The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	20731	83480	2250607	transposase,tRNA,protease,integrase	Bacillus_phage(20.0%)	57	64110:64128	82569:82587
WP_015081823.1|20731_22000_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011675094.1|21980_22532_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	1.4e-09
WP_015081824.1|22737_24828_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	49.2	1.6e-106
WP_041931722.1|25895_27719_+	PTS mannitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_015082454.1|29712_30471_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	99.6	4.5e-136
WP_015081829.1|31918_32350_+	PTS mannitol IIA component	NA	NA	NA	NA	NA
WP_015081830.1|32498_33665_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_021165766.1|33770_33995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675101.1|34083_34353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011675109.1|34477_34720_+	NINE protein	NA	NA	NA	NA	NA
WP_014571770.1|34813_36436_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_011675112.1|36645_37167_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	42.1	1.0e-30
WP_015081831.1|37628_38804_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_015081832.1|38901_39657_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_010905074.1|39808_41227_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	3.0e-40
WP_015081833.1|41445_43032_-	pyruvate dehydrogenase complex E2 component	NA	NA	NA	NA	NA
WP_011834176.1|43024_44005_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011675118.1|44007_45132_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011675119.1|45220_46222_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_015081834.1|46414_47269_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.4	7.8e-12
WP_015081835.1|47347_47998_-	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	33.3	1.2e-15
WP_015081836.1|48047_48374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081837.1|48430_49321_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011834182.1|49473_50499_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015081838.1|50997_51435_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
WP_015081839.1|51596_52910_+	APC family permease	NA	NA	NA	NA	NA
WP_015081840.1|52988_53984_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_015081841.1|54086_54899_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011675129.1|55426_57064_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	25.9	4.8e-50
WP_011675130.1|57564_57819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081842.1|57937_58762_-	KR domain-containing protein	NA	NA	NA	NA	NA
WP_011675132.1|58921_59503_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041931846.1|59690_60173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081844.1|60429_61710_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	26.5	2.5e-09
WP_011675135.1|61962_62796_-	KR domain-containing protein	NA	NA	NA	NA	NA
WP_015081863.1|63144_64035_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
64110:64128	attL	AACTAGCAATTCGGGTATT	NA	NA	NA	NA
WP_015081846.1|64940_66203_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	34.5	1.6e-53
WP_015081847.1|66285_66546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081848.1|66538_67141_-	Plasmid replication protein repB	NA	NA	NA	NA	NA
WP_015081849.1|67291_67900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081850.1|67896_68973_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_015081851.1|68972_69293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081852.1|69442_69874_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015081853.1|69989_71462_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_080600815.1|71458_71809_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015081855.1|71774_72395_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_041931724.1|72412_73582_-	restriction endonuclease subunit M	NA	Q6DMX0	Streptococcus_phage	70.2	1.1e-152
WP_015081857.1|73746_74562_-	type-2 restriction enzyme ScrFI	NA	NA	NA	NA	NA
WP_015081858.1|74580_75663_-	DNA cytosine methyltransferase	NA	A0A0E3DF50	Bacillus_phage	36.3	7.0e-50
WP_041931725.1|75666_76134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003132258.1|76331_76481_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_010905107.1|76510_76684_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_015081860.1|77045_78827_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.6	1.7e-64
WP_015081861.1|79870_80656_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_015081862.1|80710_81970_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	45.3	2.5e-91
WP_011675147.1|82013_82502_-	N-acetyltransferase	NA	A0A1B2ICF0	Erwinia_phage	50.9	1.1e-05
WP_015081863.1|82589_83480_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
82569:82587	attR	AATACCCGAATTGCTAGTT	NA	NA	NA	NA
>prophage 2
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	410607	422764	2250607		uncultured_virus(30.0%)	15	NA	NA
WP_011675460.1|410607_410925_+	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	31.9	9.0e-06
WP_015082041.1|411030_411657_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_015082042.1|411818_413159_+	NADH oxidase (H(2)O-forming)	NA	NA	NA	NA	NA
WP_015082043.1|413249_413639_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	48.6	1.3e-22
WP_011675464.1|413757_414042_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	2.3e-13
WP_011675465.1|414128_415757_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_011675466.1|415808_416621_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	1.5e-33
WP_021165900.1|416589_416799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675468.1|416810_418238_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.9	3.9e-32
WP_003131580.1|418230_418932_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
WP_015082045.1|419109_419745_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.0	1.6e-73
WP_011675470.1|419877_420738_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.8	3.1e-64
WP_015082046.1|420787_421570_+	phosphorelay inhibitor	NA	NA	NA	NA	NA
WP_011675472.1|421562_421889_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_041931741.1|421888_422764_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	66.3	5.4e-101
>prophage 3
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	602210	665092	2250607	transposase,tRNA,protease	Bacillus_phage(18.75%)	49	NA	NA
WP_015082137.1|602210_603101_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041931749.1|603144_603876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675755.1|603907_604183_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_011675756.1|604285_604462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011834603.1|604594_605527_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_015082139.1|605588_606374_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011675759.1|606540_606960_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_015082140.1|606989_607550_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_015082141.1|607683_609102_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	33.0	8.4e-35
WP_041931750.1|609283_611305_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.9	4.2e-64
WP_015082143.1|611519_613535_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	31.6	3.8e-57
WP_080600823.1|613587_613758_-	DUF3042 domain-containing protein	NA	NA	NA	NA	NA
WP_011675765.1|613952_614618_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.8	2.3e-19
