTTATTTCCCACAGTATTAAACTCATTGTATCCTCTTAGAAGTATGATAAAATGGTGGTCAAGGCCGTTTTAGAAAAGAGGATTTATGAAAATATTCAGAGGCTCAATTATTGTTAGTTTAATTGCCCTAATCATCGCGTTTATTTATGGCGGATGGAATGGGCTTTTTATTACACTCATTCTTGCCGTGCTAGAAATTTCTTTATCTATGGATAATGCCATTGTTAATGCACGGATTTTAGAGCGAATGAGTCCGGCCTGGCAAAAGACATTCCTGACTTTAGGAGTTTTGATTGCAGTAGTTGGAATGCGTTTGGTTTTCCCTTTGTTGATCGTTGGAGTATCTGCACAAATAGACCCAATTAGTGCTCTAAGATTAGCTTTAGAAAAAGGAAATCCAAGTACAGCAGGAACTTATGGCTATATTTTACATCATGCCCACCCTCAAATTGCAGCCTTTGGTGGAATGTTTCTCCTAATGCTTGCTTTAGGATTTTTCTTTGATGATCGCGCTCACACTTGGTTGAAATTGCCAGAAAAATTCTTGCAAAAAATAGGTCACTTTCCAGCAGCGAATGCGATTATTTCAATCATTATCTTGTTGATTACTTCTGAGTTTATCGCTAAAGATTCCCATGCTGTTTTATTTGCAGGGATACTTGGGATTTTAACTTTTATGCTCGTCGATGGCTTTGGCGAAACGATGAGCCATTCAAAAGCCGCAACCTCTACGCACTTTGTTGTTGCCACGGGTAAAGCAGGGTTGGCACTTTTCTTATATTTGGAAGTTATTGATGCTTCATTTAGTTTTGATGGAGTTATTGGTGCTTTTGCCATAACGGCAGATCCAATTATTATATTATTAGGACTTGGCGTGATTGGGGCCATGTTTGTAAGAAGTCTTACGCTCTATCTAGTTCAA	NA	NA	NA	NA
>prophage 10
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1120822	1246240	2397042	protease,tRNA,transposase	unidentified_phage(19.23%)	101	NA	NA
WP_003130410.1|1120822_1121770_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_031559015.1|1121908_1122844_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_014572528.1|1122993_1123779_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_032951080.1|1123779_1125129_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_011676114.1|1125227_1125893_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_011676115.1|1126165_1127989_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.8	9.8e-20
WP_011676116.1|1128055_1128691_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096824163.1|1130528_1131086_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032951082.1|1131075_1134132_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_081196109.1|1134194_1135085_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032951069.1|1135233_1135620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050595609.1|1135628_1136411_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032951067.1|1136427_1138041_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.8	2.3e-121
WP_032951065.1|1138256_1140746_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	34.6	2.4e-101
WP_011676121.1|1140827_1141913_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_032951064.1|1142035_1142788_+	sortase	NA	NA	NA	NA	NA
WP_081196110.1|1143017_1145771_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_011676124.1|1145757_1146387_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_032951062.1|1146331_1147108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021214375.1|1150079_1150652_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_015082395.1|1150732_1151182_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_011676129.1|1151357_1152866_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	29.8	1.0e-51
WP_081196111.1|1152963_1153854_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676130.1|1154005_1154944_+	phosphotransferase	NA	NA	NA	NA	NA
WP_021212251.1|1156877_1157102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021212250.1|1157186_1157585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676235.1|1157653_1158334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014572551.1|1158472_1158613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280816.1|1158605_1159184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676238.1|1159519_1160233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676239.1|1160372_1161365_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_032951054.1|1161396_1162299_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	36.4	9.8e-13
WP_011676241.1|1162384_1163356_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_014572555.1|1163505_1164567_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_011835285.1|1164559_1165453_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_050595608.1|1165488_1167441_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_011676245.1|1167502_1168354_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676246.1|1168486_1169245_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_014572562.1|1170373_1170961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165274.1|1172584_1173112_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	64.9	9.6e-61
WP_011676249.1|1173301_1174441_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_021037184.1|1174486_1175302_+	glycoside hydrolase GH25 family	NA	NA	NA	NA	NA
WP_032951053.1|1175404_1175845_+	dCMP deaminase family protein	NA	A7KUY9	Bacillus_phage	46.0	1.6e-24
WP_011676253.1|1175946_1176675_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_015082408.1|1176726_1177500_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_011676255.1|1177640_1178258_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_011676256.1|1178520_1179510_+	GMP reductase	NA	G3MBI2	Bacillus_virus	74.4	3.0e-140
WP_032951051.1|1179682_1180633_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_063280817.1|1180709_1182140_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_015082412.1|1184023_1184641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138385.1|1184840_1186016_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014572576.1|1186323_1186917_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014572577.1|1186974_1188279_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.9	6.5e-34
WP_014572578.1|1188314_1188725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196113.1|1188898_1189789_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676268.1|1189885_1190395_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_031559015.1|1190839_1191775_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_011835213.1|1191901_1192408_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	29.8	2.2e-09
WP_011676271.1|1192656_1193892_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	2.4e-134
WP_011676272.1|1193888_1194476_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_032951044.1|1194529_1194880_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_032951043.1|1194959_1196009_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	45.1	8.7e-37
