The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014842	Bacillus licheniformis strain SCDB 14 chromosome, complete genome	4136986	832694	899053	4136986	plate,tRNA,protease,tail,holin,head,coat,integrase,terminase,portal,capsid	Bacillus_phage(55.26%)	84	842492:842509	886496:886513
WP_003185439.1|832694_833834_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.6	8.6e-14
WP_009329612.1|833855_834509_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009329611.1|834522_835440_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003185432.1|835456_836134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011201739.1|836181_836586_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
WP_009329609.1|836749_837151_-	transcriptional regulator	NA	S6C481	Thermus_phage	45.3	4.2e-16
WP_085959538.1|837303_837537_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003185421.1|837565_837850_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
WP_003185418.1|838020_838251_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003185416.1|838391_839138_+	carboxylesterase	NA	NA	NA	NA	NA
WP_003185414.1|839151_841455_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
WP_009329604.1|841566_842040_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
842492:842509	attL	CGACTCCCACCGTCTCCA	NA	NA	NA	NA
WP_021837735.1|842615_843710_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	52.5	1.4e-98
WP_003185408.1|843780_844419_-	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	47.7	1.8e-45
WP_021837734.1|844595_844814_+	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	2.3e-16
WP_011198327.1|844837_845632_+	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	52.4	3.7e-64
WP_003185403.1|845628_845817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016886536.1|845948_846137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185401.1|846194_846749_+	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
WP_021837733.1|846874_847033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837732.1|847029_847359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837731.1|847421_847688_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	6.0e-19
WP_011198322.1|847775_848018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837730.1|848110_848668_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	72.4	2.8e-71
WP_011198320.1|848671_849604_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	1.9e-152
WP_009329263.1|849603_850041_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	90.3	8.2e-74
WP_021837729.1|850101_852534_+	primase	NA	D6R422	Bacillus_phage	81.1	0.0e+00
WP_021837728.1|852754_853126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837727.1|853103_853541_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	3.2e-62
WP_021837726.1|853537_854077_+	nuclease	NA	Q9ZXC2	Bacillus_phage	89.9	1.1e-88
WP_021837725.1|854073_854244_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	6.7e-08
WP_021837724.1|854246_854762_+	hypothetical protein	NA	D6R425	Bacillus_phage	83.0	1.5e-82
WP_021837723.1|854777_855155_+	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.1	6.3e-30
WP_021837721.1|855267_855648_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.1	2.0e-47
WP_006637235.1|856398_856623_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_006637236.1|856839_857067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837719.1|857264_857825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837717.1|858152_858527_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
WP_003185364.1|858756_859272_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	9.8e-34
WP_003185362.1|859268_860978_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.0	2.7e-205
WP_021837716.1|860989_861181_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_021837715.1|861181_862492_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	4.9e-106
WP_021837714.1|862436_863168_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.7	1.2e-56
WP_021837713.1|863205_864489_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.5	1.3e-79
WP_021837712.1|864960_865263_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	4.7e-12
WP_003185349.1|865252_865561_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003185346.1|865560_865959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837711.1|865955_866339_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_003185341.1|866353_866971_+|tail	tail protein	tail	NA	NA	NA	NA
WP_003185339.1|867024_867387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837710.1|867595_872071_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.2e-71
WP_003185333.1|872067_872904_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.3	5.5e-111
WP_003185331.1|872916_874629_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.6	6.0e-221
WP_021837708.1|874664_876620_+	hypothetical protein	NA	U5PWM6	Bacillus_phage	31.8	1.0e-43
WP_021837707.1|876640_877978_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	45.5	1.6e-67
WP_003185326.1|877990_878314_+	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_003185324.1|878310_878496_+	XkdX family protein	NA	NA	NA	NA	NA
WP_009329192.1|878558_878828_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_011198302.1|878843_879107_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	6.7e-31
WP_021837706.1|879158_880001_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	55.5	3.7e-46
WP_021837705.1|880074_880419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095010844.1|880436_881105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021837701.1|882756_882987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080623576.1|883220_883772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837699.1|883832_884153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837698.1|884149_884566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118381831.1|885102_885555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026699399.1|885898_886117_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003185302.1|887025_887310_-	hypothetical protein	NA	NA	NA	NA	NA
886496:886513	attR	CGACTCCCACCGTCTCCA	NA	NA	NA	NA
WP_011198290.1|887433_887976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185296.1|888091_888577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185294.1|888673_889072_-	peptidase	NA	NA	NA	NA	NA
WP_003185292.1|889144_890299_-	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_003185290.1|890392_890542_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_003185288.1|890698_891280_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003185286.1|891263_891473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185283.1|891668_892637_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003185281.1|892937_893573_+	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
WP_017474573.1|893604_894654_-	oxidoreductase	NA	NA	NA	NA	NA
WP_021837694.1|894843_896022_+	amidase	NA	NA	NA	NA	NA
WP_003185275.1|896144_896618_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003185273.1|896634_897090_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003185271.1|897086_898307_-	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_003185269.1|898303_899053_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP014842	Bacillus licheniformis strain SCDB 14 chromosome, complete genome	4136986	1447636	1504342	4136986	tRNA,protease,coat,integrase,terminase	Bacillus_phage(30.0%)	54	1445561:1445586	1450277:1450302
1445561:1445586	attL	GTCCAAGACGGAGAGCCTGCGGACAC	NA	NA	NA	NA
WP_026699140.1|1447636_1449631_+|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	2.7e-15