WP_011675766.1|614749_615634_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_015082144.1|615779_616448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075070707.1|616618_617515_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	35.2	1.8e-35
WP_080600854.1|617763_618408_-	glycoside hydrolase, family 25	NA	A0A1P8BMN5	Lactococcus_phage	56.9	2.4e-13
WP_015082146.1|618887_619235_-	XRE family transcriptional regulator	NA	A0A182BQC8	Lactococcus_phage	74.6	2.0e-43
WP_015082147.1|619999_620923_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_011675772.1|620915_621617_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015082148.1|621789_624018_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	6.7e-79
WP_011834623.1|624141_624654_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	5.3e-32
WP_015082149.1|624869_625433_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_015082150.1|625568_627209_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014573028.1|627269_627740_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011834627.1|630570_631026_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082152.1|631015_633466_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	2.2e-123
WP_015082153.1|633600_634158_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010905473.1|634345_635647_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
WP_014573010.1|635750_636422_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.2e-29
WP_015082154.1|636423_637497_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014573008.1|637508_638078_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082155.1|638264_639788_-	long-chain acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_080600855.1|640035_640899_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_015082157.1|641158_643522_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	31.8	3.6e-107
WP_011675632.1|643650_644310_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_021036849.1|644312_645530_+	MFS transporter	NA	NA	NA	NA	NA
WP_003129585.1|645526_645673_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_041931753.1|646050_647313_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_014573002.1|647417_650831_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_015082159.1|652278_654825_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_015082160.1|654844_656083_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011834647.1|656122_656722_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	7.1e-52
WP_075070705.1|656940_657447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129597.1|657616_658015_+	arsenate reductase	NA	NA	NA	NA	NA
WP_080513983.1|658396_659365_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015082163.1|662625_662859_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	35.1	2.1e-07
WP_010905103.1|662896_663736_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	9.3e-50
WP_081172393.1|664201_665092_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	788767	914694	2250607	transposase,tRNA,integrase	Bacillus_phage(19.23%)	106	895338:895354	920335:920351
WP_015082226.1|788767_790768_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.3	4.9e-89
WP_011675925.1|791344_791584_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011675926.1|791605_792337_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011675928.1|792742_793252_+	queuosine transporter QueT	NA	E7DN70	Pneumococcus_phage	33.1	2.0e-10
WP_004234939.1|794095_794386_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010905146.1|794481_795243_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.6	5.3e-44
WP_015082229.1|798109_799132_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015082230.1|799143_800331_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_015082231.1|800348_801482_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	3.1e-24
WP_015082232.1|801478_802330_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_081172400.1|802368_803370_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011675937.1|803393_803966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082234.1|804144_804840_+	ribonuclease 3	NA	M4QMG4	Micromonas_pusilla_virus	32.6	3.4e-21
WP_015082235.1|804829_808354_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_041931762.1|808596_810765_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.0e-140
WP_041931763.1|810859_811270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051013164.1|811362_812481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082239.1|812477_813239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931876.1|814156_814966_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011675947.1|814975_815527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082242.1|815588_816983_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.3	1.9e-15
WP_014572881.1|817163_818138_+	ribose-phosphate pyrophosphokinase 1	NA	A0A2K9L2G2	Tupanvirus	36.6	2.2e-42
WP_015082243.1|818261_818933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675950.1|819003_821493_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.1	0.0e+00
WP_015082244.1|822890_824309_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_015082245.1|824420_825734_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011675953.1|825880_826684_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015082247.1|826820_827183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004234939.1|827297_827588_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010905146.1|827683_828445_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.6	5.3e-44
WP_011675781.1|828605_829865_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015082248.1|830005_832012_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081172402.1|832124_832796_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_011675784.1|832815_833679_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_011835521.1|833799_834255_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_011675786.1|834273_834474_+	copper chaperone	NA	NA	NA	NA	NA
WP_011675787.1|834660_836823_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.0	4.3e-99
WP_015082250.1|837024_839676_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675790.1|839746_840532_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_031286465.1|840846_841977_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015082251.1|842230_843457_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_015082252.1|843651_845103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082253.1|845221_845890_+	DNA-binding response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	31.2	5.0e-06
WP_014572868.1|846038_847187_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	5.8e-18
WP_015082254.1|847325_848042_+	uridine phosphorylase	NA	NA	NA	NA	NA
WP_015082255.1|848059_848773_+	nicotinamide mononucleotide transporter	NA	A0A1S6UAV8	Serratia_phage	23.6	5.5e-11
WP_015082256.1|848868_850878_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_015082257.1|850975_852136_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_011675799.1|853111_853447_+	XRE family transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	48.4	7.8e-08
WP_015082259.1|853557_855927_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_051013166.1|856971_857526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082260.1|857598_858489_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
WP_021212525.1|858554_858992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931764.1|859075_859336_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	40.0	6.5e-10