WP_032951041.1|1196005_1197079_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_014572580.1|1197081_1197582_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011676277.1|1197597_1198881_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_032951040.1|1199828_1201115_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011676280.1|1201119_1202010_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161631177.1|1202193_1202862_+	niacin ECF transporter S component NiaX	NA	NA	NA	NA	NA
WP_032951038.1|1202904_1203804_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_032951037.1|1204263_1205544_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	38.9	2.1e-32
WP_032951035.1|1205540_1206329_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021212202.1|1206330_1207131_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032951034.1|1207178_1208246_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032951033.1|1209454_1210651_-	MFS transporter	NA	NA	NA	NA	NA
WP_003138385.1|1210908_1212084_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_031559015.1|1212325_1213261_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_021037230.1|1213367_1213613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196114.1|1213760_1214651_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280857.1|1215069_1217415_+	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_153041289.1|1217451_1218562_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.7e-49
WP_014572649.1|1218902_1219607_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_021165388.1|1219744_1220566_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676170.1|1220628_1221999_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	56.0	3.8e-141
WP_021165386.1|1222043_1223651_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011676167.1|1224337_1225510_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_032950056.1|1225537_1226794_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_032950057.1|1226948_1228613_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_032950058.1|1228719_1229865_-	MFS transporter	NA	NA	NA	NA	NA
WP_014572641.1|1229972_1230371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081196115.1|1230686_1231577_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280603.1|1232157_1232490_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	44.0	4.5e-08
WP_081196116.1|1232667_1233843_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	1.9e-32
WP_063280698.1|1234015_1236019_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	2.4e-80
WP_081196117.1|1237103_1237784_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.2	1.4e-109
WP_032950066.1|1239158_1240466_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011676150.1|1240466_1241075_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_032950068.1|1241902_1242511_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011676147.1|1242510_1243251_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_061777892.1|1243219_1243999_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_032950069.1|1243995_1244634_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_031559015.1|1245304_1246240_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
>prophage 11
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1267448	1337198	2397042	protease,tRNA,transposase	Staphylococcus_phage(25.0%)	55	NA	NA
WP_032950090.1|1267448_1268795_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014572599.1|1268844_1269915_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_021165347.1|1270541_1271249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572597.1|1271427_1271574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|1271705_1272641_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032950096.1|1275495_1275828_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011676291.1|1275990_1277058_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.5	1.2e-54
WP_003138385.1|1277403_1278579_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_153041290.1|1278781_1279892_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_032950105.1|1280309_1281167_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_032950106.1|1281156_1283430_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014572659.1|1283589_1284243_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_081196118.1|1284335_1287068_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	3.3e-43
WP_011676183.1|1287542_1288829_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011676184.1|1288818_1289058_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_032950108.1|1289093_1290317_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	2.4e-22
WP_015082475.1|1290316_1291816_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	30.0	1.8e-40
WP_021212171.1|1291840_1291972_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_031559015.1|1292199_1293135_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_015082476.1|1293225_1293882_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011676188.1|1293874_1294675_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_021212172.1|1294687_1295440_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_081196119.1|1296779_1297670_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675620.1|1299639_1300530_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_050595591.1|1300818_1302378_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_031286422.1|1302383_1302761_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032950119.1|1303210_1303576_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011676195.1|1303645_1304161_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_011676196.1|1304414_1304840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676197.1|1305087_1305276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950121.1|1305289_1306048_-	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	26.2	3.7e-05
WP_032950124.1|1306166_1307951_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.3e-45
WP_032950127.1|1307934_1309752_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.4	1.1e-44
WP_003138385.1|1309900_1311076_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950131.1|1311210_1312461_-|protease	trypsin-like serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	26.8	1.6e-05
