The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	335937	384405	4475542	integrase,holin,tail	Bacillus_phage(91.67%)	50	336971:336986	377972:377987
WP_080623910.1|335937_337038_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	26.5	4.5e-28
336971:336986	attL	CAAAATATCTTGAAAA	NA	NA	NA	NA
WP_003180750.1|337596_337674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048349897.1|337882_338182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837857.1|338200_338455_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	77.1	1.0e-28
WP_016886002.1|338473_338860_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	70.6	4.0e-40
WP_048349898.1|338991_340080_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	68.1	2.3e-109
WP_080623911.1|340236_341982_-	hypothetical protein	NA	U5PVB1	Bacillus_phage	27.3	7.9e-19
WP_080623912.1|342001_344620_-	hypothetical protein	NA	D6R401	Bacillus_phage	36.5	7.0e-136
WP_080623913.1|344638_345436_-	hypothetical protein	NA	O64043	Bacillus_phage	59.0	5.1e-74
WP_080623914.1|345451_348091_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	51.1	2.2e-246
WP_080623915.1|348094_348856_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	58.1	5.1e-79
WP_080623916.1|348911_354083_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.6	0.0e+00
WP_145614420.1|354177_354411_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	80.4	3.9e-14
WP_080623917.1|355051_356446_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.3	2.7e-102
WP_080623918.1|356532_356787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623919.1|356827_357532_-	hypothetical protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	56.2	2.4e-30
WP_080623920.1|357534_357756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623921.1|357934_358093_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_080623922.1|358102_358798_-	immunity protein	NA	Q37974	Bacillus_phage	43.0	3.7e-44
WP_145614405.1|358979_359603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623923.1|359618_359891_+	DUF3986 family protein	NA	NA	NA	NA	NA
WP_080623924.1|361722_362190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623925.1|362299_362602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886023.1|362738_363416_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_071583713.1|363553_364555_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	85.9	1.4e-169
WP_009328388.1|364568_364988_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	57.0	3.9e-41
WP_034291541.1|364988_365474_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	31.4	1.8e-13
WP_009328386.1|365516_365708_-	XkdX family protein	NA	NA	NA	NA	NA
WP_009328385.1|365704_366031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328384.1|366042_367359_-	hypothetical protein	NA	A0A142F1F9	Bacillus_phage	27.1	1.0e-10
WP_009328383.1|367361_367727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080623926.1|367836_368229_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	46.8	1.6e-12
WP_080623927.1|368268_369063_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	43.9	3.8e-29
WP_080623928.1|369107_369824_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	44.1	1.0e-49
WP_080623929.1|369820_370351_-	hypothetical protein	NA	O64060	Bacillus_phage	62.5	6.5e-57
WP_080623930.1|370347_371007_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	66.7	1.3e-78
WP_009328377.1|370993_371224_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	52.8	6.3e-09
WP_009328376.1|371220_371619_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	62.1	2.2e-41
WP_009328375.1|371630_372101_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.8	1.3e-69
WP_009328374.1|372135_373152_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.9	1.4e-161
WP_009328373.1|373192_373795_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.0	7.6e-78
WP_009328372.1|373818_375258_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.5	7.2e-175
WP_009328371.1|375292_376813_-	hypothetical protein	NA	O64068	Bacillus_phage	83.0	8.7e-248
WP_080623931.1|376830_378600_-	hypothetical protein	NA	O64069	Bacillus_phage	92.0	0.0e+00
377972:377987	attR	TTTTCAAGATATTTTG	NA	NA	NA	NA
WP_080623932.1|378583_379516_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.4	1.2e-138
WP_009328368.1|379797_380427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328367.1|380781_381975_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	38.2	9.1e-67
WP_009328366.1|381987_382191_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	74.2	1.0e-18
WP_009328365.1|382830_383346_-	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.7	1.8e-35
WP_017474483.1|384129_384405_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	73.3	1.9e-28
>prophage 2
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	416858	428254	4475542	integrase	Bacillus_phage(90.91%)	20	413463:413477	432053:432067
413463:413477	attL	AAAACTAATTAAAAG	NA	NA	NA	NA
WP_080623958.1|416858_418235_+	hypothetical protein	NA	O64100	Bacillus_phage	42.1	2.9e-93
WP_080623959.1|418238_419240_+|integrase	integrase	integrase	O64101	Bacillus_phage	40.7	1.7e-61
WP_080623960.1|419607_419862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328316.1|419874_420069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761903.1|420372_420534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623961.1|420676_421831_+	AAA family ATPase	NA	A0A172JHS6	Bacillus_phage	40.2	2.3e-67
WP_075646775.1|421883_422171_+	hypothetical protein	NA	A0A0E3DEX0	Bacillus_phage	49.5	1.8e-16
WP_050820958.1|422215_422410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073425980.1|422442_422835_+	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	44.6	5.3e-24
WP_075223458.1|423004_423202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075646773.1|423248_423593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073425983.1|423619_423793_+	DNA strand exchange inhibitor protein	NA	A0A1B1P7C0	Bacillus_phage	73.7	5.8e-15
WP_075646772.1|424305_424518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006640548.1|425353_425602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006640547.1|425611_426424_-	hypothetical protein	NA	O64130	Bacillus_phage	75.8	7.7e-118
WP_016885326.1|426517_426742_+	hypothetical protein	NA	O64132	Bacillus_phage	63.4	3.1e-21
WP_006640545.1|426738_427101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474432.1|427218_427668_+	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	39.6	2.8e-08
WP_061576016.1|427664_428063_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	95.5	2.8e-73
WP_061576017.1|428059_428254_+	hypothetical protein	NA	R4JF30	Bacillus_phage	100.0	3.2e-30
432053:432067	attR	AAAACTAATTAAAAG	NA	NA	NA	NA
>prophage 3
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	432106	470145	4475542		Bacillus_phage(87.5%)	49	NA	NA
