The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020410	Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome	2489049	62166	116681	2489049	protease,transposase,tRNA	Bacillus_phage(40.0%)	47	NA	NA
WP_010934496.1|62166_62670_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010934497.1|62715_63339_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.5	1.7e-08
WP_004567129.1|63335_63587_+	mycothiol system anti-sigma-R factor	NA	NA	NA	NA	NA
WP_004567131.1|63591_63936_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_004567132.1|64273_64534_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	2.0e-11
WP_010934499.1|65166_65628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934500.1|65621_66884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934501.1|66880_68191_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.0	1.7e-42
WP_004567139.1|68448_68676_+	DUF3107 domain-containing protein	NA	NA	NA	NA	NA
WP_010934503.1|68678_69557_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_010934504.1|69580_70438_+	TIGR02569 family protein	NA	NA	NA	NA	NA
WP_010934505.1|70441_73624_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_010934506.1|73617_76848_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.9	1.5e-18
WP_004567149.1|76892_77981_+	potassium channel protein	NA	NA	NA	NA	NA
WP_010934507.1|78012_78696_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010934508.1|78688_80740_+	ATP-dependent DNA helicase UvrD2	NA	S5MMD7	Bacillus_phage	27.5	2.9e-44
WP_014303076.1|80684_81578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934510.1|81613_82135_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_010934511.1|82131_83523_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_010934512.1|83603_84656_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_041627816.1|84667_85366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934514.1|85416_85920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934515.1|86092_89056_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_010934516.1|89539_90109_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_010934518.1|90638_91649_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_010934519.1|91651_92608_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010934520.1|92863_93031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934521.1|93286_94768_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_010934522.1|94780_96337_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_003850577.1|96350_96614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850583.1|96638_97007_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_014301560.1|97209_98301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934524.1|98319_99108_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014308099.1|99164_99980_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_010934526.1|100159_101269_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010934527.1|101265_102864_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_003850596.1|103042_103732_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.7	1.2e-26
WP_010934528.1|103748_104651_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003850600.1|104757_105249_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.2	1.5e-36
WP_010934530.1|105839_107219_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	7.9e-38
WP_010934531.1|107328_110262_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_010934532.1|110249_112382_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.2	5.3e-33
WP_010934533.1|112381_113260_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	6.6e-30
WP_010934534.1|113259_114057_+	lantibiotic ABC transporter permease	NA	NA	NA	NA	NA
WP_010934535.1|114222_114489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013170013.1|115523_115805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044026255.1|115877_116681_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020410	Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome	2489049	1208571	1259079	2489049	integrase,tRNA,terminase,portal,protease	Gordonia_phage(27.78%)	50	1203450:1203465	1262100:1262115
1203450:1203465	attL	GCGACGAGGTCTTCGA	NA	NA	NA	NA
WP_003852470.1|1208571_1211280_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	7.2e-136
WP_010935335.1|1211374_1212355_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_010935336.1|1212837_1213590_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010935337.1|1213626_1214919_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	3.3e-131
WP_041627968.1|1215065_1217591_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.4	6.2e-65
WP_003852475.1|1217685_1218315_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_003852476.1|1218332_1218932_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	3.3e-41
WP_010935339.1|1219097_1220444_-	trigger factor	NA	NA	NA	NA	NA
WP_003852480.1|1221270_1221507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852481.1|1221653_1222436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852484.1|1222512_1222986_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_010935340.1|1223017_1223638_-	DsbA family protein	NA	NA	NA	NA	NA
WP_010935341.1|1223759_1226378_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.0	5.7e-45
WP_010935342.1|1226633_1227650_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010935343.1|1227661_1228054_+	globin	NA	NA	NA	NA	NA
WP_010935344.1|1228050_1228671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935345.1|1228680_1229124_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010935346.1|1229250_1230921_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.3e-47
WP_010935347.1|1231018_1231507_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_010935348.1|1231690_1233727_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_010935349.1|1233953_1236239_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_003852501.1|1236259_1236460_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_003852518.1|1237931_1239137_-	MFS transporter	NA	NA	NA	NA	NA
WP_014309480.1|1239541_1240573_+	oxidoreductase	NA	NA	NA	NA	NA
WP_010935351.1|1240632_1241433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010935352.1|1241451_1242084_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	38.6	4.3e-23
WP_010935353.1|1242261_1243092_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014307201.1|1243092_1244346_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_100209167.1|1244588_1244855_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157761930.1|1244985_1245177_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003852534.1|1245173_1245458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852535.1|1245450_1245780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126374930.1|1245751_1245946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935357.1|1246664_1247066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852539.1|1247058_1247337_+	HNH endonuclease	NA	G9FGW5	Rhodococcus_phage	61.8	3.4e-25