WP_014572677.1|1312474_1313065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196120.1|1313730_1314906_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.9	5.5e-32
WP_011835093.1|1315338_1315959_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_011676202.1|1316308_1317028_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011676203.1|1317014_1317581_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.4	9.5e-14
WP_011676204.1|1317573_1318302_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.5	4.5e-08
WP_014572682.1|1318332_1319049_-	site-specific tyrosine recombinase XerD	NA	NA	NA	NA	NA
WP_011676206.1|1319026_1319488_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011676207.1|1319518_1320022_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014572683.1|1320060_1320666_-	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_011676209.1|1320666_1321482_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003130191.1|1321657_1321897_-	YneF family protein	NA	NA	NA	NA	NA
WP_032950140.1|1322047_1323307_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014572686.1|1323421_1324861_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_032950142.1|1324860_1329330_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_021165321.1|1329498_1330110_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011676214.1|1330142_1331165_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_021165320.1|1331324_1332080_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_032950144.1|1335119_1336010_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081196121.1|1336487_1337198_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1341349	1415013	2397042	transposase	Bacillus_phage(27.27%)	59	NA	NA
WP_003138385.1|1341349_1342525_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950154.1|1342670_1345811_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_032950156.1|1345813_1346986_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_011676318.1|1347131_1348070_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011676319.1|1348267_1348642_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_081196122.1|1348840_1349731_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003130410.1|1349837_1350785_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_153041291.1|1351565_1352676_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_063280718.1|1352687_1355504_-	LPXTG cell wall anchor domain-containing protein	NA	Q9MCC0	Lactococcus_phage	48.2	6.6e-07
WP_011676322.1|1355836_1356280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165422.1|1356584_1358207_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	32.1	7.2e-06
WP_021165423.1|1358248_1359064_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014572714.1|1359245_1360766_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	4.8e-20
WP_014572715.1|1360758_1361853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011676327.1|1361849_1362803_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_161631171.1|1362918_1363899_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_021165427.1|1364013_1365522_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_032950160.1|1365609_1366632_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_032950161.1|1367019_1368168_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011676330.1|1368338_1369517_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.8	1.5e-37
WP_011835023.1|1369658_1370285_-	XpaC-like protein	NA	NA	NA	NA	NA
WP_011835022.1|1370475_1371504_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_021165431.1|1371545_1372487_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.9	1.4e-78
WP_063280719.1|1372557_1372965_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_032950163.1|1372961_1373492_+	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_021165432.1|1373482_1374442_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_014572720.1|1374438_1375155_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_021165433.1|1375163_1375622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676339.1|1375623_1376337_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_015082533.1|1376466_1377402_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014572723.1|1377632_1378421_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_032950165.1|1378670_1380035_-	MFS transporter	NA	NA	NA	NA	NA
WP_032950167.1|1380231_1380948_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153041292.1|1381699_1382809_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.7e-49
WP_032950174.1|1383681_1384422_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011676346.1|1384422_1384968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676347.1|1384964_1385801_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011676348.1|1385800_1386754_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_032950176.1|1386791_1388111_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011676350.1|1388223_1389153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196124.1|1389253_1390192_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_032950194.1|1390358_1391570_+	virion core protein	NA	NA	NA	NA	NA
WP_032950178.1|1391778_1392930_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011676353.1|1392926_1393712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676354.1|1393746_1394280_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_014572735.1|1394579_1396097_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_014572736.1|1396149_1397727_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_011676357.1|1397745_1398474_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	32.6	6.9e-33
WP_011676358.1|1398531_1398738_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_032950184.1|1398734_1399694_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_014572741.1|1399772_1400585_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_011676366.1|1402420_1403002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572744.1|1403200_1406395_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011676368.1|1406744_1407218_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_032950186.1|1408116_1410750_-	calcium-translocating P-type ATPase, PMCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.8	7.6e-90
