The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014866	Pseudomonas aeruginosa strain PA_154197, complete genome	6445239	624491	706646	6445239	plate,tail,tRNA	Pseudomonas_phage(39.02%)	88	NA	NA
WP_003129196.1|624491_625517_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|625595_626165_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|626248_626602_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003137363.1|626592_627135_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|627107_628340_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|628383_628890_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|628984_630538_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085075.1|630534_631806_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|631906_633829_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|634107_634440_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|634483_635335_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|635334_635715_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|635751_636558_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|636673_637660_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|637656_638949_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_031671280.1|638929_641740_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_080911357.1|641866_642883_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|642879_643554_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080911358.1|643555_644314_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_080911359.1|644314_645376_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_080911360.1|645527_647921_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|647966_648599_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_020751085.1|648727_649762_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_080911361.1|649995_651105_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_080911362.1|651160_652207_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|652321_653569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|653674_654505_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|654628_655303_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|655302_656121_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|656193_657672_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003109046.1|657858_658173_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003109047.1|658273_659044_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	7.9e-72
WP_003085132.1|659501_659702_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003459419.1|659749_660109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|660471_660921_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|660942_661458_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_016852413.1|661454_662012_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	1.3e-44
WP_003085143.1|662164_662491_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_080911363.1|662487_663375_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	59.5	3.5e-87
WP_080911364.1|663367_663901_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	1.5e-61
WP_080911365.1|663902_665978_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	50.5	2.7e-199
WP_031805528.1|665974_666433_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003085173.1|666475_667636_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003129212.1|667648_668152_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|668166_668511_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080911366.1|668680_670918_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_080911367.1|670927_671800_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.0e-75
WP_003101635.1|671774_671981_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_080911368.1|672038_673028_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	1.1e-105
WP_003129215.1|673060_673690_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003121852.1|673686_674049_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003137395.1|674045_674303_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_003113190.1|674618_675113_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|675124_675472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|675501_675756_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023120177.1|675802_677641_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|677633_677975_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003117971.1|677982_678678_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.1e-69
WP_003117973.1|678680_679451_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003117974.1|679505_680108_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_080911369.1|680166_683781_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.3	0.0e+00
WP_003118927.1|684016_684805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911370.1|684827_685919_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.6e-46
WP_034012394.1|685918_686254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023085655.1|686234_686465_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	3.3e-18
WP_003113178.1|686560_687613_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.2	4.6e-62
WP_003113177.1|687612_687915_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003161916.1|687911_688142_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	70.3	1.4e-24
WP_003101640.1|688560_689166_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|689167_690217_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003137410.1|690213_691050_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.8e-70
WP_003085214.1|691111_691756_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|692027_692450_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085223.1|692769_693564_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|693618_694266_-	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_003085225.1|694365_694704_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003121853.1|694782_696264_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
WP_080911371.1|696303_697104_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003085240.1|697164_698247_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085244.1|698368_699337_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|699353_699776_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003101649.1|700066_701101_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|701100_701820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|701820_702243_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|702320_702671_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003142820.1|702724_703816_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_073665956.1|703818_705162_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003113167.1|705446_706646_+|tRNA	Tyrosine--tRNA ligase 2	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP014866	Pseudomonas aeruginosa strain PA_154197, complete genome	6445239	754421	782362	6445239	integrase,transposase	uncultured_Caudovirales_phage(20.0%)	28	753433:753448	789830:789845
