The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	141561	157912	2178261	integrase	Streptococcus_phage(73.33%)	26	140915:140938	155221:155244
140915:140938	attL	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_025195363.1|141561_141939_-	DUF1492 domain-containing protein	NA	Q7Y4J3	Streptococcus_phage	36.6	7.2e-10
WP_000500998.1|141913_142276_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891800.1|142674_143163_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
WP_017644960.1|143236_143794_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	59.8	1.4e-30
WP_001873750.1|143795_143969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694574.1|143974_144148_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
WP_017644961.1|144432_146070_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	83.1	8.8e-262
WP_017644962.1|146089_146947_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.0e-121
WP_001100458.1|146947_147220_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	1.4e-18
WP_000174502.1|147222_147552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644963.1|147563_147761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644964.1|147741_147882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644965.1|147878_148211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000648623.1|148465_148708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644966.1|148734_149358_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	42.8	2.2e-40
WP_017644967.1|149367_150120_-	hypothetical protein	NA	A0A0A7RW33	Clostridium_phage	54.1	3.3e-22
WP_017644968.1|150145_150763_-	Rha family transcriptional regulator	NA	A0A249XSL1	Mycobacterium_phage	37.3	1.6e-11
WP_017644969.1|150779_151187_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	57.5	1.4e-35
WP_003066809.1|151201_151405_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_017644970.1|151602_152166_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	34.8	2.2e-18
WP_017644971.1|152519_152681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646039.1|152942_153797_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.9	8.0e-57
WP_025195365.1|154043_155210_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.6	1.3e-153
WP_000092759.1|155316_155928_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
155221:155244	attR	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_001278152.1|156257_156545_-	Veg family protein	NA	NA	NA	NA	NA
WP_000230635.1|156556_157912_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 2
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	237402	245507	2178261		Mollivirus(16.67%)	7	NA	NA
WP_000220675.1|237402_238857_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_001291333.1|238884_239907_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
WP_000685108.1|240073_240622_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
WP_000780023.1|240644_241397_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166553.1|241416_242964_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
WP_001045908.1|243156_244056_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783413.1|244202_245507_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 3
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	441899	463060	2178261	integrase	Streptococcus_phage(89.47%)	24	438776:438790	463764:463778
438776:438790	attL	ATAAAGATTTAATTG	NA	NA	NA	NA
WP_065736059.1|441899_443348_+	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	35.6	6.5e-67
WP_000078283.1|444166_444457_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_000749953.1|444527_444935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001172779.1|445020_445413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291561.1|445534_446752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|446833_447037_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|447497_447728_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|447724_448147_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|448651_449005_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|449064_449232_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691753.1|449350_451270_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	99.7	0.0e+00
WP_001814923.1|451285_451402_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|451646_452582_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_000769868.1|452578_453580_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|453576_455754_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331160.1|455756_458204_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|458187_458694_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|458668_459166_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|459282_459504_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|459546_460752_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|460774_460927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|460929_462315_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|462343_462730_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|462745_463060_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
463764:463778	attR	ATAAAGATTTAATTG	NA	NA	NA	NA
>prophage 4
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	719375	805821	2178261	transposase,portal,terminase,head,protease,holin,tail,integrase,tRNA	Streptococcus_phage(57.38%)	95	739596:739655	778773:778853
WP_000768156.1|719375_722168_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	2.4e-86
WP_001237037.1|722237_722540_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_000184290.1|722603_723059_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000882544.1|723244_725506_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
WP_000443582.1|725803_726034_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|726174_726867_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230129.1|726859_727594_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001106849.1|727880_729575_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.3	7.7e-128
WP_000137498.1|729713_730568_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634982.1|730564_731401_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286946.1|731526_732867_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.0	2.0e-38
WP_001280898.1|732844_733060_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256277.1|733059_733932_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041038.1|733924_734752_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000747940.1|734738_735212_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923611.1|735223_736882_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034835.1|736994_737831_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|737823_738663_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|738637_739240_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|739342_739618_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