WP_014572748.1|1411007_1411730_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_032950188.1|1411952_1412381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063280541.1|1413619_1414057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196125.1|1414122_1415013_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1535027	1608630	2397042	bacteriocin,transposase	Staphylococcus_phage(33.33%)	60	NA	NA
WP_031559015.1|1535027_1535963_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032949753.1|1536206_1537559_+	aspartate kinase	NA	NA	NA	NA	NA
WP_011675710.1|1537595_1539107_-	flotillin family protein	NA	NA	NA	NA	NA
WP_031559015.1|1539259_1540195_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032949752.1|1540242_1540587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675708.1|1540673_1542062_-	Cof-type HAD-IIB family hydrolase	NA	A0A0N9SIY2	Staphylococcus_phage	41.8	5.3e-26
WP_032949751.1|1542256_1543225_+	asparaginase	NA	NA	NA	NA	NA
WP_032949750.1|1543265_1543658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675705.1|1543671_1544595_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_021166147.1|1544689_1545970_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011835598.1|1545976_1546558_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032949748.1|1546823_1547963_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_081196129.1|1548004_1549669_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_014572947.1|1549658_1550474_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_011675699.1|1550862_1551705_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_032949742.1|1551862_1553218_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.6	2.7e-59
WP_011675697.1|1553214_1554327_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_011675695.1|1554712_1555123_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_031298996.1|1555130_1556138_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_050574209.1|1558445_1559087_-	YesL family protein	NA	NA	NA	NA	NA
WP_032949740.1|1559164_1560727_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_081196130.1|1561469_1562360_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_050595584.1|1562710_1563661_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_032950572.1|1564645_1565620_-	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081196131.1|1566577_1568056_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	5.9e-15
WP_011834764.1|1568074_1568473_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032950566.1|1569408_1570392_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676545.1|1570526_1571822_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.8	2.0e-19
WP_011676546.1|1572036_1572726_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	46.2	1.9e-48
WP_011676547.1|1572998_1573202_-	DUF2969 family protein	NA	NA	NA	NA	NA
WP_032950564.1|1573443_1573758_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.2	4.3e-16
WP_032950563.1|1573854_1576185_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	55.4	1.2e-14
WP_011676550.1|1576228_1576789_-	CvpA family protein	NA	NA	NA	NA	NA
WP_011676551.1|1577097_1578063_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A249XZT7	Enterococcus_phage	27.9	1.7e-18
WP_032950561.1|1578196_1579195_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_032950559.1|1579408_1580497_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011676555.1|1580600_1582610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165574.1|1582791_1583946_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_011676557.1|1584581_1584968_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_011676558.1|1585021_1586026_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011676559.1|1586027_1586606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165576.1|1586602_1588870_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	1.6e-80
WP_032950557.1|1589061_1589847_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011676562.1|1589886_1590279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082685.1|1590416_1591397_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_011676564.1|1591612_1592233_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.9	5.3e-34
WP_011676565.1|1592529_1593510_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_021165578.1|1593775_1594375_-	transglycosylase	NA	E0YIP1	Lactococcus_phage	53.9	3.9e-26
WP_014572273.1|1595045_1596005_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_011676568.1|1596029_1597568_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_014572271.1|1597735_1597969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950547.1|1598340_1598655_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014572269.1|1598672_1598861_-|bacteriocin	lactococcin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011676573.1|1599187_1600021_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011676574.1|1600057_1600798_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_081196132.1|1600896_1603362_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_061777731.1|1603622_1605056_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_011676678.1|1605174_1605447_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.1	1.5e-17
WP_032950539.1|1605567_1607310_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003138385.1|1607454_1608630_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
>prophage 14
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1779346	1877343	2397042	capsid,protease,transposase,head,tRNA,holin,terminase,portal	Lactococcus_phage(44.44%)	94	NA	NA
WP_011675620.1|1779346_1780237_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082786.1|1780928_1781615_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_021165694.1|1781784_1783662_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_011676860.1|1784045_1784609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835756.1|1784741_1785110_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_011676862.1|1785224_1785626_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_021211905.1|1785618_1786965_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	30.7	1.0e-50