WP_080623965.1|432106_432439_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	50.5	1.8e-17
WP_073425990.1|432522_433434_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	67.3	9.3e-112
WP_034291501.1|433487_434459_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	84.1	3.3e-155
WP_017474765.1|434505_434976_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	69.2	1.3e-56
WP_017474764.1|434990_436505_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.3	8.2e-238
WP_080623966.1|436521_437655_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.7	5.7e-159
WP_017474762.1|437658_439380_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	64.4	1.3e-215
WP_071583871.1|439380_440805_+	PHP domain-containing protein	NA	A0A1P8CX14	Bacillus_phage	85.8	6.3e-240
WP_009328290.1|440854_441784_+	helix-turn-helix domain-containing protein	NA	A7KV45	Bacillus_phage	36.4	7.7e-29
WP_009328288.1|443453_444224_+	hypothetical protein	NA	R9QM99	Lactococcus_phage	32.8	6.2e-16
WP_080623967.1|444210_445647_+	hypothetical protein	NA	A0A1P8CX14	Bacillus_phage	76.1	1.2e-214
WP_080623968.1|445657_446374_+	hypothetical protein	NA	O64147	Bacillus_phage	43.5	3.3e-40
WP_009328285.1|446378_446594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837961.1|446917_447505_+	hypothetical protein	NA	A7KV03	Bacillus_phage	38.1	6.3e-29
WP_080623969.1|447525_447870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328280.1|448877_449348_+	hypothetical protein	NA	O64162	Bacillus_phage	91.7	1.4e-79
WP_080623970.1|449526_449889_+	hypothetical protein	NA	A0A1I9S6H8	Bacillus_phage	36.8	1.2e-06
WP_095266724.1|450056_450191_+	hypothetical protein	NA	O64168	Bacillus_phage	79.5	1.6e-12
WP_073410992.1|450653_451001_+	antitoxin endoai	NA	O64171	Bacillus_phage	40.7	2.2e-13
WP_080623971.1|451000_451405_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	62.4	2.3e-38
WP_080623972.1|451358_452087_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	84.9	3.3e-112
WP_080623973.1|452330_454868_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	83.6	0.0e+00
WP_080623974.1|455519_456491_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.6	3.6e-146
WP_016885364.1|456480_457218_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	60.0	7.3e-83
WP_016885365.1|457240_457489_+	NrdH-redoxin	NA	A0A1P8CX24	Bacillus_phage	65.8	8.9e-25
WP_021837978.1|457488_457656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223514.1|457696_458026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132825.1|458015_458450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623975.1|458493_458928_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	88.7	2.5e-70
WP_017474732.1|459023_459206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623976.1|459536_459740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623977.1|459723_460017_+	hypothetical protein	NA	O64180	Bacillus_phage	48.9	7.5e-15
WP_080623978.1|460022_460580_+	hypothetical protein	NA	G3MBK8	Bacillus_virus	53.6	5.2e-49
WP_080623979.1|460581_461304_+	hypothetical protein	NA	G3MBL0	Bacillus_virus	54.7	9.1e-70
WP_080623980.1|461316_461679_+	hypothetical protein	NA	G3MBL0	Bacillus_virus	57.1	8.1e-35
WP_080623981.1|461691_462531_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	40.3	8.4e-51
WP_080623982.1|462678_463044_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	44.1	1.4e-15
WP_048355950.1|463093_463672_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	35.0	1.0e-10
WP_080623983.1|463759_463954_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	83.9	2.1e-21
WP_075223503.1|464060_464582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075223502.1|464601_465429_+	metallophosphoesterase	NA	O64184	Bacillus_phage	88.4	1.5e-153
WP_017474722.1|465468_465648_+	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	84.7	1.6e-20
WP_009328256.1|465689_465863_+	hypothetical protein	NA	O64190	Bacillus_phage	89.5	2.7e-20
WP_026579542.1|466305_466533_+	hypothetical protein	NA	A0A0E3D9Q5	Bacillus_phage	48.7	8.7e-11
WP_017474719.1|466580_467030_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	65.5	5.1e-47
WP_009328253.1|467229_467832_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	83.5	1.4e-84
WP_155761904.1|467828_467975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061576026.1|468056_469748_+	resolvase	NA	A0A0S2SXR4	Bacillus_phage	24.0	6.7e-15
WP_073410961.1|469725_470145_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	43.4	6.1e-18
>prophage 4
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	940358	952538	4475542		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|940358_940952_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|940941_941697_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183108.1|941879_941975_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|942095_942617_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|942627_943002_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|943103_943568_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183117.1|943602_944799_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183118.1|944820_945468_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183120.1|945479_946568_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	6.6e-64
WP_003183123.1|946928_947273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183125.1|947535_949722_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183127.1|949848_950286_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|950444_950750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009327959.1|950739_951870_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183133.1|952100_952538_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 5
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	1088444	1143616	4475542	plate,capsid,tail,terminase,holin,portal,coat,integrase	Bacillus_phage(32.5%)	77	1099860:1099874	1130175:1130189
WP_003183447.1|1088444_1089239_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003183449.1|1089312_1089897_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003183451.1|1089893_1090622_-	amyloid fiber anchoring/assembly protein TapA	NA	NA	NA	NA	NA
WP_003183454.1|1090898_1091219_+	DUF3889 domain-containing protein	NA	NA	NA	NA	NA
WP_003183456.1|1091242_1091425_-	YqzE family protein	NA	NA	NA	NA	NA
WP_080624019.1|1091513_1091879_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_016885935.1|1091891_1092272_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_026699160.1|1092288_1092636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583679.1|1092619_1093057_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_080624020.1|1093062_1093326_-	competence protein ComG	NA	NA	NA	NA	NA