739596:739655	attL	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTG	NA	NA	NA	NA
WP_000269472.1|739705_740848_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	81.6	1.1e-181
WP_047198696.1|740962_741514_-	hypothetical protein	NA	A7J267	Streptococcus_phage	63.7	6.5e-60
WP_000151182.1|741531_741918_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	57.6	2.3e-35
WP_000484457.1|741921_742269_-	helix-turn-helix transcriptional regulator	NA	A0A126GGQ7	Streptococcus_phage	76.1	1.3e-42
WP_000739596.1|742564_742810_+	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	7.4e-08
WP_000092750.1|742760_743549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001112862.1|743599_743791_+	hypothetical protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
WP_001123482.1|743870_744182_+	hypothetical protein	NA	M1Q0Y6	Streptococcus_phage	87.3	2.9e-49
WP_000732608.1|744186_744336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910901.1|744329_744557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573547.1|744549_744780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156426.1|744763_746083_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	57.1	3.1e-132
WP_001167564.1|746097_747171_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	54.2	9.6e-100
WP_000141564.1|747266_747872_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	48.5	1.5e-36
WP_001870729.1|747871_748480_+	hypothetical protein	NA	D2XPY9	Bacillus_virus	45.5	7.2e-44
WP_032456395.1|748485_750069_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	77.8	1.7e-233
WP_000427885.1|750077_750275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114109.1|750267_750519_-	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	52.8	1.3e-20
WP_000829573.1|750589_752869_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	62.7	4.6e-277
WP_000666342.1|753238_753436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151204.1|753462_753861_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	61.2	1.7e-41
WP_000687319.1|753857_754073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145465.1|754069_754306_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	93.6	2.3e-38
WP_001005355.1|754302_754533_+	hypothetical protein	NA	J7KK64	Streptococcus_phage	100.0	3.1e-32
WP_000052302.1|754535_754868_+	hypothetical protein	NA	J7KDM7	Streptococcus_phage	55.8	2.6e-27
WP_000041038.1|754945_755359_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	60.6	1.2e-42
WP_000041103.1|755479_755911_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	93.7	3.9e-68
WP_000208745.1|755900_757181_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	94.1	1.3e-233
WP_000462948.1|757195_758725_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	83.8	6.7e-248
WP_032459253.1|758684_760133_+|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	77.3	4.4e-225
WP_025194292.1|760160_760349_+	hypothetical protein	NA	A7J294	Streptococcus_phage	77.4	3.7e-15
WP_001042286.1|760353_760557_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	53.4	1.3e-13
WP_000797011.1|760699_761269_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	89.9	1.5e-72
WP_000818573.1|761287_762184_+	hypothetical protein	NA	A7J297	Streptococcus_phage	94.6	2.4e-152
WP_000356705.1|762189_762546_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	62.7	6.7e-34
WP_000639437.1|762556_762835_+	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_000060408.1|762831_763176_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	93.0	6.9e-52
WP_000640604.1|763179_763539_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	74.6	5.6e-44
WP_000450517.1|763550_764183_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	68.6	2.6e-60
WP_000424190.1|764233_764689_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	70.9	3.1e-55
WP_000398752.1|764763_764994_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	59.2	2.2e-14
WP_105253162.1|765022_769249_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	46.6	1.1e-21
WP_000365119.1|769261_770104_+|tail	phage tail family protein	tail	A7J2A6	Streptococcus_phage	48.6	3.4e-76
WP_000206522.1|770116_773944_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	49.2	2.9e-162
WP_000391486.1|773952_774105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001873936.1|774115_774532_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_000222556.1|774594_774756_+	hypothetical protein	NA	A0A1X9I5T1	Streptococcus_phage	56.8	1.9e-07
WP_000564987.1|774765_775062_+	hypothetical protein	NA	Q938J6	Temperate_phage	84.7	1.2e-39
WP_001001962.1|775063_775402_+|holin	phage holin	holin	A0A1P8VVK6	Streptococcus_phage	71.4	6.8e-36
WP_000236382.1|775403_776123_+	CHAP domain-containing protein	NA	A0A1U9WRD0	Streptococcus_virus	70.3	7.2e-59
WP_000829578.1|776461_777421_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	38.7	1.3e-58
WP_000076696.1|777575_777776_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	87.9	7.4e-22
WP_000356856.1|777816_777987_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_000965651.1|778406_778586_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.4	2.1e-20
WP_001290370.1|778991_779189_+	hypothetical protein	NA	NA	NA	NA	NA
778773:778853	attR	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTGATAGCGACAAGGTTCTTTTTT	NA	NA	NA	NA
WP_105253163.1|779232_780165_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.4	3.9e-65
WP_001185383.1|780352_781588_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000285510.1|781606_782818_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527081.1|782830_784066_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200660.1|784050_784863_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003542.1|784934_786251_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209457.1|786314_786713_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|787056_789741_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
WP_000064641.1|790797_792729_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_000351633.1|792818_793943_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|794011_795109_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|795128_795821_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|795804_796734_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088186184.1|796807_798152_+|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001022577.1|798222_798933_-	thioesterase	NA	NA	NA	NA	NA