WP_041931765.1|859349_860177_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.7e-49
WP_015082262.1|860228_861053_-	putative glycosyltransferase	NA	NA	NA	NA	NA
WP_015082263.1|861358_862777_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_011675803.1|862905_863265_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011675804.1|863308_864412_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	6.3e-30
WP_011675805.1|864572_865001_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_015082264.1|865139_866447_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011675807.1|866575_867493_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	9.0e-22
WP_015082265.1|867489_868992_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_015082266.1|869253_871788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081213176.1|871774_872314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931766.1|872323_872701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082268.1|872716_873295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082269.1|873276_874167_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675815.1|876556_877444_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.0	2.1e-39
WP_031286477.1|877614_878868_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.3	1.2e-45
WP_011675817.1|878870_879110_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
WP_015082270.1|879336_880227_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675819.1|880285_881431_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	4.5e-47
WP_015082271.1|881655_882513_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_015082272.1|882513_883014_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014572851.1|883089_883896_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011675823.1|883892_884339_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015082273.1|884518_886186_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015082274.1|886885_887452_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_011835491.1|887546_888068_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_011835489.1|889246_890200_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
WP_015082275.1|890355_890736_+	Cell division protein FtsL, DivIC superfamily	NA	NA	NA	NA	NA
WP_015082276.1|890732_893030_+	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_015082277.1|893104_894094_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_011675833.1|894292_894577_+	hypothetical protein	NA	NA	NA	NA	NA
895338:895354	attL	ATGTTGTCATTGAATCA	NA	NA	NA	NA
WP_011835483.1|896352_897015_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.4e-21
WP_041931767.1|897374_898262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082279.1|898520_899411_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011675837.1|899497_900172_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_011675838.1|900331_900676_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011675840.1|901605_902067_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_081172525.1|902589_902832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082281.1|902824_904153_+	glycosyltransferase family 2 cellulose synthase (CESA) superfamily	NA	NA	NA	NA	NA
WP_011835479.1|904383_904941_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_015082283.1|905003_905249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931768.1|905521_906247_+	nicotinamide mononucleotide transporter	NA	A0A2P0ZKW0	Lactobacillus_phage	28.7	1.1e-14
WP_014572836.1|906799_907225_+	universal stress protein	NA	NA	NA	NA	NA
WP_081213177.1|907392_907755_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_011675849.1|907816_908350_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080600829.1|908508_909021_+	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_015082286.1|909021_909912_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041931770.1|910046_911918_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003131392.1|912106_912439_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_015082287.1|912574_913549_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	28.3	1.9e-30
WP_041931880.1|913736_914075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003137511.1|914433_914694_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
920335:920351	attR	ATGTTGTCATTGAATCA	NA	NA	NA	NA
>prophage 5
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	946144	994952	2250607	transposase	Bacillus_phage(14.29%)	45	NA	NA
WP_015082304.1|946144_946405_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	40.0	6.5e-10
WP_041931775.1|946432_949519_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_015082306.1|949619_950510_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082307.1|950748_951864_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_031286330.1|951957_952794_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011675881.1|952980_954216_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_015082308.1|954273_954543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675883.1|954613_955318_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_011675884.1|956573_957020_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_015082309.1|957103_957430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675886.1|957590_959258_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_041931776.1|959366_959960_+	hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	43.5	2.4e-15
WP_015082310.1|959985_960876_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082311.1|961111_961960_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011675889.1|962228_963116_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011675890.1|963127_963880_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.8e-28
WP_075070694.1|963884_964109_+	DUF4059 domain-containing protein	NA	NA	NA	NA	NA
WP_014572788.1|964306_965233_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	2.0e-85
WP_011675893.1|965373_965622_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_041931884.1|965863_968317_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	44.2	1.3e-104
WP_041168338.1|968335_968923_+	isochorismatase	NA	NA	NA	NA	NA
WP_015082314.1|969000_970017_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_015082315.1|969998_970889_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082316.1|971090_972032_-	prenyltransferase	NA	NA	NA	NA	NA
WP_015081738.1|972146_972827_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	1.2e-108
WP_011675898.1|973001_973265_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011675899.1|973381_974719_+	PFL family protein	NA	NA	NA	NA	NA
WP_015082317.1|974814_975294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675901.1|975364_976060_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011675902.1|976056_976803_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_011675903.1|976817_977222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011675904.1|977382_978426_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572780.1|978455_978995_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015082318.1|979066_980890_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	45.8	3.4e-129
WP_015082319.1|981052_982897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082320.1|983066_984830_+	oleate hydratase	NA	NA	NA	NA	NA
WP_015082321.1|984896_986036_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011675960.1|986157_986859_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_015082322.1|986941_987859_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_015082323.1|987858_989763_+	PTS fructose IIABC component	NA	NA	NA	NA	NA