753433:753448	attL	CTCGGCGCGGCGCTGG	NA	NA	NA	NA
WP_080911373.1|754421_755627_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080911374.1|755623_757174_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080911375.1|757166_759167_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_080911376.1|759169_759583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155931347.1|759970_760504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911379.1|760774_761068_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155931348.1|761324_761624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911381.1|761623_761995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155931349.1|762039_762444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911382.1|762483_762924_+	hypothetical protein	NA	A0A2H4J161	uncultured_Caudovirales_phage	40.2	1.5e-11
WP_080911914.1|764216_764897_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	44.9	1.1e-40
WP_080911383.1|764896_765667_+	8-oxoguanine DNA glycosylase	NA	NA	NA	NA	NA
WP_155931350.1|765674_766385_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_080911384.1|766338_766956_-	7-cyano-7-deazaguanine synthase	NA	A0A2I7QX69	Vibrio_phage	34.6	5.0e-08
WP_080911385.1|766952_768161_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_080911386.1|768181_768514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911388.1|771596_772796_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.4	3.2e-35
WP_080911389.1|772792_773437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911390.1|773600_774233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911391.1|775019_776654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911392.1|776852_777221_+	DNA binding protein	NA	NA	NA	NA	NA
WP_155931351.1|778284_778986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155931352.1|779033_779861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911393.1|779848_780772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155931353.1|780782_781097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911394.1|781211_781757_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.2	1.1e-40
WP_155931354.1|781524_782211_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080911395.1|782113_782362_-|transposase	transposase	transposase	NA	NA	NA	NA
789830:789845	attR	CCAGCGCCGCGCCGAG	NA	NA	NA	NA
>prophage 3
NZ_CP014866	Pseudomonas aeruginosa strain PA_154197, complete genome	6445239	1485705	1494734	6445239		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1485705_1486341_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_017148388.1|1486386_1487280_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1487384_1488389_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1488815_1489139_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003113873.1|1489205_1491773_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092265.1|1491898_1492906_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1493053_1493560_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1493693_1494734_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP014866	Pseudomonas aeruginosa strain PA_154197, complete genome	6445239	2596363	2655925	6445239	holin,integrase,tail,tRNA	Pseudomonas_phage(66.07%)	73	2592534:2592551	2627314:2627331
2592534:2592551	attL	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_003097631.1|2596363_2597644_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003108773.1|2597645_2599043_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2599047_2600022_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2600109_2601093_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_021264897.1|2601089_2601425_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	9.5e-38
WP_021264896.1|2601421_2601727_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2601726_2602086_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_023099506.1|2602082_2602478_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2602588_2603257_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_033952627.1|2603592_2604660_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.5	2.4e-135
WP_080911540.1|2604661_2604898_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	2.2e-17
WP_080911541.1|2605455_2605890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911542.1|2606327_2606609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911543.1|2606644_2608546_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	88.9	1.8e-266
WP_071534313.1|2608671_2609010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911544.1|2608996_2610352_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	49.0	9.0e-87
WP_080911545.1|2610491_2612237_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	73.3	1.4e-228
WP_080911546.1|2612236_2612824_-	hypothetical protein	NA	A0A2I7RT07	Vibrio_phage	39.9	6.8e-23
WP_080911547.1|2612827_2613589_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	67.1	9.2e-105
WP_003116739.1|2613600_2613801_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_080911548.1|2613807_2614698_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	67.8	4.5e-103
WP_080911549.1|2614710_2615619_-	endonuclease	NA	Q858E0	Salmonella_phage	71.6	3.6e-124
WP_080911550.1|2615683_2615974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057384024.1|2616087_2616279_-	hypothetical protein	NA	J7HXB2	Pseudomonas_phage	98.4	9.5e-27
WP_003099037.1|2616275_2616497_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_073652514.1|2617135_2617507_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	4.2e-63
WP_080911551.1|2618382_2618859_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080911552.1|2619338_2619671_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	91.7	3.8e-47
WP_155931360.1|2619702_2620578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911554.1|2620621_2621587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911920.1|2621674_2622247_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	90.0	1.8e-84
WP_003451709.1|2622626_2622845_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_073667949.1|2623084_2623597_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	95.3	1.3e-86
WP_003103363.1|2623679_2624252_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	100.0	5.5e-102
WP_015648948.1|2624334_2624688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080911555.1|2624754_2625648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103373.1|2625697_2626306_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_019396730.1|2626298_2626742_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	99.3	2.1e-77
WP_080911556.1|2626770_2627640_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	96.2	1.4e-162