WP_021165696.1|1786977_1787571_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_021165697.1|1787584_1788184_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_032950401.1|1788289_1789060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676867.1|1789328_1791638_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021165699.1|1791918_1793064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|1793332_1794268_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032950399.1|1794503_1795469_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	32.5	4.0e-36
WP_011676870.1|1795573_1796005_-	universal stress protein	NA	NA	NA	NA	NA
WP_032950393.1|1796304_1797429_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	28.4	2.7e-28
WP_014572106.1|1797454_1797799_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003132374.1|1797887_1799075_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.4	2.0e-34
WP_021165701.1|1799318_1799501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011835767.1|1799559_1799676_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_032950391.1|1799735_1802534_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.1	2.5e-83
WP_021165703.1|1802983_1803919_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_011676876.1|1803975_1804767_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_011676877.1|1804763_1805039_-	YggT family protein	NA	NA	NA	NA	NA
WP_014572100.1|1805038_1805629_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_021165705.1|1805662_1806340_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_021213780.1|1806343_1807597_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_032950387.1|1807626_1808997_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_032950385.1|1809158_1810028_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.8	4.2e-13
WP_014572097.1|1810144_1810873_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	A0A2D1A6G0	Rhodococcus_phage	27.7	4.6e-05
WP_081196172.1|1811065_1811956_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572095.1|1812032_1813145_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_032950380.1|1813282_1814128_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	33.7	2.3e-32
WP_032950378.1|1814139_1815465_-	MFS transporter	NA	NA	NA	NA	NA
WP_032950376.1|1816957_1818268_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	31.5	4.4e-62
WP_050595596.1|1818438_1819071_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014572089.1|1819088_1819592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676892.1|1819728_1820409_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_011676893.1|1820436_1820715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835788.1|1820707_1821292_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032950374.1|1821393_1822770_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	35.7	5.5e-31
WP_032950372.1|1822987_1823779_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.2	1.4e-31
WP_010906184.1|1823862_1824132_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_032950368.1|1824302_1826180_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	32.4	9.8e-23
WP_011676898.1|1826179_1826956_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_011676899.1|1827078_1828353_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_031286545.1|1828856_1829795_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	50.6	7.9e-82
WP_003138385.1|1831424_1832600_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_014571872.1|1832815_1833385_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161940335.1|1833471_1833696_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.6	1.4e-05
WP_081196084.1|1833768_1834659_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196140.1|1834718_1835207_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.5	1.6e-33
WP_032950357.1|1835280_1836348_-|holin	phage holin	holin	A0A1P8BKR7	Lactococcus_phage	97.3	3.3e-124
WP_032950355.1|1836360_1836588_-|holin	holin	holin	Q9AZR4	Lactococcus_phage	95.8	2.6e-31
WP_021212325.1|1836600_1836837_-	hypothetical protein	NA	A0A1P8BKU6	Lactococcus_phage	93.6	4.2e-32
WP_080683436.1|1839009_1841208_-	tape measure protein	NA	Q9AZL5	Lactococcus_phage	92.7	4.4e-285
WP_021166226.1|1841189_1841360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166227.1|1841377_1841722_-	hypothetical protein	NA	Q9AZL6	Lactococcus_phage	98.2	1.6e-27
WP_032950354.1|1841781_1842387_-	small major structural protein	NA	Q9AZL7	Lactococcus_phage	93.5	9.9e-102
WP_010905383.1|1842388_1842784_-	DUF806 family protein	NA	Q9AZL8	Lactococcus_phage	100.0	1.4e-67
WP_032950353.1|1842780_1843266_-	HK97 gp10 family phage protein	NA	Q9AZL9	Lactococcus_phage	98.1	4.8e-83
WP_021166229.1|1843262_1843598_-|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	94.6	1.4e-52
WP_021166230.1|1843584_1843890_-	hypothetical protein	NA	Q9AZM1	Lactococcus_phage	97.0	2.9e-49
WP_032950352.1|1843900_1845214_-|capsid	phage major capsid protein	capsid	Q9AZM2	Lactococcus_phage	88.3	4.1e-185
WP_032950351.1|1845203_1845791_-|head,protease	HK97 family phage prohead protease	head,protease	Q9AZM3	Lactococcus_phage	99.5	1.7e-106
WP_050595595.1|1845790_1846870_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	97.8	6.7e-194
WP_032950350.1|1847039_1848854_-|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	98.5	0.0e+00
WP_014573149.1|1848853_1849306_-|terminase	phage terminase small subunit P27 family	terminase	Q9AZM7	Lactococcus_phage	99.3	6.5e-82
WP_014573151.1|1850148_1850571_-	DUF722 domain-containing protein	NA	Q9AYX5	Lactococcus_phage	100.0	5.5e-75
WP_153041295.1|1850650_1851762_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_063280716.1|1851782_1851965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950879.1|1851961_1852450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675518.1|1852452_1852851_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_032950880.1|1852831_1853689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675516.1|1853900_1855508_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	44.9	1.6e-130
WP_011675514.1|1856920_1857463_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_050595603.1|1857443_1857944_-	thiamine transporter	NA	NA	NA	NA	NA