WP_080624021.1|1093451_1094141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624022.1|1094307_1095048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624023.1|1095147_1096212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748465.1|1096237_1096594_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	38.3	3.9e-13
WP_080624025.1|1096837_1097695_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016886590.1|1097774_1098635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624026.1|1098674_1099748_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	41.2	1.5e-44
WP_080624027.1|1099799_1100063_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.0e-30
1099860:1099874	attL	ATAGTTGTTTTTAAA	NA	NA	NA	NA
WP_020450984.1|1100078_1100348_-	phage-like protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.7e-24
WP_080624028.1|1100427_1101261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043929126.1|1101362_1101545_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	57.4	3.7e-12
WP_044822060.1|1101541_1101871_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.4	1.8e-12
WP_080624029.1|1101882_1102986_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	65.9	1.5e-18
WP_080624030.1|1102986_1103262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624031.1|1103258_1103837_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.6	3.0e-15
WP_080624032.1|1103823_1104867_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.9	7.5e-73
WP_076793407.1|1104859_1105285_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	37.8	1.3e-12
WP_016886601.1|1105297_1105606_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	34.3	2.6e-05
WP_080624033.1|1105602_1106586_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.3	3.6e-37
WP_080624034.1|1106607_1107267_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.8	3.7e-25
WP_080624035.1|1107259_1112524_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	40.9	5.0e-48
WP_096748223.1|1112527_1112677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624036.1|1112706_1113156_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.9	5.0e-10
WP_080624039.1|1114226_1114670_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_080624040.1|1114671_1116072_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	42.0	1.1e-84
WP_080624041.1|1116072_1116300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624042.1|1116300_1116765_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_080624043.1|1116754_1117252_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.5	1.5e-39
WP_080624044.1|1117248_1117605_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_080624045.1|1117601_1117997_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	6.4e-17
WP_080624046.1|1118003_1118417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624047.1|1118427_1119363_-|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.4	7.8e-106
WP_080624048.1|1119375_1120551_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	51.0	1.9e-80
WP_080624049.1|1120556_1121429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624050.1|1121477_1122395_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	38.9	1.1e-51
WP_080624051.1|1122387_1123926_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	50.7	7.7e-143
WP_080624052.1|1123929_1125225_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.9	2.6e-160
WP_080624053.1|1125221_1126091_-|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	43.3	1.3e-38
WP_080624054.1|1126277_1126568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624055.1|1126858_1127062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624230.1|1127565_1128027_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080624056.1|1128050_1129928_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	6.8e-16
WP_096748224.1|1130209_1131313_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	31.1	3.7e-46
1130175:1130189	attR	TTTAAAAACAACTAT	NA	NA	NA	NA
WP_080624058.1|1131493_1131877_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	57.9	9.8e-31
WP_080624059.1|1131967_1132621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624060.1|1132617_1132818_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	63.6	2.8e-13
WP_080624061.1|1132836_1133070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624062.1|1133144_1133702_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	53.4	3.1e-49
WP_149208611.1|1133694_1133907_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	61.4	5.1e-13
WP_080624063.1|1133974_1134241_-	DUF3850 domain-containing protein	NA	A8E2L6	Enterococcus_phage	59.2	1.0e-18
WP_080624232.1|1134483_1135119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624064.1|1135130_1135589_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	69.8	2.2e-53
WP_080624065.1|1135725_1135986_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_080624233.1|1136093_1136270_-	Fur-regulated basic protein FbpA	NA	M4ZS77	Bacillus_phage	50.9	1.0e-06
WP_080624066.1|1136305_1137610_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.5	9.0e-92
WP_080624067.1|1137584_1137866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624068.1|1137868_1138681_-	hypothetical protein	NA	S6BFM4	Thermus_phage	50.0	3.7e-11
WP_080624069.1|1138848_1139799_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	60.8	1.2e-88
WP_080624070.1|1139791_1140742_-	hypothetical protein	NA	S6C475	Thermus_phage	61.7	2.3e-105
WP_017474946.1|1140741_1140921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624071.1|1141041_1141254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624072.1|1141266_1141461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624073.1|1141588_1141777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624074.1|1141777_1142044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624075.1|1142040_1142568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624077.1|1142866_1143070_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	50.8	1.1e-09
WP_080624234.1|1143268_1143616_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	50.0	3.1e-15
>prophage 6
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	1393444	1453016	4475542	terminase,coat,tRNA,protease	Moraxella_phage(25.0%)	58	NA	NA
WP_003184005.1|1393444_1394497_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003184007.1|1394612_1395722_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|1395743_1396583_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003184010.1|1396563_1398138_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_009327768.1|1398238_1399417_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.3	1.2e-31