2627314:2627331	attR	GTCGCCGAGGTGGTGGCG	NA	NA	NA	NA
WP_023105198.1|2627776_2627968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031632420.1|2628052_2628436_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	98.4	2.6e-60
WP_033937803.1|2628428_2628713_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	98.9	2.7e-41
WP_058010338.1|2629299_2630625_+	hypothetical protein	NA	A0A2H4GY89	Pseudomonas_phage	69.3	7.5e-179
WP_080911558.1|2630627_2631983_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.6	4.8e-96
WP_003451682.1|2631979_2633059_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.6	3.9e-202
WP_080911921.1|2633187_2633931_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	74.5	3.2e-86
WP_023105203.1|2633940_2634912_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	1.9e-110
WP_080911559.1|2634953_2635439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911560.1|2635422_2635887_+	hypothetical protein	NA	H9EB35	Vibrio_phage	35.4	5.2e-10
WP_019396738.1|2635886_2636276_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.8	1.3e-33
WP_080911561.1|2636279_2636954_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.0	2.3e-115
WP_080911562.1|2636950_2637361_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	44.1	8.6e-25
WP_003451664.1|2637428_2638082_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.3	1.3e-59
WP_003451662.1|2638091_2638472_+	hypothetical protein	NA	A0A1S5R1H9	Pseudomonas_phage	45.1	7.2e-26
WP_080911563.1|2638534_2638798_+	hypothetical protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	4.7e-16
WP_080911564.1|2638794_2641986_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.8	1.1e-154
WP_058202737.1|2641991_2642330_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	96.4	9.8e-59
WP_080911565.1|2642326_2643076_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	7.3e-147
WP_080911566.1|2643078_2643840_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	96.4	9.1e-145
WP_080911567.1|2643864_2644107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063456166.1|2644087_2644321_-	hypothetical protein	NA	A0A0S2SY71	Pseudomonas_phage	90.7	6.0e-15
WP_155931361.1|2644876_2645458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911568.1|2645523_2646135_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	83.2	2.6e-86
WP_155931362.1|2646170_2647013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080911569.1|2647067_2650730_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	86.4	0.0e+00
WP_080911573.1|2652488_2652791_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	93.0	2.2e-46
WP_080911574.1|2652787_2653015_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	94.7	5.6e-34
WP_080911575.1|2653080_2653710_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	93.8	3.3e-108
WP_080911576.1|2653706_2654075_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	69.7	9.7e-36
WP_080911577.1|2654071_2654401_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	92.6	1.2e-48
WP_015975466.1|2654437_2654704_+	hypothetical protein	NA	A0A0U1W088	Pseudomonas_phage	100.0	8.3e-45
WP_080911578.1|2654685_2655372_-	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	87.3	2.7e-116
WP_080911579.1|2655409_2655925_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	91.1	8.7e-91
>prophage 5
NZ_CP014866	Pseudomonas aeruginosa strain PA_154197, complete genome	6445239	5372516	5411166	6445239	coat,integrase,tRNA	Pseudomonas_phage(68.75%)	42	5402931:5402990	5414086:5414167
WP_003117437.1|5372516_5373065_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003123421.1|5373095_5373629_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016562365.1|5373628_5374171_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_023113585.1|5374189_5374978_+	molecular chaperone	NA	NA	NA	NA	NA
WP_080911828.1|5374994_5377367_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_031757003.1|5377363_5378311_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099328.1|5378312_5379686_-	MFS transporter	NA	NA	NA	NA	NA
WP_080911829.1|5379965_5380988_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003114699.1|5380984_5381902_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|5382315_5383299_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033955960.1|5383451_5384408_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003141623.1|5384417_5385317_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_034028219.1|5385313_5386759_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.2e-44
WP_003099307.1|5386883_5387405_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_080911830.1|5387538_5388336_-	glutamate racemase	NA	NA	NA	NA	NA
WP_023092959.1|5388325_5389084_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003114694.1|5389077_5389908_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|5389909_5390992_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|5391009_5392278_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003135130.1|5392421_5394194_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|5394198_5394816_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_080911831.1|5394817_5395666_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5395832_5396774_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003095013.1|5396890_5397505_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5397545_5398130_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_080911832.1|5398170_5399271_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_049321234.1|5399355_5400399_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_009316208.1|5400478_5401405_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_057384474.1|5401699_5402830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
5402931:5402990	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_124175996.1|5403115_5403526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352688.1|5403506_5404508_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_033946423.1|5404504_5405797_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.0e-241
WP_080911833.1|5406026_5407301_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	86.1	3.1e-198
WP_003114150.1|5407304_5407661_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_080911834.1|5407665_5408946_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	56.0	7.3e-46
WP_003125072.1|5409093_5409342_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|5409354_5409606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5409618_5409711_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_025324669.1|5409727_5410162_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	2.1e-61
WP_079274753.1|5410296_5410674_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	3.4e-60
WP_023088865.1|5410677_5410968_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
WP_080911835.1|5410971_5411166_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	93.8	1.3e-28
5414086:5414167	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