WP_032950882.1|1857983_1858772_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_011675511.1|1858805_1859567_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_032950883.1|1859967_1861347_-	LCP family protein	NA	NA	NA	NA	NA
WP_032950885.1|1861451_1861970_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011675508.1|1861966_1862413_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011675507.1|1862571_1863270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165922.1|1863381_1864149_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021165921.1|1864206_1864872_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	29.2	4.7e-12
WP_032950887.1|1865024_1867334_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_032950889.1|1867400_1868966_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_081196142.1|1869113_1870004_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081196143.1|1870128_1870506_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014572071.1|1872232_1872949_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_021165919.1|1873022_1874381_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_021212832.1|1874425_1875385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675498.1|1875374_1876253_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_081196113.1|1876452_1877343_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	1903407	1960117	2397042	tRNA,transposase	unidentified_phage(18.18%)	53	NA	NA
WP_003130410.1|1903407_1904355_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_014572053.1|1904584_1905517_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_015082048.1|1905647_1906148_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675476.1|1906279_1907209_+	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	6.3e-23
WP_014572051.1|1907221_1908031_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032950911.1|1908105_1908297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|1908357_1909293_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032950912.1|1909450_1910326_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.1	2.7e-100
WP_011675472.1|1910325_1910652_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_011834464.1|1910644_1911427_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_011675470.1|1911476_1912337_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_015082045.1|1912468_1913104_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	1.6e-73
WP_003131580.1|1913281_1913983_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_011675468.1|1913975_1915403_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_011675466.1|1915592_1916405_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_032950921.1|1916456_1918085_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.6	4.9e-156
WP_011675464.1|1918171_1918456_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_021165898.1|1918574_1918964_-	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	47.4	2.0e-23
WP_032950924.1|1919054_1920395_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675461.1|1920556_1921183_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_011675460.1|1921288_1921606_-	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_011675459.1|1921650_1921935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165896.1|1922037_1923105_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_021165895.1|1923143_1925582_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011675456.1|1925726_1926986_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	42.9	1.6e-77
WP_032950928.1|1927110_1927581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021165893.1|1927670_1929713_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_011675453.1|1929768_1930203_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011675452.1|1930300_1930906_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_032950930.1|1932684_1933905_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032950931.1|1934261_1935236_-	TDT family transporter	NA	NA	NA	NA	NA
WP_081196146.1|1935397_1936288_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063282446.1|1936397_1937240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031559015.1|1937236_1938172_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_003138385.1|1938535_1939711_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950938.1|1939929_1940874_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_050595604.1|1941091_1942132_-	YeiH family protein	NA	NA	NA	NA	NA
WP_003130410.1|1942255_1943203_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
WP_050574203.1|1944377_1945832_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.6	3.0e-88
WP_021165888.1|1947320_1948298_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011675441.1|1948294_1949098_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.8	8.1e-43
WP_003138385.1|1949229_1950405_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
WP_032950945.1|1950578_1952012_-	amino acid permease	NA	NA	NA	NA	NA
WP_011675439.1|1952321_1953155_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_015082027.1|1953198_1954080_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_011675422.1|1954079_1954892_-	NAD kinase	NA	NA	NA	NA	NA
WP_021165882.1|1954878_1955538_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	29.1	1.0e-06
WP_032950948.1|1955726_1956533_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_011834433.1|1956752_1957346_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014572025.1|1957409_1957928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011834431.1|1958152_1958476_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
WP_011675416.1|1958450_1958831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003138385.1|1958941_1960117_-|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
>prophage 16
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	2191857	2255584	2397042	protease,tRNA,transposase	uncultured_Mediterranean_phage(33.33%)	51	NA	NA
WP_011675227.1|2191857_2192550_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_021036584.1|2192539_2193073_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011675226.1|2193191_2193389_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	83.1	3.5e-24
WP_011675225.1|2193569_2194910_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_032950734.1|2194975_2196475_-	amidase	NA	NA	NA	NA	NA