WP_003184015.1|1399385_1399928_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003184017.1|1399971_1400841_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|1400849_1401293_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|1401406_1402693_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|1402725_1403304_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|1403529_1403811_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|1403823_1404165_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|1404177_1404486_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|1404642_1405509_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|1405501_1406293_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184032.1|1406438_1406867_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184034.1|1406866_1407187_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|1407231_1408038_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|1408040_1408721_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|1408775_1409294_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003184040.1|1409290_1410199_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|1410229_1411240_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184045.1|1411327_1412002_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|1412056_1412629_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|1412782_1413814_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011198164.1|1414017_1414767_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|1414909_1416214_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_080624082.1|1416289_1418932_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	2.8e-161
WP_003184058.1|1419393_1419585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|1419604_1420627_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_063906779.1|1420654_1422112_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|1422260_1423556_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003184063.1|1423581_1424556_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003184065.1|1424559_1425351_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|1425340_1426282_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|1426321_1427152_-	cytochrome c	NA	NA	NA	NA	NA
WP_017474375.1|1427157_1428519_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|1428707_1429193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|1429240_1429828_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|1429824_1432149_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184080.1|1432367_1434023_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|1434205_1435471_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_011198167.1|1435739_1437014_-	trigger factor	NA	NA	NA	NA	NA
WP_003184086.1|1437240_1438248_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003184088.1|1438377_1438977_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_009329313.1|1438989_1440408_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003184091.1|1440441_1441554_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003184093.1|1441581_1443138_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	2.5e-08
WP_003184095.1|1443124_1444153_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003184097.1|1444176_1444695_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184100.1|1444691_1446416_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184102.1|1446840_1447755_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184104.1|1448212_1448440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329318.1|1448482_1449865_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_009329319.1|1450277_1450532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|1450575_1451067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003184114.1|1451501_1451717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565973.1|1451720_1453016_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.2	1.9e-158
>prophage 7
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	2004168	2070589	4475542	plate,capsid,tail,tRNA,terminase,holin,coat,transposase,head,portal,integrase,protease	Bacillus_phage(58.54%)	84	2016708:2016725	2060775:2060792
WP_009329597.1|2004168_2004918_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_003185271.1|2004914_2006135_+	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_003185273.1|2006131_2006587_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003185275.1|2006603_2007077_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003185279.1|2008565_2009615_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003185281.1|2009646_2010282_-	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
WP_003185283.1|2010582_2011551_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003185286.1|2011746_2011956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185288.1|2011939_2012521_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003185290.1|2012677_2012827_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003185292.1|2012920_2014075_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_003185294.1|2014147_2014546_+	peptidase	NA	NA	NA	NA	NA
WP_069500775.1|2014642_2015128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185298.1|2015280_2015508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185302.1|2015908_2016193_+	hypothetical protein	NA	NA	NA	NA	NA
2016708:2016725	attL	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
WP_080624098.1|2017164_2017848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128739515.1|2017997_2018318_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.9	9.4e-11
WP_021837698.1|2018361_2018778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837699.1|2018774_2019095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624100.1|2019131_2019707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837701.1|2019940_2020171_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624101.1|2020769_2022287_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017474559.1|2022317_2022656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808202.1|2022783_2023737_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	43.2	5.1e-60
WP_009329191.1|2023783_2024047_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.5e-30
WP_009329192.1|2024062_2024332_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_017474775.1|2024394_2024577_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	50.0	2.3e-06
WP_069500777.1|2024573_2024897_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.3	6.6e-12
WP_069500778.1|2024909_2026349_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	58.8	2.7e-97
WP_073358672.1|2026369_2026924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500780.1|2028451_2030164_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.4	8.7e-220