WP_041931777.1|991311_992637_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_041167445.1|992633_993017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082325.1|993100_993502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051013168.1|993633_993948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082326.1|994061_994952_+|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1011648	1035346	2250607	transposase	Bacillus_phage(18.75%)	23	NA	NA
WP_015082336.1|1011648_1012341_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.3	4.2e-32
WP_015082337.1|1012333_1013269_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011675984.1|1013378_1014356_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	65.7	6.0e-117
WP_081213180.1|1014739_1016908_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	3.3e-256
WP_015082339.1|1017044_1017467_-	protein NrdI	NA	A0A142F1R4	Bacillus_phage	36.4	1.7e-12
WP_011675987.1|1017468_1017687_-	NrdH-redoxin	NA	C3U2K9	Lactococcus_phage	47.6	5.8e-12
WP_011675988.1|1017860_1018502_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_015082340.1|1018780_1020715_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.9	4.1e-125
WP_015082341.1|1020821_1021358_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_015082342.1|1021350_1022184_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	38.7	1.5e-20
WP_041931779.1|1022781_1025256_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.0e-96
WP_010890648.1|1026073_1026754_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	8.5e-110
WP_041931780.1|1026766_1027003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082345.1|1027494_1028583_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.8	8.4e-51
WP_011675996.1|1028582_1029230_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.7	5.5e-42
WP_015082346.1|1029241_1030438_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.3	7.4e-109
WP_014572751.1|1030464_1030929_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.3	1.4e-39
WP_011669038.1|1031110_1031371_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	1.1e-09
WP_081172527.1|1031382_1032222_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	6.0e-49
WP_080600831.1|1032254_1033190_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572493.1|1033255_1033636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676002.1|1033925_1034378_+	signal peptidase II	NA	NA	NA	NA	NA
WP_015082348.1|1034440_1035346_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	3.5e-10
>prophage 7
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1150476	1215660	2250607	transposase,protease	Lactococcus_phage(23.08%)	59	NA	NA
WP_011676271.1|1150476_1151712_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	2.4e-134
WP_015082414.1|1151708_1152296_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011676273.1|1152349_1152700_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011676274.1|1152779_1153829_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	45.1	8.7e-37
WP_015082415.1|1153825_1154899_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_014572580.1|1154901_1155402_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015082416.1|1155417_1156701_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_081172421.1|1156829_1157468_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	5.4e-50
WP_015082417.1|1157647_1158934_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_011676280.1|1158938_1159829_+	homoserine kinase	NA	NA	NA	NA	NA
WP_015082418.1|1160082_1160682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082419.1|1160724_1161624_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_015082420.1|1162083_1163364_+	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	38.4	6.0e-32
WP_081213182.1|1163360_1164149_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021212202.1|1164150_1164951_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015082423.1|1164998_1166066_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041931789.1|1166081_1166267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082424.1|1167274_1168468_-	MFS transporter	NA	NA	NA	NA	NA
WP_015082425.1|1168764_1169946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082426.1|1169978_1171640_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_015082427.1|1172581_1172926_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082428.1|1173154_1173913_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_081172427.1|1174002_1174893_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_021037225.1|1175105_1175420_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082430.1|1176177_1176594_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_011676176.1|1176958_1177369_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082431.1|1177540_1178398_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	30.4	2.4e-29
WP_015082432.1|1178435_1179326_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081172527.1|1179743_1180583_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	6.0e-49
WP_015082433.1|1180594_1180855_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	2.5e-09
WP_015082434.1|1181198_1181903_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_011676170.1|1182924_1184295_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	56.0	3.8e-141
WP_015082435.1|1184339_1185947_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015082436.1|1185948_1186569_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080600858.1|1186742_1187807_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015082438.1|1187834_1189091_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015082439.1|1189245_1190910_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_015082440.1|1191016_1192162_-	MFS transporter	NA	NA	NA	NA	NA
WP_014572641.1|1192269_1192668_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015082441.1|1192984_1193875_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011676161.1|1194455_1194788_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082442.1|1194992_1196996_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	3.2e-80
WP_011676158.1|1197314_1197794_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_021165370.1|1201052_1201277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082445.1|1201388_1202459_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_015082446.1|1202458_1203415_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_081213183.1|1204194_1205502_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_015082448.1|1205502_1206111_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_041931790.1|1206122_1206893_+	aminoglycoside 3'-phosphotransferase	NA	A0A193CJY5	Infectious_laryngotracheitis_virus	26.1	5.6e-09
WP_015082449.1|1206937_1207546_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_015082450.1|1207545_1208286_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_015082451.1|1208254_1209034_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011676145.1|1209030_1209669_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_015082452.1|1209669_1210455_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011835164.1|1210487_1211447_-	rhodanese domain-containing protein	NA	NA	NA	NA	NA
WP_015082453.1|1211869_1213411_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.5	8.9e-06