WP_001115859.1|798929_799628_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048142.1|799795_800560_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458617.1|800667_803175_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	1.4e-218
WP_000221828.1|803260_804454_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038473.1|804474_805821_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.7e-56
>prophage 5
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	817605	825163	2178261	transposase,integrase	Streptococcus_phage(50.0%)	11	810950:810965	828443:828458
810950:810965	attL	GAAAATAAATAAAATT	NA	NA	NA	NA
WP_000595706.1|817605_818802_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
WP_001068667.1|819385_819733_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|819877_820492_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|820494_820761_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|820760_821165_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|821326_821527_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|821548_821809_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|821934_822144_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|822316_822478_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|823219_824497_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|824506_825163_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
828443:828458	attR	GAAAATAAATAAAATT	NA	NA	NA	NA
>prophage 6
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1046066	1055397	2178261	capsid	Streptococcus_phage(50.0%)	8	NA	NA
WP_000417519.1|1046066_1047284_+	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	90.6	5.1e-198
WP_000420313.1|1047403_1048867_+	ABC-F type ribosomal protection protein Msr(D)	NA	A0A1B0RXA0	Streptococcus_phage	97.3	3.7e-251
WP_004121959.1|1048984_1049275_-	hypothetical protein	NA	A0A1B0RX98	Streptococcus_phage	82.5	1.7e-11
WP_004121956.1|1049274_1049487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004121944.1|1049798_1052123_+	nucleoside triphosphatase	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	30.9	2.1e-99
WP_070469374.1|1052541_1053489_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	31.3	8.4e-39
WP_180947200.1|1053506_1053674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105253167.1|1053744_1055397_+	recombinase family protein	NA	C7F8K5	Bacillus_phage	27.7	1.7e-26
>prophage 7
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1321652	1366652	2178261	transposase,portal,terminase,capsid,head,protease,holin,tail	Streptococcus_phage(97.44%)	50	NA	NA
WP_017646703.1|1321652_1323218_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	61.5	8.0e-180
WP_017646702.1|1323220_1324429_-	recombinase family protein	NA	Q6DMS6	Streptococcus_phage	49.7	1.8e-102
WP_017643178.1|1324485_1324647_-	hypothetical protein	NA	Q6DMS7	Streptococcus_phage	58.8	6.4e-08
WP_017646701.1|1324643_1325045_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_017646700.1|1325154_1326624_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1X9I678	Streptococcus_phage	78.9	1.8e-226
WP_017646699.1|1326625_1327030_-|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	74.8	3.0e-46
WP_017646698.1|1327047_1328904_-	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.3	2.5e-257
WP_017646697.1|1328916_1331832_-|tail	phage tail protein	tail	Q6DMT0	Streptococcus_phage	64.8	0.0e+00
WP_017646696.1|1331831_1332557_-|tail	phage tail protein	tail	Q6DMT1	Streptococcus_phage	57.9	1.4e-81
WP_017646695.1|1332553_1335673_-|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	76.7	2.0e-254
WP_001249611.1|1335855_1336275_-	hypothetical protein	NA	A0A1X9I691	Streptococcus_phage	76.3	1.3e-55
WP_017646694.1|1336286_1336856_-|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	93.6	1.5e-96
WP_017646693.1|1336858_1337185_-	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	69.4	8.3e-39
WP_017646692.1|1337193_1337562_-	HK97 gp10 family phage protein	NA	Q6DMT7	Streptococcus_phage	62.9	7.0e-34
WP_017646691.1|1337554_1337893_-|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	70.5	4.3e-38
WP_017646690.1|1337892_1338150_-|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	78.8	9.5e-30
WP_017646689.1|1338146_1339355_-|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.3	1.0e-211
WP_017646688.1|1339367_1340066_-|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	83.6	5.8e-106
WP_017646687.1|1340058_1341354_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	89.3	8.0e-226
WP_017646686.1|1341422_1341626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017646685.1|1341695_1342034_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017646684.1|1342026_1342320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017646683.1|1342386_1343979_-|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	95.8	6.0e-308
WP_017646682.1|1343975_1344449_-|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	96.8	1.5e-84
WP_017646681.1|1344497_1344947_-	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	67.1	4.1e-20
WP_017646680.1|1344948_1345200_-	hypothetical protein	NA	M1PG57	Streptococcus_phage	59.3	5.8e-16
WP_017646679.1|1345261_1346542_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	92.3	2.2e-231
WP_017646678.1|1346538_1347795_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	90.9	3.0e-225
WP_017646677.1|1347766_1348222_-	hypothetical protein	NA	M1Q209	Streptococcus_phage	50.3	1.0e-42
WP_017646676.1|1348510_1348876_-	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	88.4	3.2e-63
WP_024051850.1|1348877_1349915_-	methionine adenosyltransferase	NA	E4ZFL0	Streptococcus_phage	83.8	2.7e-168
WP_017646674.1|1349962_1350145_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	86.7	1.7e-20
WP_017646673.1|1350339_1350816_-	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	84.2	3.2e-71
WP_017646672.1|1350808_1352185_-	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.7	1.6e-232
WP_024051851.1|1352165_1352447_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	84.9	2.2e-40
WP_017646670.1|1352727_1355016_-	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	87.9	0.0e+00
WP_017646668.1|1355374_1355698_+	hypothetical protein	NA	D0R0B4	Streptococcus_phage	72.9	8.8e-33
WP_017646667.1|1355690_1356812_+	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	90.9	3.5e-201
WP_017646666.1|1356816_1357380_+	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	92.8	1.5e-91
WP_017646665.1|1357398_1357566_+	hypothetical protein	NA	E4ZFK2	Streptococcus_phage	56.9	4.3e-07
WP_017646664.1|1357614_1359570_+	DNA polymerase	NA	E4ZFK1	Streptococcus_phage	86.2	0.0e+00
WP_017646663.1|1359631_1360174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017646662.1|1360335_1360932_-	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	27.9	4.6e-11