WP_009329324.1|1449636_1450116_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_003184124.1|1450528_1450885_+	hypothetical protein	NA	A0A1B1P7B5	Bacillus_phage	52.0	1.8e-23
1450277:1450302	attR	GTCCAAGACGGAGAGCCTGCGGACAC	NA	NA	NA	NA
WP_026080840.1|1450893_1451664_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	63.1	1.3e-87
WP_009329322.1|1451969_1452743_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_017474640.1|1453233_1454238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026699142.1|1454283_1455153_+|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	39.6	7.4e-34
WP_026699143.1|1456448_1456664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474379.1|1456885_1457086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184110.1|1457099_1457591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009329319.1|1457634_1457889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003184106.1|1458301_1459684_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003184104.1|1459726_1459954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003184102.1|1460410_1461325_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_003184100.1|1461749_1463474_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	1.5e-62
WP_003184097.1|1463470_1463989_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003184095.1|1464012_1465041_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_044822493.1|1465027_1466584_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.6	1.5e-08
WP_003184091.1|1466611_1467724_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_009329313.1|1467757_1469176_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003184088.1|1469188_1469788_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_017474376.1|1469917_1470925_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003184085.1|1471151_1472426_+	trigger factor	NA	NA	NA	NA	NA
WP_003184083.1|1472694_1473960_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
WP_003184080.1|1474142_1475798_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_016885551.1|1476016_1478341_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184076.1|1478337_1478925_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003184074.1|1478972_1479458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474375.1|1479646_1481008_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184070.1|1481013_1481844_+	cytochrome c	NA	NA	NA	NA	NA
WP_003184068.1|1481883_1482825_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184065.1|1482814_1483606_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184063.1|1483609_1484584_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003184061.1|1484609_1485905_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_063906779.1|1486053_1487511_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003184059.1|1487538_1488561_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003184058.1|1488580_1488772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003184055.1|1489233_1491876_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184054.1|1491951_1493256_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011198164.1|1493398_1494148_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184050.1|1494351_1495383_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003184048.1|1495536_1496109_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184045.1|1496163_1496838_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003184042.1|1496925_1497936_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003184040.1|1497966_1498875_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184039.1|1498871_1499390_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011198163.1|1499444_1500125_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184035.1|1500127_1500934_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003184034.1|1500978_1501299_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184032.1|1501298_1501727_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_044789852.1|1501872_1502664_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003184028.1|1502656_1503523_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184027.1|1503679_1503988_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184025.1|1504000_1504342_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 3
NZ_CP014842	Bacillus licheniformis strain SCDB 14 chromosome, complete genome	4136986	1902178	1914358	4136986		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183133.1|1902178_1902616_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
WP_009327959.1|1902846_1903977_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.3	1.4e-77
WP_003183128.1|1903966_1904272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623594.1|1904430_1904868_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183125.1|1904994_1907181_+	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.3	1.4e-150
WP_003183123.1|1907443_1907788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011198083.1|1908148_1909237_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	5.1e-64
WP_003183118.1|1909248_1909896_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_003183117.1|1909917_1911114_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	2.1e-116
WP_003183115.1|1911148_1911613_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_003183113.1|1911714_1912089_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183111.1|1912099_1912621_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183108.1|1912741_1912837_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009327962.1|1913019_1913775_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_003183104.1|1913764_1914358_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
>prophage 4
NZ_CP014842	Bacillus licheniformis strain SCDB 14 chromosome, complete genome	4136986	2886067	2956500	4136986	plate,tail,holin,coat,terminase,portal	Bacillus_phage(28.21%)	87	NA	NA
WP_009328728.1|2886067_2886916_-	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
WP_003180867.1|2886891_2887989_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003180865.1|2888009_2889026_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180863.1|2889048_2889726_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328730.1|2889827_2890892_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	50.8	2.0e-44
WP_003180859.1|2890942_2891206_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180856.1|2891220_2891490_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180853.1|2891592_2892624_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180851.1|2892661_2893867_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180850.1|2893882_2894269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328731.1|2894282_2895203_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_009328732.1|2895189_2896233_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_003180844.1|2896225_2896651_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_003180843.1|2896669_2896978_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_009328734.1|2896974_2897955_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180838.1|2898011_2898668_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_080623616.1|2898660_2902443_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180833.1|2902446_2902584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180832.1|2902625_2903075_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180830.1|2903257_2903701_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_011197804.1|2903702_2905049_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180826.1|2905048_2905273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180824.1|2905273_2905714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180822.1|2905726_2906215_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_003180819.1|2906211_2906568_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_011201613.1|2906564_2906945_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_009328739.1|2907032_2907968_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_009328740.1|2907985_2908834_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_080623617.1|2908841_2910356_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.3	9.9e-143