WP_041931791.1|1213446_1213626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003331414.1|1213666_1214425_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_015082455.1|1214436_1215660_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	6.4e-233
>prophage 8
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1233585	1374573	2250607	transposase,tRNA,lysis	Bacillus_phage(37.5%)	119	NA	NA
WP_014572600.1|1233585_1234932_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_015082466.1|1234981_1236052_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_015082467.1|1236698_1237400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021165346.1|1237578_1237809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082468.1|1238657_1239725_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.9	2.7e-54
WP_004234939.1|1240238_1240529_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080600835.1|1240546_1240888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931793.1|1240923_1241187_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.0	2.7e-08
WP_080600859.1|1241198_1242038_+	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	1.8e-48
WP_015082470.1|1243057_1243915_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_015082471.1|1243904_1246178_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014572659.1|1246337_1246991_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015082472.1|1247083_1249816_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	1.9e-43
WP_015082473.1|1250290_1251577_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_011676184.1|1251566_1251806_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
WP_041931794.1|1251841_1253065_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	2.4e-22
WP_015082475.1|1253064_1254564_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	30.0	1.8e-40
WP_021212171.1|1254588_1254720_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_015082476.1|1254902_1255559_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015082477.1|1255551_1256352_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015082478.1|1256364_1257117_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_015082479.1|1258456_1259347_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081172432.1|1259403_1260144_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.5	4.0e-20
WP_015082481.1|1260654_1261491_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_011676192.1|1261487_1263047_-	MFS transporter	NA	NA	NA	NA	NA
WP_015082163.1|1263185_1263419_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	35.1	2.1e-07
WP_010905103.1|1263456_1264296_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	9.3e-50
WP_015082482.1|1265106_1265472_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011676195.1|1265541_1266057_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_015082483.1|1266310_1266736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676197.1|1266983_1267172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676198.1|1267185_1267944_-	XRE family transcriptional regulator	NA	R9TNM0	Vibrio_phage	26.6	3.7e-05
WP_015082484.1|1268062_1269847_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.5e-44
WP_015082485.1|1269830_1271648_-	multidrug resistance ABC transporter ATP-binding and permease	NA	W8CYL7	Bacillus_phage	27.4	1.1e-44
WP_015082486.1|1271785_1273036_-	glycoside hydrolase family 25	NA	A0A2H4PQN5	Staphylococcus_phage	26.3	2.1e-05
WP_015082487.1|1273049_1273640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082488.1|1273693_1274281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011835093.1|1274591_1275212_-	riboflavin transporter RibU	NA	NA	NA	NA	NA
WP_011676202.1|1275560_1276280_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011676203.1|1276266_1276833_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.4	9.5e-14
WP_015082490.1|1276825_1277554_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.5	4.5e-08
WP_015082491.1|1277584_1278301_-	XerD-like tyrosine recombinase	NA	NA	NA	NA	NA
WP_011676206.1|1278278_1278740_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_015082492.1|1278770_1279274_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014572683.1|1279312_1279918_-	nucleoside-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015082493.1|1279918_1280734_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003130191.1|1280909_1281149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082494.1|1281299_1282559_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014572686.1|1282673_1284113_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_015082495.1|1284112_1288582_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_015082496.1|1288750_1289362_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_015082497.1|1289394_1290417_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011676215.1|1290576_1291332_+	potassium transporter KefA	NA	NA	NA	NA	NA
WP_015082498.1|1292817_1294329_-	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_041931795.1|1294371_1295262_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082500.1|1295740_1296631_-|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
WP_015082501.1|1296864_1297641_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	1.9e-25
WP_015082502.1|1297753_1298602_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_041931796.1|1298831_1299344_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015082454.1|1299419_1300178_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	99.6	4.5e-136
WP_015082455.1|1300189_1301413_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	6.4e-233
WP_080506533.1|1301644_1301725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931797.1|1301706_1302528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082504.1|1302873_1303635_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_015082505.1|1303627_1305013_+	PepP/PepQ-like peptidase M24 family	NA	NA	NA	NA	NA
WP_015082506.1|1305081_1306809_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015082507.1|1308984_1309608_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015082508.1|1309623_1310757_-	endoglucanase	NA	NA	NA	NA	NA
WP_011676308.1|1310758_1311613_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015082509.1|1312705_1314013_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015082511.1|1314744_1315635_-|transposase	IS982-like element IS982B family transposase	transposase	NA	NA	NA	NA
WP_015082512.1|1315836_1316784_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081172436.1|1316783_1317623_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015082515.1|1319123_1319354_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_081172438.1|1319605_1322746_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_015082517.1|1322748_1323921_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_011676318.1|1324066_1325005_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_015082518.1|1325202_1325577_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_081213184.1|1326217_1327108_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_041931798.1|1330467_1330911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676323.1|1331215_1332838_+	DUF814 domain-containing protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	32.1	5.5e-06
WP_015082522.1|1332879_1333695_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015082523.1|1333876_1335397_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.4e-19