WP_003047226.1|1361364_1362489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176802.1|1362488_1362713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904398.1|1362703_1364362_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000673009.1|1364351_1364561_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	58.5	4.8e-16
WP_000154547.1|1364819_1365170_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000391861.1|1365223_1365409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071659975.1|1365380_1366652_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1441771	1518910	2178261	transposase,tRNA,protease	Bacillus_phage(28.57%)	60	NA	NA
WP_088186184.1|1441771_1443117_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_000129278.1|1443192_1443960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022110.1|1443968_1444679_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000254651.1|1444662_1445919_-	chloride channel protein	NA	NA	NA	NA	NA
WP_000173383.1|1445920_1446730_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000416957.1|1446768_1447176_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	52.3	7.7e-34
WP_000077191.1|1447226_1448438_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000343877.1|1448494_1449166_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_001259482.1|1449403_1450114_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000863793.1|1450203_1450992_-	esterase family protein	NA	NA	NA	NA	NA
WP_001280054.1|1451048_1452710_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000979970.1|1453006_1453768_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-12
WP_000587301.1|1453767_1454631_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000790858.1|1454643_1455648_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006716.1|1456006_1457662_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000005481.1|1457715_1458435_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140341.1|1458448_1460131_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934868.1|1460240_1461467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075588.1|1461456_1462647_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796047.1|1462738_1463200_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163512.1|1463189_1463672_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000403410.1|1463888_1467107_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000134275.1|1467158_1468205_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	6.6e-69
WP_000139163.1|1468411_1469005_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000676114.1|1469004_1469874_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000716829.1|1469932_1471036_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000647415.1|1471044_1471833_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000365673.1|1471822_1472506_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221656.1|1472609_1473290_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1473407_1473926_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_001247507.1|1474048_1476613_-	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_000622235.1|1476764_1478963_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
WP_000124585.1|1478959_1479721_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405388.1|1479722_1480652_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568320.1|1480693_1481341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573351.1|1481333_1482572_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001226480.1|1482662_1483553_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1483663_1483840_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_070469330.1|1484934_1488693_-	pullulanase	NA	NA	NA	NA	NA
WP_001205490.1|1488861_1489596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130587.1|1489610_1490195_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150951.1|1490291_1491698_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_000670189.1|1491744_1492347_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000942624.1|1492516_1494298_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	4.6e-06
WP_088186184.1|1494354_1495700_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001003955.1|1495774_1497556_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567585.1|1497714_1498482_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285045.1|1498540_1499881_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000245056.1|1499980_1500397_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1500400_1500898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162275.1|1501119_1501716_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_088197863.1|1501904_1503009_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_070469363.1|1504843_1507312_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000755138.1|1507324_1508245_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_105253173.1|1510336_1513777_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
WP_000453221.1|1514430_1515765_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_000584204.1|1515872_1516421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863581.1|1516517_1516748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102864.1|1516816_1517158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088197863.1|1517805_1518910_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
>prophage 9
NZ_CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1793658	1805154	2178261	transposase	Streptococcus_phage(90.91%)	13	NA	NA
WP_000767484.1|1793658_1794486_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287943.1|1794525_1794882_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1794883_1795360_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_001167085.1|1796637_1797186_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000587955.1|1797253_1798345_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
WP_000603277.1|1798477_1799113_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425856.1|1799382_1800252_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.9e-110
WP_000358198.1|1800251_1800578_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364562.1|1800607_1801471_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
WP_000715592.1|1801490_1802126_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_065733474.1|1802334_1803501_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_001144245.1|1803765_1804425_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
WP_000178147.1|1804443_1805154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.2e-17