WP_041627971.1|1247457_1247778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035119248.1|1247839_1249177_+|terminase	terminase	terminase	A0A2P1CBZ2	Gordonia_phage	46.4	6.4e-101
WP_010935359.1|1249415_1250465_+|portal	phage portal protein	portal	G9FGU9	Rhodococcus_phage	45.3	2.5e-52
WP_003852546.1|1250448_1251000_+	C39 family peptidase	NA	A0A2H4P9D2	Corynebacterium_phage	71.8	1.0e-73
WP_003852548.1|1251190_1251427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852552.1|1251419_1252823_+	hypothetical protein	NA	G9FGV2	Rhodococcus_phage	42.7	2.2e-59
WP_003852555.1|1252822_1253134_+	hypothetical protein	NA	A0A2P1CBZ4	Gordonia_phage	44.7	5.2e-14
WP_003852557.1|1253130_1253505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003852559.1|1253504_1253927_+	hypothetical protein	NA	A0A160DHJ4	Gordonia_phage	38.4	1.4e-17
WP_010935362.1|1253929_1254343_+	hypothetical protein	NA	A0A2P1CBZ9	Gordonia_phage	46.9	5.6e-24
WP_003852563.1|1254342_1254654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935363.1|1254731_1256297_+	hypothetical protein	NA	A0A222ZGY6	Arthrobacter_phage	46.3	1.5e-61
WP_003852566.1|1256290_1257478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935364.1|1257478_1258267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935365.1|1258263_1259079_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	46.5	1.2e-57
1262100:1262115	attR	GCGACGAGGTCTTCGA	NA	NA	NA	NA
>prophage 3
NZ_CP020410	Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome	2489049	1376316	1429705	2489049	protease,transposase,tRNA	Escherichia_phage(15.38%)	54	NA	NA
WP_041627987.1|1376316_1377081_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	5.6e-86
WP_007929940.1|1377818_1378670_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1378797_1379298_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041627987.1|1379804_1380569_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	5.6e-86
WP_010935457.1|1380680_1382417_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_010935458.1|1382529_1383981_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_088245739.1|1384421_1385719_-|transposase	IS3-like element ISCod1 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.9	6.5e-58
WP_010935461.1|1385854_1386112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935462.1|1386251_1386731_+	hypothetical protein	NA	A0A1L6BZI7	Pasteurella_phage	45.8	2.2e-24
WP_010935463.1|1386786_1387101_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8D5N3	Corynebacterium_phage	52.5	2.5e-16
WP_010935464.1|1387239_1387689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935465.1|1387685_1388024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133060854.1|1388119_1388566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041627995.1|1388626_1390006_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.6e-38
WP_010935468.1|1390387_1391932_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003852836.1|1391992_1392337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021336039.1|1392336_1393785_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_014310795.1|1393812_1394295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935471.1|1394284_1395043_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_014302329.1|1395005_1396133_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010935472.1|1396154_1397096_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_010935473.1|1397123_1398515_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.8	3.7e-43
WP_010935474.1|1398533_1399016_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003852854.1|1399008_1399743_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003852856.1|1399752_1400334_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_041627997.1|1400589_1401171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935476.1|1401274_1402666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935477.1|1403022_1404414_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003852863.1|1404441_1405158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003852865.1|1405227_1405857_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010935478.1|1405987_1406875_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_080624866.1|1406871_1408149_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003852870.1|1408255_1408426_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_041627999.1|1408456_1411093_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.5	2.5e-133
WP_003852875.1|1411540_1411996_-	DIP1984 family protein	NA	NA	NA	NA	NA
WP_010935481.1|1412031_1412670_+	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_041628193.1|1412776_1413571_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014309555.1|1413586_1413760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935483.1|1414096_1415659_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.3	2.9e-73
WP_010935485.1|1417042_1417801_-	permease	NA	NA	NA	NA	NA
WP_010935486.1|1417797_1418721_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	4.6e-18
WP_010935487.1|1419194_1420163_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_003852899.1|1420162_1420360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628001.1|1420409_1421702_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003852901.1|1421718_1422498_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_010935489.1|1422510_1423134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935490.1|1423130_1424048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935491.1|1424049_1424517_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_010935492.1|1424513_1424993_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010935493.1|1425002_1425368_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010935494.1|1425373_1426210_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	33.4	7.7e-20
WP_003852910.1|1426333_1426648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003852911.1|1426650_1427223_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	56.1	1.0e-47
WP_010935495.1|1427230_1429705_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.7	9.0e-109
>prophage 4
NZ_CP020410	Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome	2489049	1665616	1716856	2489049	protease,transposase,holin,tRNA	Vibrio_phage(22.22%)	46	NA	NA
WP_010935656.1|1665616_1667842_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	5.6e-17