WP_080624102.1|2030176_2031013_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	7.2e-111
WP_080624103.1|2031012_2035482_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.9	9.3e-72
WP_003185339.1|2035690_2036053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185341.1|2036106_2036724_-|tail	tail protein	tail	NA	NA	NA	NA
WP_003185344.1|2036738_2037122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637249.1|2037118_2037517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185349.1|2037516_2037825_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_044821664.1|2037814_2038117_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_003185353.1|2038137_2038563_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.8	9.3e-14
WP_080624104.1|2038586_2039870_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.6	4.1e-81
WP_080624105.1|2039908_2040640_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	55.2	8.9e-57
WP_043054222.1|2040584_2041895_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035316082.1|2041895_2042087_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_080624106.1|2042099_2043809_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	64.1	2.5e-211
WP_026080867.1|2043805_2044321_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	46.4	4.4e-34
WP_006637239.1|2044550_2044925_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.4e-29
WP_080624107.1|2044951_2045266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053071265.1|2045252_2045813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637236.1|2046010_2046238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|2046454_2046679_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|2047417_2047798_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_073513083.1|2047910_2048309_-	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	38.6	2.5e-05
WP_073513081.1|2048324_2048840_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.5	9.6e-82
WP_071583658.1|2048843_2049014_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
WP_073358634.1|2049010_2049550_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	6.5e-89
WP_073358636.1|2049546_2049984_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	74.5	4.7e-61
WP_025807631.1|2049961_2050225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624108.1|2050499_2052932_-	DNA primase	NA	D6R422	Bacillus_phage	80.0	0.0e+00
WP_009329263.1|2052992_2053430_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	90.3	8.2e-74
WP_061565941.1|2053429_2054362_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	87.5	9.4e-152
WP_061565942.1|2054365_2054923_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	6.3e-71
WP_011198322.1|2055015_2055258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565943.1|2055345_2055612_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	1.0e-18
WP_003185396.1|2055671_2056052_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	7.0e-21
WP_080624109.1|2056557_2057112_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.1	4.9e-31
WP_016886536.1|2057169_2057358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185403.1|2057490_2057679_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624110.1|2057675_2058470_-	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	53.1	4.4e-65
WP_080624111.1|2058493_2058712_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	61.1	7.8e-17
WP_080624112.1|2058888_2059527_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	48.2	2.1e-46
WP_080624113.1|2059597_2060692_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	53.3	5.7e-100
WP_009329604.1|2061243_2061717_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
2060775:2060792	attR	TGGAGACGGTGGGAGTCG	NA	NA	NA	NA
WP_003185414.1|2061828_2064132_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
WP_003185416.1|2064145_2064892_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003185418.1|2065032_2065263_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003185421.1|2065433_2065718_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
WP_085959538.1|2065746_2065980_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009329609.1|2066132_2066534_+	transcriptional regulator	NA	S6C481	Thermus_phage	45.3	4.2e-16
WP_011201739.1|2066697_2067102_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
WP_003185432.1|2067149_2067827_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009329611.1|2067843_2068761_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009329612.1|2068774_2069428_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003185439.1|2069449_2070589_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.6	8.6e-14
>prophage 8
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	3542342	3552266	4475542		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179530.1|3542342_3543638_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_061576038.1|3543712_3544429_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|3544430_3544685_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|3544681_3545365_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|3545348_3547577_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_073411794.1|3547552_3548983_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|3549106_3550147_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|3550143_3550731_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|3550727_3552266_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 9
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	3768436	3837019	4475542	plate,capsid,tail,tRNA,terminase,holin,portal,transposase,head,coat,integrase,protease	Bacillus_phage(43.24%)	81	3768398:3768420	3810111:3810133
3768398:3768420	attL	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054197.1|3768436_3769555_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	60.8	7.6e-124
WP_043054198.1|3769569_3770016_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	54.1	2.5e-41
WP_043054199.1|3770019_3770361_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC14	Paenibacillus_phage	62.8	1.6e-32
WP_052500258.1|3770529_3770781_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC17	Paenibacillus_phage	72.2	1.3e-26
WP_043054200.1|3770797_3771118_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	34.0	4.2e-11
WP_043054202.1|3772033_3772585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054203.1|3772642_3772861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054204.1|3772853_3773696_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.9	4.5e-52
WP_043054205.1|3773655_3774504_+	AAA family ATPase	NA	Q9MBR8	Staphylococcus_prophage	32.3	5.2e-24
WP_155392279.1|3774493_3774652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054206.1|3775249_3775450_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	3.6e-08