WP_011675223.1|2196598_2198032_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_014571887.1|2198056_2199517_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011675221.1|2199516_2199822_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011834262.1|2200099_2200888_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_011675219.1|2201040_2202255_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_032950732.1|2202384_2203965_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_011675217.1|2204162_2204402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032950730.1|2204413_2204623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014571883.1|2204791_2205577_-	DNAse	NA	NA	NA	NA	NA
WP_011675214.1|2205713_2206151_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_021166017.1|2207565_2208255_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_011675211.1|2208454_2209603_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.9	1.4e-85
WP_011675210.1|2209891_2210206_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SC02	Streptococcus_phage	40.0	2.8e-07
WP_081196155.1|2210317_2213059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196174.1|2213165_2213810_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_011675205.1|2213924_2214245_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_011675204.1|2214259_2215390_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_011675203.1|2215547_2215691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031559015.1|2216814_2217750_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_081196156.1|2217753_2217927_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_021164969.1|2217944_2218424_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_021164968.1|2218799_2220023_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	25.8	2.4e-06
WP_032951305.1|2220144_2221143_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_014573350.1|2221280_2222621_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011677198.1|2222728_2222953_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_021164965.1|2223096_2224101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021164964.1|2224157_2224910_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_021164963.1|2225117_2227751_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.3	2.2e-57
WP_031559015.1|2227843_2228779_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032951307.1|2229896_2230502_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015082943.1|2236196_2236688_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011677205.1|2236951_2238682_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_011677206.1|2238886_2239915_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_032951471.1|2240036_2240804_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_032951472.1|2241198_2242224_+	lactonase family protein	NA	NA	NA	NA	NA
WP_032951473.1|2242478_2245190_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032951474.1|2245653_2246151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677212.1|2246137_2246347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196119.1|2246633_2247524_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573366.1|2247630_2248950_-	KxxxW cyclic peptide radical SAM maturase	NA	NA	NA	NA	NA
WP_011836076.1|2249017_2249131_-	KxxxW-cyclized peptide pheromone	NA	NA	NA	NA	NA
WP_011677213.1|2249448_2250480_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011677214.1|2250463_2250964_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.1	2.0e-15
WP_031286167.1|2251011_2251551_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011677216.1|2251721_2252942_-	MFS transporter	NA	NA	NA	NA	NA
WP_003138385.1|2254408_2255584_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
>prophage 17
NZ_CP015899	Lactococcus lactis subsp. cremoris strain JM1 chromosome, complete genome	2397042	2322764	2378870	2397042	protease,tRNA,integrase,transposase	Lactococcus_phage(12.5%)	45	2364740:2364757	2380637:2380654
WP_081196084.1|2322764_2323655_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032951377.1|2323778_2324648_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_014573430.1|2324939_2325380_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011677274.1|2325404_2326079_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011836134.1|2326162_2326846_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_021212104.1|2326947_2328153_-	MFS transporter	NA	NA	NA	NA	NA
WP_011677277.1|2328215_2328653_-	universal stress protein	NA	NA	NA	NA	NA
WP_011677278.1|2328672_2328876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080683465.1|2329101_2333412_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_014573433.1|2333822_2334437_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021164812.1|2334520_2335249_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014573435.1|2335479_2336115_-	hypothetical protein	NA	A0A1W6JNE9	Lactococcus_phage	53.3	5.2e-61
WP_021164811.1|2336413_2337781_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_081196084.1|2338428_2339319_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_063280661.1|2340029_2341874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951371.1|2342107_2342947_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032951370.1|2343025_2343763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021213390.1|2343762_2345763_-	ATP-dependent DNA helicase RecG	NA	B2CRJ8	Acidianus_filamentous_virus	23.7	2.1e-07
WP_015082981.1|2345901_2346246_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011677291.1|2346313_2347324_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032951369.1|2347600_2348113_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_032951368.1|2348250_2350944_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.6	2.8e-71
WP_032951367.1|2350985_2351513_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011677295.1|2351637_2352657_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031559015.1|2353081_2354017_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.5	3.5e-37