WP_015082524.1|1335389_1336484_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011676327.1|1336480_1337434_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015082525.1|1337550_1338528_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_015082526.1|1338645_1340154_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003131080.1|1340241_1341264_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011676329.1|1341651_1342800_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_015082527.1|1342970_1344149_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.8	1.5e-37
WP_015082528.1|1344290_1344917_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_015082529.1|1345107_1346136_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_015082530.1|1346177_1347119_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	52.2	2.8e-79
WP_041931799.1|1347189_1347597_+	transporter	NA	NA	NA	NA	NA
WP_011676335.1|1347593_1348124_+	heptaprenyl diphosphate synthase subunit I	NA	NA	NA	NA	NA
WP_015082532.1|1348114_1349074_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_014572720.1|1349070_1349787_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014572721.1|1349795_1350254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676339.1|1350255_1350969_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_015082533.1|1351098_1352034_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_014572723.1|1352264_1353053_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_015082534.1|1353302_1354667_-	MFS transporter	NA	NA	NA	NA	NA
WP_011676343.1|1354864_1355581_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082535.1|1355651_1357079_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_015082536.1|1357088_1357829_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015082537.1|1357829_1358375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082538.1|1358371_1359208_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_051013173.1|1359207_1360161_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015082540.1|1360198_1361518_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081213185.1|1363764_1364976_+	virion core protein	NA	NA	NA	NA	NA
WP_015082543.1|1365189_1366341_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_011676353.1|1366337_1367123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676354.1|1367157_1367691_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_015082544.1|1367990_1369508_+	glycerol kinase	NA	NA	NA	NA	NA
WP_015082545.1|1369560_1371138_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_015082547.1|1372017_1372830_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_011676361.1|1372810_1373146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600860.1|1373461_1374301_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_015082549.1|1374312_1374573_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.9e-09
>prophage 9
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1517777	1580697	2250607	transposase,bacteriocin,tRNA	Bacillus_phage(18.18%)	53	NA	NA
WP_015082638.1|1517777_1518815_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015082639.1|1518886_1519489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011676623.1|1519537_1519708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011834866.1|1519735_1521049_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_015082640.1|1521198_1522365_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_015082641.1|1522365_1523439_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_015082642.1|1523681_1525031_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011676628.1|1525199_1525541_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_015082643.1|1525625_1526867_-	ammonium transporter	NA	NA	NA	NA	NA
WP_021211938.1|1527052_1528525_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	5.1e-27
WP_081213187.1|1528537_1529230_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	9.1e-35
WP_011834860.1|1529385_1529916_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_011676633.1|1530048_1530294_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
WP_051013198.1|1531082_1531679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015082647.1|1531786_1532557_+	hypothetical protein	NA	Q38326	Lactococcus_phage	74.0	1.9e-65
WP_011676639.1|1532717_1533791_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.5e-60
WP_011676640.1|1533878_1534811_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.5	1.3e-23
WP_011834850.1|1535059_1536352_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.2	3.6e-61
WP_011676642.1|1536451_1536973_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015082648.1|1537264_1537963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676644.1|1538067_1538367_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021037569.1|1538356_1539274_+	cation transporter	NA	NA	NA	NA	NA
WP_015082651.1|1540862_1541675_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.5e-41
WP_081213188.1|1541911_1542802_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082654.1|1544290_1544533_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_015082655.1|1544648_1544975_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_015082656.1|1544961_1545669_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015082657.1|1545863_1546436_+	NADP oxidoreductase coenzyme F420-dependent	NA	NA	NA	NA	NA
WP_015082658.1|1546505_1547048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015082659.1|1547072_1548629_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015082660.1|1548873_1549764_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082662.1|1551787_1553500_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
WP_015082663.1|1553849_1554521_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.3	2.8e-20
WP_011676659.1|1554560_1555454_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011676660.1|1555782_1556238_-	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	38.9	1.0e-26
WP_015082664.1|1556247_1557324_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015082665.1|1557419_1558283_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_015082666.1|1558631_1558883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082667.1|1559050_1561027_-	transketolase	NA	NA	NA	NA	NA
WP_015082668.1|1561194_1562595_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_011676666.1|1562647_1562947_-	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
WP_015082669.1|1565063_1565705_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_015082670.1|1566654_1568073_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011676673.1|1569026_1570553_-	MFS transporter	NA	NA	NA	NA	NA
WP_081172455.1|1570738_1571815_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_011676494.1|1573989_1574670_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082673.1|1574734_1576165_-	MFS transporter	NA	NA	NA	NA	NA
WP_011834820.1|1576523_1576829_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011676497.1|1576833_1577058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014572291.1|1577272_1578163_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014572290.1|1578144_1578345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081738.1|1579108_1579789_-|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	1.2e-108
WP_081172459.1|1579839_1580697_-|transposase	transposase	transposase	A0A059NT83	Lactococcus_phage	99.6	3.6e-158
>prophage 10
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1605059	1654096	2250607	transposase,bacteriocin,tRNA	Bacillus_phage(45.45%)	43	NA	NA
WP_015082687.1|1605059_1605950_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082688.1|1606179_1607160_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011676566.1|1607425_1608025_-	transglycosylase	NA	E0YIP1	Lactococcus_phage	53.9	1.0e-26