WP_043054207.1|3775485_3775719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155392280.1|3775930_3776068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054209.1|3776108_3776423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054210.1|3776419_3776668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054211.1|3776707_3777019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054212.1|3777050_3777263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054213.1|3777259_3777442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054214.1|3777623_3777890_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	39.1	3.5e-11
WP_043054215.1|3778175_3778616_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	1.4e-36
WP_043054216.1|3778615_3779158_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_043054217.1|3779391_3779583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075213432.1|3779988_3780213_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_043054218.1|3780466_3781135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624192.1|3781210_3781519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054219.1|3781545_3781920_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	6.9e-29
WP_043054221.1|3782663_3784373_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	64.1	2.5e-211
WP_035316082.1|3784385_3784577_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_043054222.1|3784577_3785888_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035338281.1|3785832_3786564_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.9	2.4e-57
WP_043054223.1|3786603_3787884_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.5	6.3e-74
WP_052500260.1|3787907_3788351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054224.1|3788365_3788668_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_043054225.1|3788657_3788966_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	9.7e-13
WP_043054226.1|3788965_3789364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054227.1|3789360_3789744_+	phage protein	NA	NA	NA	NA	NA
WP_043054228.1|3789758_3790376_+|tail	tail protein	tail	NA	NA	NA	NA
WP_043054229.1|3790429_3790795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624193.1|3791003_3795473_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.8e-70
WP_080624194.1|3795472_3796309_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.5	4.4e-108
WP_080624195.1|3796321_3798034_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.6	1.2e-216
WP_075223317.1|3798070_3800716_+	peptidase G2	NA	D6R401	Bacillus_phage	56.8	3.1e-293
WP_080624196.1|3800729_3802046_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	43.3	2.7e-67
WP_075213437.1|3802058_3802382_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	46.4	1.7e-12
WP_075213438.1|3802378_3802561_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.4e-06
WP_075213459.1|3802623_3802893_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	2.1e-24
WP_003185319.1|3802908_3803172_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.0e-30
WP_065644215.1|3803219_3804173_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	3.9e-60
WP_016886588.1|3804273_3804609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624197.1|3804626_3806150_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	36.6	1.2e-07
WP_071583847.1|3806405_3807527_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_080618531.1|3807749_3808118_-	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.0e-17
WP_075223314.1|3808207_3809020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031305060.1|3809240_3809459_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_071583735.1|3809483_3809798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179971.1|3812614_3812824_-	hypothetical protein	NA	NA	NA	NA	NA
3810111:3810133	attR	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_003179974.1|3814027_3814243_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|3814236_3814587_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|3814645_3814984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|3815009_3816734_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_003179978.1|3817059_3818178_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	33.0	3.1e-48
WP_071583540.1|3818970_3820296_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|3820542_3820761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|3821148_3821913_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017474999.1|3822318_3824094_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|3824296_3825064_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_087634947.1|3825060_3826074_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|3826070_3826907_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|3826920_3828051_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_071583541.1|3828081_3828540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|3828536_3828743_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|3829292_3829505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|3829612_3830359_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_011201596.1|3830324_3831794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699457.1|3831783_3832692_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|3832688_3832973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|3833080_3833350_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|3833674_3834304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583959.1|3834384_3835533_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|3835596_3836502_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085959525.1|3836536_3837019_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	4170334	4241364	4475542	plate,tail,terminase,holin,portal,coat	Bacillus_phage(24.32%)	86	NA	NA
WP_009328811.1|4170334_4170784_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|4170934_4171423_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|4171554_4172067_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|4172137_4172536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|4172584_4172971_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|4173117_4173474_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|4173760_4173970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|4174049_4174181_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|4174310_4174568_+	sporulation protein	NA	NA	NA	NA	NA
WP_011197782.1|4174606_4176889_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_016885900.1|4177010_4177268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|4177307_4177895_-	DedA family protein	NA	NA	NA	NA	NA