WP_032951365.1|2354204_2354738_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032951364.1|2354761_2355217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196158.1|2361621_2362719_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_063280665.1|2362715_2363615_-	adenine-specific DNA-methyltransferase	NA	S0A0D5	Cellulophaga_phage	33.2	1.9e-24
WP_081196159.1|2363741_2364938_-	ATP-binding protein	NA	NA	NA	NA	NA
2364740:2364757	attL	GCGGATAAAATTCAAAAT	NA	NA	NA	NA
WP_063280664.1|2365049_2366276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677303.1|2366445_2366727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280663.1|2366749_2367091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021213934.1|2367341_2368436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011677306.1|2368713_2370204_+	ATPase AAA	NA	NA	NA	NA	NA
WP_011677307.1|2370437_2370629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011677308.1|2370720_2371770_+|integrase	site-specific integrase	integrase	O34032	Streptococcus_phage	26.9	1.3e-19
WP_004254378.1|2371832_2372225_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_010906417.1|2372244_2372691_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014573446.1|2373089_2374160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011677310.1|2374175_2374847_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.5e-34
WP_032951517.1|2374993_2375872_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_032951516.1|2375883_2376510_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011677314.1|2376557_2377373_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003138385.1|2377694_2378870_+|transposase	IS256-like element IS905 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.3	2.5e-32
2380637:2380654	attR	ATTTTGAATTTTATCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP016746	Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence	193245	82008	86097	193245		Lactococcus_phage(85.71%)	11	NA	NA
WP_063280735.1|82008_82680_+	N-6 DNA methylase	NA	L0P368	Streptococcus_phage	45.8	5.7e-50
WP_063280734.1|82715_82952_+	hypothetical protein	NA	A0A1P8BLV4	Lactococcus_phage	48.2	1.7e-09
WP_063280733.1|83016_83352_+	hypothetical protein	NA	Q8LTM4	Lactococcus_phage	53.4	2.0e-24
WP_063280732.1|83348_83543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280731.1|83539_83935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280730.1|84007_84427_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	72.7	6.5e-52
WP_155724498.1|84447_84606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280729.1|84617_85016_+	hypothetical protein	NA	A0A1P8BM10	Lactococcus_phage	63.4	1.1e-19
WP_063280728.1|85041_85305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063280727.1|85325_85823_+	hypothetical protein	NA	A0A1W6JJX6	Lactococcus_phage	46.0	2.6e-07
WP_153041305.1|85854_86097_+	hypothetical protein	NA	A0A1W6JIL6	Lactococcus_phage	42.0	3.0e-09
>prophage 2
NZ_CP016746	Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence	193245	147580	186657	193245	transposase,integrase	Streptococcus_phage(38.46%)	28	147508:147567	178555:179362
147508:147567	attL	GGTTCTGTTGCAAAGTTTTCTGATAAGTCTATTTTAGTGTAAAATGAATAAAAATGACAG	NA	NA	NA	NA
WP_010890648.1|147580_148261_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_042748179.1|148442_150491_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	36.7	5.0e-65
WP_063280706.1|150492_151230_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_011834934.1|151966_152647_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	7.6e-127
WP_021212881.1|152909_153080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021215689.1|153594_153855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080683478.1|154011_154593_+	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	35.0	9.4e-25
WP_080683477.1|154609_154930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196202.1|155058_161121_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011669080.1|161440_162340_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_081196203.1|162489_163170_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.9	1.7e-105
WP_081196204.1|163835_165638_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	24.2	2.3e-13
WP_021722469.1|165659_167171_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	30.3	9.5e-53
WP_081196205.1|167115_167667_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	37.1	1.7e-23
WP_153041310.1|167596_168265_-	type I restriction endonuclease	NA	E3T4D5	Cafeteria_roenbergensis_virus	35.5	2.0e-10
WP_081196211.1|168370_169363_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	7.7e-35
WP_081196206.1|169375_170551_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_081196207.1|170591_172088_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_081196208.1|172120_175138_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.7e-67
WP_081196209.1|175197_175464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031286803.1|176177_177983_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_010890648.1|178627_179308_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_063280543.1|179583_180696_+	hypothetical protein	NA	NA	NA	NA	NA
178555:179362	attR	GGTTCTGTTGCAAAGTTTTCTGATAAGTCTATTTTAGTGTAAAATGAATAAAAATGACAGCGAGGATATATCAATGAACTATTTTAAAGGTAAACAATTTCAAAAAGATGTGATTATTGTCGCTGTTGGTTATTATCTACGTTACAATCTAAGCTATCGTGAAATTCAAGAACTCCTTTATGATCGTGGGATTAACGTTTGTCACACAACTATTTATCGTTGGGTACAAGAATACAGTAAAGTCCTCTATCATCTCTGGAAAAAGAAAAATAGACAGTCCTTCTATTCGTGGAAAATGGATGAAACTTATATCAAAATCAAAGGTCGTTGGCATTATCTCTATCGTGCAATTGATGCGGATGGATTGACTTTAGACATCTGGCTACGCAAGAAACGGGATACTCAAGCTGCTTATGCGTTCTTGAAACGACTACATAAACAGTTTGGTCAACCAAGAGTAATTGTCACGGATAAAGCGCCCTCTATTGGTTCTGCATTTAGAAAGTTACAGAGTAACGGTTTATATACTAAGACAGAGCATCGAACCGTGAAGTATCTCAATAACCTCATTGAGCAAGACCATCGACCAATCAAACGACGCAATAAATTTTATCGAAGTCTACGAACTGCCTCAACCACGATTAAGGGCATGGAAACAATTCGAGGAATATACAAAAAGAACCGAAGAAATGGAACGCTCTTCGGATTTTCGGTATCTACTGAGATTAAGGTCTTAATGGGAATATTAGCTTAAGAACAAGAAGGATTATAAACCTTGTATTTGATTTTTAAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_063280544.1|180714_183180_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_063280545.1|183268_183580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152023992.1|183820_184600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155724481.1|184821_184983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153041311.1|185285_186657_+|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	9.2e-55