WP_014572273.1|1608695_1609655_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_015082689.1|1609679_1611218_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_041931810.1|1611385_1611619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676570.1|1611688_1611910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082690.1|1611990_1612305_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011676572.1|1612322_1612652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011676573.1|1612837_1613671_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011676574.1|1613707_1614448_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_015082692.1|1614546_1617252_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_015082693.1|1617512_1618946_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_011676678.1|1619064_1619337_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.1	1.5e-17
WP_015082694.1|1619457_1621200_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_081172462.1|1621348_1622719_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.8	4.6e-06
WP_011676681.1|1622934_1623612_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	2.3e-30
WP_011676682.1|1623780_1624755_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015082696.1|1624906_1627162_-	maltose phosphorylase	NA	NA	NA	NA	NA
WP_029344224.1|1630416_1631028_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_080600841.1|1631048_1632674_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_015082699.1|1632940_1634695_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_011676689.1|1635067_1636297_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041931811.1|1637729_1638587_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041931812.1|1638759_1638972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081172531.1|1638982_1639822_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.8	7.1e-50
WP_011669038.1|1639833_1640094_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	1.1e-09
WP_041931814.1|1640946_1641567_-	hydrolase	NA	NA	NA	NA	NA
WP_014572252.1|1641806_1643198_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014572251.1|1643277_1643940_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_015082704.1|1644059_1644572_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011676698.1|1644618_1644822_+	ferredoxin	NA	NA	NA	NA	NA
WP_011676699.1|1645091_1646081_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_011834717.1|1646159_1646972_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_015082705.1|1646990_1647914_+	mannose-specific PTS system component IID	NA	NA	NA	NA	NA
WP_081172464.1|1648056_1648440_+	DUF956 domain-containing protein	NA	NA	NA	NA	NA
WP_015082707.1|1648468_1649164_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	30.4	1.2e-21
WP_041931815.1|1649302_1649674_+	DUF956 domain-containing protein	NA	NA	NA	NA	NA
WP_081213189.1|1650072_1651344_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.7e-95
WP_041931816.1|1651336_1651516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041168249.1|1651618_1652446_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_003137511.1|1652459_1652720_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_041931817.1|1653415_1654096_+|transposase	IS6-like element ISS1S family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.5	6.5e-110
>prophage 11
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1846966	1857263	2250607	transposase,integrase	Lactococcus_phage(62.5%)	13	1846563:1846585	1857283:1857305
1846563:1846585	attL	AACGTAACTAAAAACGTAACTAA	NA	NA	NA	NA
WP_015082809.1|1846966_1847905_-	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	50.6	1.0e-81
WP_011676902.1|1847822_1849424_-	membrane protein	NA	NA	NA	NA	NA
WP_081172533.1|1849513_1850353_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.1	3.5e-49
WP_003137511.1|1850364_1850625_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_021212698.1|1850736_1851132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082812.1|1851134_1851554_-	deoxyuridine 5-triphosphate nucleotidohydrolase	NA	A5GYP0	Lactococcus_phage	95.7	9.0e-70
WP_003331414.1|1851785_1852544_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_015082455.1|1852555_1853779_-|transposase	IS21-like element IS712 family transposase	transposase	A0A059NT83	Lactococcus_phage	99.8	6.4e-233
WP_015082813.1|1853854_1854379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600863.1|1854659_1855226_+	helix-turn-helix domain-containing protein	NA	A5GYQ3	Lactococcus_phage	72.2	5.1e-60
WP_015082815.1|1855231_1855666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573177.1|1855679_1856015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021212288.1|1856081_1857263_+|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	47.5	2.0e-90
1857283:1857305	attR	AACGTAACTAAAAACGTAACTAA	NA	NA	NA	NA
>prophage 12
NZ_CP015894	Lactococcus lactis subsp. cremoris strain 158 chromosome, complete genome	2250607	1948965	2007406	2250607	transposase,tRNA,protease	Bacillus_phage(35.71%)	58	NA	NA
WP_081172505.1|1948965_1949856_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082866.1|1951108_1952248_-	nicotinamide-nucleotide adenylyltransferase	NA	A0A2K9VDE3	Lactobacillus_phage	55.4	1.5e-119
WP_015082867.1|1952234_1953212_-	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_015082868.1|1953409_1954702_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	33.7	1.0e-39
WP_041931920.1|1954986_1955910_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_015082870.1|1956129_1956411_+	DUF3270 domain-containing protein	NA	NA	NA	NA	NA
WP_081213194.1|1956440_1957262_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011677066.1|1957380_1958007_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_015082871.1|1958039_1959059_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011677068.1|1959051_1959822_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	4.9e-29
WP_051013186.1|1959840_1960731_-	hypothetical protein	NA	A0A076G4Q2	Staphylococcus_phage	26.6	6.5e-09
WP_051013188.1|1960832_1961156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600867.1|1961244_1962084_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	4.6e-49
WP_011669038.1|1962095_1962356_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	1.1e-09
WP_011677070.1|1962624_1963023_+	HIT family protein	NA	NA	NA	NA	NA
WP_011677071.1|1963037_1963259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573252.1|1963270_1963615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677073.1|1963692_1964382_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011677074.1|1964768_1965194_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_015082873.1|1965329_1966094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082874.1|1966093_1966972_-	bacitracin transport ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.4	1.9e-05
WP_011677077.1|1967038_1967248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677078.1|1967281_1967803_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_015082876.1|1967977_1968835_-	RNA-binding domain protein	NA	NA	NA	NA	NA
WP_011677080.1|1968879_1969338_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011677081.1|1969422_1969980_-	ribosome-recycling factor	NA	NA	NA	NA	NA
WP_004254608.1|1970135_1970852_-	UMP kinase	NA	NA	NA	NA	NA
WP_011677082.1|1970936_1971389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082877.1|1971518_1972706_-	acetate kinase	NA	NA	NA	NA	NA
WP_011677084.1|1972864_1974052_-	acetate kinase	NA	NA	NA	NA	NA