WP_011197784.1|4177990_4178977_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328799.1|4178973_4179864_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|4179886_4180282_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|4180446_4180866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|4180875_4181385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|4181449_4182172_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|4182162_4182495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|4182688_4183177_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|4183257_4184205_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|4184513_4185638_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_011197788.1|4185627_4186803_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|4186848_4188039_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_011197790.1|4188212_4188782_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|4188771_4189056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474216.1|4189231_4190605_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	3.8e-08
WP_080624209.1|4190909_4191896_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|4192497_4192581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061565996.1|4193019_4193199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474214.1|4193232_4193811_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_017474213.1|4193897_4194185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474212.1|4194392_4195283_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197796.1|4195603_4197433_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180762.1|4197460_4199179_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_080624210.1|4199236_4200124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|4200215_4201088_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|4201135_4201513_+	glyoxalase	NA	NA	NA	NA	NA
WP_009328757.1|4201556_4202105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|4202557_4203292_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_011197798.1|4203347_4204772_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_075223542.1|4204787_4205366_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075223543.1|4205378_4205714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|4205742_4206156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|4206530_4207013_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|4209283_4209931_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_003180785.1|4209944_4210601_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180787.1|4210789_4211143_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_003180788.1|4211315_4211576_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_003180790.1|4211565_4211862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624211.1|4211862_4212693_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_011197802.1|4212592_4213393_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_155589718.1|4213389_4213563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180798.1|4213663_4214005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|4214001_4214205_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|4214325_4214829_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|4214971_4215772_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|4215768_4217067_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_009328740.1|4218597_4219446_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|4219463_4220399_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_011201613.1|4220486_4220867_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328738.1|4220863_4221220_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003180822.1|4221216_4221705_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_003180824.1|4221717_4222158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|4222158_4222383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|4222382_4223729_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|4223730_4224174_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|4224356_4224806_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|4224847_4224985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624212.1|4224988_4228771_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|4228763_4229420_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|4229476_4230457_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|4230453_4230762_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|4230780_4231206_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|4231198_4232242_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|4232228_4233149_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|4233162_4233549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|4233564_4234770_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|4234807_4235839_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|4235941_4236211_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|4236225_4236489_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180861.1|4236539_4237604_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	1.1e-44
WP_003180863.1|4237705_4238383_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|4238405_4239422_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180867.1|4239442_4240540_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003180869.1|4240515_4241364_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 11
NZ_CP014793	Bacillus licheniformis strain SCDB 34, complete genome	4475542	4326216	4397165	4475542	plate,tail,holin,portal,integrase,protease	Bacillus_phage(30.3%)	87	4354496:4354555	4397238:4397493
WP_003181048.1|4326216_4327110_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003181050.1|4327256_4328606_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_071583721.1|4328718_4330719_+	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_003181054.1|4330766_4330982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181056.1|4330978_4331167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181058.1|4331219_4332245_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003181060.1|4332554_4334765_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_003181061.1|4334772_4335270_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	51.4	1.8e-21
WP_009328612.1|4335481_4336543_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_003181068.1|4336548_4337745_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_003181070.1|4338056_4338836_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003181072.1|4338931_4340122_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003181075.1|4340355_4341573_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_003181077.1|4341569_4342853_+	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