WP_009328741.1|2910359_2911658_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_003180804.1|2911654_2912455_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_003180803.1|2912597_2913101_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180800.1|2913221_2913425_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180798.1|2913421_2913763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589718.1|2913863_2914037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197802.1|2914033_2914834_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180792.1|2914733_2915564_-	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_003180790.1|2915564_2915861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180788.1|2915850_2916111_-	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	7.9e-08
WP_025805657.1|2916283_2916637_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	6.1e-19
WP_003180785.1|2916825_2917482_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	4.0e-40
WP_003180784.1|2917495_2918143_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_080623618.1|2918363_2920412_+	hypothetical protein	NA	O64023	Bacillus_phage	25.2	2.1e-26
WP_003180781.1|2920415_2920898_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180779.1|2921272_2921686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180778.1|2921714_2922050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180775.1|2922062_2922641_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011197798.1|2922656_2924081_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180772.1|2924136_2924871_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_009328757.1|2925323_2925872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180768.1|2925915_2926293_-	glyoxalase	NA	NA	NA	NA	NA
WP_003180767.1|2926340_2927213_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003180765.1|2927304_2928192_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080623619.1|2928249_2929968_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_080623620.1|2929995_2931825_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_080623621.1|2932145_2933036_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016885896.1|2933243_2933531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328767.1|2933622_2934201_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_003180752.1|2934234_2934414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016885898.1|2934852_2934936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197792.1|2935538_2936525_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_080623622.1|2936829_2938203_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	23.9	2.9e-08
WP_009328774.1|2938378_2938663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197790.1|2938652_2939222_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080623623.1|2939395_2940586_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_009328782.1|2940631_2941807_-	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_009328785.1|2941796_2942921_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328787.1|2943229_2944177_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_025808330.1|2944257_2944746_+	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_011197786.1|2944939_2945272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328793.1|2945262_2945985_+	esterase family protein	NA	NA	NA	NA	NA
WP_009328796.1|2946049_2946559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328797.1|2946568_2946988_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328798.1|2947152_2947548_+	GtrA family protein	NA	NA	NA	NA	NA
WP_009328799.1|2947570_2948461_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197784.1|2948457_2949444_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.6e-53
WP_009328801.1|2949539_2950127_+	DedA family protein	NA	NA	NA	NA	NA
WP_009328802.1|2950166_2950424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197782.1|2950545_2952828_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	1.0e-90
WP_009328805.1|2952866_2953124_-	sporulation protein	NA	NA	NA	NA	NA
WP_011197781.1|2953253_2953385_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328806.1|2953464_2953674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197779.1|2953960_2954317_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328807.1|2954463_2954850_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|2954898_2955297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328809.1|2955367_2955880_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|2956011_2956500_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP014842	Bacillus licheniformis strain SCDB 14 chromosome, complete genome	4136986	3528833	3538757	4136986		Synechococcus_phage(50.0%)	9	NA	NA
WP_003179539.1|3528833_3530372_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
WP_003179538.1|3530368_3530956_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_011197613.1|3530952_3531993_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179536.1|3532116_3533547_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_003179534.1|3533522_3535751_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	4.2e-158
WP_003179533.1|3535734_3536418_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003179532.1|3536414_3536669_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	34.6	8.0e-05
WP_003179531.1|3536670_3537387_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179530.1|3537461_3538757_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
>prophage 1
NZ_CP014843	Bacillus licheniformis strain SCDB 14 plasmid pSCDB14, complete sequence	205480	32821	40709	205480		Bacillus_phage(87.5%)	18	NA	NA
WP_080623724.1|32821_33292_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	67.1	2.1e-22
WP_080623725.1|33301_33511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623726.1|33610_33802_+	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	69.4	4.7e-18
WP_080623728.1|33922_34117_+	hypothetical protein	NA	R4JF30	Bacillus_phage	90.5	6.7e-28
WP_080623729.1|34113_34302_+	hypothetical protein	NA	A0A0A0RMX5	Bacillus_phage	62.7	2.0e-13
WP_080623730.1|34298_34505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623732.1|34504_34729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623733.1|34794_35004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623734.1|35074_35491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623890.1|35567_36719_+	AAA family ATPase	NA	A0A172JHS6	Bacillus_phage	41.9	4.2e-69
WP_080623736.1|36827_37187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623737.1|37228_37522_+	hypothetical protein	NA	S5MM68	Bacillus_phage	46.5	1.7e-06
WP_080623738.1|37534_37813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623739.1|37799_38159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623740.1|38155_38341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087635023.1|38404_39112_+	single-stranded DNA-binding protein	NA	A0A2H4J1P3	uncultured_Caudovirales_phage	37.0	7.0e-06
WP_080623743.1|39169_39553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080623745.1|39533_40709_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	42.9	1.6e-68