WP_081172507.1|1974243_1975182_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011677086.1|1975269_1975521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011677087.1|1975621_1977463_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	1.2e-17
WP_015082879.1|1977630_1978104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080600868.1|1978226_1979066_-	DDE domain-containing protein	NA	A0A1P8CWQ3	Bacillus_phage	41.4	4.6e-49
WP_003137511.1|1979077_1979338_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
WP_041931832.1|1979374_1979749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082881.1|1979831_1980722_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_015082882.1|1980782_1981241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082883.1|1981255_1981870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082884.1|1982209_1982938_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011677095.1|1983130_1983352_+	DUF910 domain-containing protein	NA	NA	NA	NA	NA
WP_011677096.1|1983385_1984357_+	glucokinase	NA	NA	NA	NA	NA
WP_011677097.1|1984359_1984746_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015082885.1|1984861_1985308_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.6	1.6e-16
WP_015082886.1|1985473_1986061_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011677101.1|1987096_1988191_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011677102.1|1988266_1988758_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_015082889.1|1988833_1990327_-	amino acid permease	NA	NA	NA	NA	NA
WP_015082890.1|1991910_1992855_-	carbamate kinase	NA	NA	NA	NA	NA
WP_015082892.1|1994584_1995649_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_015082893.1|1995814_1997047_-	arginine deiminase	NA	NA	NA	NA	NA
WP_011677109.1|1998353_2000048_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.2	7.8e-80
WP_015082894.1|2000115_2000574_+	arginine repressor	NA	NA	NA	NA	NA
WP_015082895.1|2000733_2002065_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_041931833.1|2002265_2002865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015082897.1|2003081_2006186_-	DNA/RNA helicase SWF/SNF family	NA	A0A2L1IWL4	Gordonia_phage	30.1	2.4e-42
WP_003137511.1|2007145_2007406_+|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
>prophage 1
NZ_CP016685	Lactococcus lactis subsp. cremoris strain 158 plasmid p158A, complete sequence	75119	1729	60612	75119	bacteriocin,protease,transposase,integrase	Lactococcus_phage(39.13%)	59	NA	NA
WP_015081769.1|1729_2620_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014573541.1|2905_3139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573540.1|3148_3907_+	chromosome partitioning protein ParA	NA	H7BUL8	unidentified_phage	28.4	1.6e-16
WP_014573539.1|3910_4639_+	chromosome partitioning protein ParB	NA	Q4ZC37	Staphylococcus_virus	27.7	7.2e-06
WP_021164865.1|4668_5049_-	hypothetical protein	NA	A0A182BQ76	Lactococcus_phage	75.6	3.3e-10
WP_015081770.1|5008_6475_-	DNA polymerase V subunit UmuC	NA	Q6DMX4	Streptococcus_phage	51.3	1.3e-123
WP_080600870.1|6736_6925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931939.1|7114_7447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080600871.1|7478_7841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081213204.1|7844_8498_-	DDE domain-containing protein	NA	A0A1X9I6C6	Streptococcus_phage	80.7	1.6e-97
WP_003331414.1|8565_9324_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	100.0	5.3e-137
WP_003331415.1|9335_10559_-|transposase	IS21 family transposase IS712	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_014573531.1|11673_11874_+	hypothetical protein	NA	Q9AZK6	Lactococcus_phage	51.9	2.8e-05
WP_003132324.1|12004_12205_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	54.7	1.6e-13
WP_011669084.1|12481_12682_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	97.0	9.6e-30
WP_011669083.1|15848_16145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021164873.1|16194_16425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014573656.1|17114_17453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041931947.1|17644_18325_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	81.9	4.4e-106
WP_014573523.1|18437_18725_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011669076.1|18734_19097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669075.1|19283_19553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669074.1|19697_20273_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011669073.1|21300_22650_+	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.7	5.4e-116
WP_081172582.1|24998_25889_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_061778283.1|25941_26757_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021166316.1|26878_27244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012898583.1|27929_28130_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	92.4	6.9e-28
WP_041931732.1|28281_28962_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	8.5e-110
WP_080600872.1|28961_29162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081772.1|29262_29844_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.4	1.4e-36
WP_011669047.1|29848_31774_+	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	36.6	5.7e-34
WP_080600873.1|32663_33155_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	35.9	9.7e-15
WP_021214628.1|33151_33574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081172581.1|33903_35064_-	MFS transporter	NA	NA	NA	NA	NA
WP_015081777.1|37957_38716_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	99.6	2.6e-136
WP_003331415.1|38727_39951_-|transposase	IS21 family transposase IS712	transposase	A0A059NT83	Lactococcus_phage	100.0	4.9e-233
WP_010890679.1|40176_40443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081778.1|40456_41254_-	plasmid partition protein	NA	A0A1V0DZZ0	Clostridioides_phage	32.6	1.1e-20
WP_015081779.1|41397_41955_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.1	2.9e-31
WP_032940538.1|42161_42344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015081780.1|42500_43967_-	UmuC protein	NA	Q6DMX4	Streptococcus_phage	51.3	6.5e-123
WP_015081781.1|44215_44851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081782.1|45285_46797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081783.1|47065_47314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041931940.1|47729_49877_+	lactococcin-A transport/processing ATP-binding protein LcnC	NA	W8CYL7	Bacillus_phage	27.1	3.5e-40
WP_015081785.1|49891_51316_+	Lactococcin A secretion protein LcnD	NA	NA	NA	NA	NA
WP_015081786.1|51389_51617_+|bacteriocin	bacteriocin lactococcin-A	bacteriocin	NA	NA	NA	NA
WP_015081787.1|51631_51928_+	Lactococcin-A immunity protein	NA	NA	NA	NA	NA
WP_015081788.1|52202_52409_+|bacteriocin	bacteriocin lactococcin-B	bacteriocin	NA	NA	NA	NA
WP_021166195.1|53490_53655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015081789.1|53857_54310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021166196.1|54348_55005_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021166197.1|55104_55386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166198.1|55387_55615_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011834695.1|55968_57288_+|transposase	IS4 family transposase IS1675	transposase	NA	NA	NA	NA
WP_011834695.1|57582_58902_+|transposase	IS4 family transposase IS1675	transposase	NA	NA	NA	NA
WP_021211273.1|59409_59634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021166201.1|59718_60612_-|transposase	IS982-like element ISLgar3 family transposase	transposase	NA	NA	NA	NA