WP_003181078.1|4342873_4343413_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003181080.1|4343437_4343902_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	52.6	9.1e-31
WP_011197892.1|4343888_4344218_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_003181085.1|4344436_4344679_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003181087.1|4344740_4346252_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003181089.1|4346489_4346945_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003181091.1|4346969_4347749_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003181093.1|4347741_4348545_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_071583722.1|4348743_4350840_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	2.6e-125
WP_003181096.1|4351060_4352095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181098.1|4352359_4353019_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.9	6.6e-67
WP_003181100.1|4353021_4353462_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003181103.1|4353454_4354186_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	48.0	9.6e-59
WP_009328607.1|4354207_4354705_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	6.1e-57
4354496:4354555	attL	CACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTAT	NA	NA	NA	NA
WP_003181108.1|4355309_4356368_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.8	9.1e-26
WP_003181109.1|4356376_4357093_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080574625.1|4357137_4357353_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011197895.1|4357501_4357834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181116.1|4357845_4359285_-	lipase	NA	NA	NA	NA	NA
WP_003181118.1|4359342_4359657_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_003181120.1|4359688_4359862_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.1	4.0e-24
WP_025808379.1|4360186_4360369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181125.1|4360441_4360774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181127.1|4360766_4360967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181130.1|4361437_4361656_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	65.7	5.6e-07
WP_003181131.1|4361890_4362253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837415.1|4362264_4363788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031314606.1|4364097_4364283_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025808382.1|4364468_4364819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837418.1|4364815_4365154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837419.1|4365150_4365348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808384.1|4365344_4365692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808385.1|4365678_4366074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111327957.1|4367435_4367612_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003181141.1|4367714_4368086_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.1	1.5e-15
WP_003181143.1|4368153_4368489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808391.1|4368519_4368792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181147.1|4368830_4369019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808393.1|4370547_4370742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837426.1|4370738_4370885_+	hypothetical protein	NA	A0A2H4J4P7	uncultured_Caudovirales_phage	68.1	3.1e-09
WP_021837427.1|4370908_4371181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181149.1|4371297_4371585_+	hypothetical protein	NA	A6MAI4	Lactococcus_virus	59.8	2.8e-22
WP_003181152.1|4371720_4371945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181154.1|4371941_4372487_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	44.1	8.5e-28
WP_021837428.1|4372592_4374347_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	72.6	4.0e-252
WP_003181160.1|4374362_4374791_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	52.2	6.4e-31
WP_003181162.1|4374793_4376401_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.0	8.9e-166
WP_021837429.1|4376400_4377225_+	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	54.2	1.8e-77
WP_111327956.1|4377401_4377776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837431.1|4377890_4378622_+	OmpH family outer membrane protein	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	59.5	2.1e-26
WP_003181166.1|4378675_4379767_+	hypothetical protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	66.6	1.3e-128
WP_125150312.1|4379821_4380034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181168.1|4380048_4380435_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	48.8	1.9e-26
WP_003181170.1|4380435_4380774_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	43.8	1.9e-17
WP_003181172.1|4380770_4381181_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	54.4	1.1e-30
WP_003181173.1|4381184_4381559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003181175.1|4381597_4382143_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	6.2e-55
WP_003181177.1|4382200_4382569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624220.1|4383352_4383958_+	hypothetical protein	NA	A0A1X9SG40	Bacillus_phage	53.3	7.0e-23
WP_003181182.1|4384102_4386556_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	40.9	7.1e-74
WP_064503584.1|4386555_4387416_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	45.0	4.9e-62
WP_003181184.1|4387426_4388797_+	endopeptidase	NA	A6M966	Geobacillus_virus	35.5	6.6e-45
WP_003181185.1|4390404_4391628_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	61.1	6.0e-130
WP_003181186.1|4391643_4391937_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.0e-40
WP_003181188.1|4391937_4392132_+	XkdX family protein	NA	NA	NA	NA	NA
WP_003181190.1|4392135_4392399_+|holin	holin	holin	NA	NA	NA	NA
WP_080624221.1|4392465_4393380_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	63.2	6.5e-97
WP_011197925.1|4393401_4393659_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	52.9	2.3e-20
WP_011197926.1|4393778_4394333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197927.1|4394384_4394588_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080624222.1|4394718_4395537_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624223.1|4395609_4395939_+	YolD-like family protein	NA	O64030	Bacillus_phage	30.6	1.3e-07
WP_080624224.1|4396019_4397165_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	1.6e-44
4397238:4397493	attR	CACGAAGACTGCATGAACATCATCATGAACGATTTAATTGAGCTGATGGACCCGCGCTATATCGAAGTCTGGGGCAAATTCACGCCGAGGGGCGGAATCTCGATCGATCCGTACACCAACTACGGCAAGCCCGGCACAAAGTATGAAAAAATGGCCGAGTATCGGATGATGAACCATGATCTGTATCCGGAGACGATTGATAATCGGTGATGATGCGGGCAGATGAAGCGAAGGTTTGTGATCGATGTGTGACCGA	NA	NA	NA	NA