WP_041628057.1|1668113_1669907_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.1	1.6e-54
WP_041628058.1|1670092_1671256_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	46.1	1.7e-94
WP_041628060.1|1671294_1671501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181241235.1|1671469_1671958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010935660.1|1671950_1672976_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_010935661.1|1673037_1673313_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_010935662.1|1673782_1675603_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A159B6I5	Gordonia_phage	34.8	8.9e-05
WP_010935663.1|1675711_1676440_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_010935664.1|1676432_1677491_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_010935665.1|1677546_1678131_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_010935666.1|1678123_1679680_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_010935667.1|1680045_1680732_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_010935668.1|1680731_1683362_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_010935669.1|1683363_1684323_+	type I-E CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	28.0	1.1e-09
WP_010935670.1|1684323_1684638_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_014302524.1|1686298_1686469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935671.1|1686527_1687043_+	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	65.9	4.4e-42
WP_010935673.1|1687761_1688439_+	hypothetical protein	NA	G1BSM8	Mycobacterium_virus	32.6	1.3e-09
WP_010935675.1|1688844_1689120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302528.1|1689275_1689425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014302529.1|1689421_1689562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010935677.1|1689582_1690392_-	SpaH fimbrial minor subunit SpaI	NA	NA	NA	NA	NA
WP_010935678.1|1690464_1691511_-	SpaH fimbrial biogenesis class C sortase SrtE	NA	NA	NA	NA	NA
WP_010935679.1|1691494_1692451_-	SpaH fimbrial biogenesis class C sortase SrtD	NA	NA	NA	NA	NA
WP_010935680.1|1692640_1694308_-	SpaH fimbrial major subunit SpaH	NA	NA	NA	NA	NA
WP_010935681.1|1694411_1698539_-	SpaH fimbrial tip protein SpaG	NA	NA	NA	NA	NA
WP_010935682.1|1698672_1698855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628064.1|1699199_1699364_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_021336177.1|1699438_1699666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004567371.1|1699794_1699953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010935684.1|1701230_1701602_+	SdpI family protein	NA	NA	NA	NA	NA
WP_010935685.1|1701700_1703221_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010935686.1|1703239_1703980_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.3	2.0e-16
WP_041628066.1|1703979_1705704_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_010935688.1|1705900_1707733_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010935689.1|1707745_1708573_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_010935690.1|1708602_1709862_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.6	4.5e-56
WP_042382035.1|1709959_1710733_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041628069.1|1710734_1711736_+	septum formation family protein	NA	NA	NA	NA	NA
WP_010935693.1|1711742_1712090_+	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_010935694.1|1712164_1713412_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041628071.1|1713397_1714024_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010935696.1|1714068_1714971_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_041628073.1|1715006_1716143_+	amidase	NA	NA	NA	NA	NA
WP_010935698.1|1716139_1716856_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP020410	Corynebacterium diphtheriae strain FDAARGOS_197 chromosome, complete genome	2489049	1994497	2057931	2489049	capsid,integrase,tail,portal,protease,head	Corynebacterium_phage(79.41%)	64	2019329:2019352	2058218:2058241
WP_010934063.1|1994497_1995418_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010934064.1|1995407_1996316_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010934065.1|1996336_1996774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934066.1|1996999_2000425_-	arabinosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041627741.1|2000417_2002418_-	arabinofuranosyltransferase	NA	NA	NA	NA	NA
WP_010934068.1|2002612_2003374_-	decaprenylphospho-beta-D-erythro-pentofuranosid- 2-ulose 2-reductase	NA	NA	NA	NA	NA
WP_003850144.1|2003393_2004860_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010934069.1|2004976_2005225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934070.1|2005253_2005688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934071.1|2005684_2006233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934072.1|2006244_2006664_+	GtrA family protein	NA	NA	NA	NA	NA
WP_010934073.1|2006873_2007653_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003850156.1|2007786_2008704_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010934074.1|2008877_2009843_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010934075.1|2009942_2010677_+	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.3	1.8e-09
WP_010934076.1|2010673_2011573_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010934077.1|2011569_2012421_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_041627743.1|2012505_2013543_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003850169.1|2013608_2014388_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	3.9e-10
WP_014307805.1|2014406_2015312_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010934080.1|2015402_2016596_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010934081.1|2016592_2017540_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010934082.1|2017896_2018931_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.8	5.4e-15
2019329:2019352	attL	CTCGAACTCAAGAACACGAAAACC	NA	NA	NA	NA
WP_010934083.1|2019695_2021270_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010934086.1|2022869_2024096_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	90.9	5.3e-219
WP_010934087.1|2024195_2025218_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010934088.1|2025229_2025793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934089.1|2025887_2026295_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JRC2	Corynebacterium_phage	99.3	1.7e-73
WP_010934091.1|2026908_2027151_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JRC7	Corynebacterium_phage	98.7	1.6e-34
WP_041627747.1|2027197_2027665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628108.1|2027748_2028129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010934094.1|2028211_2029030_+	phage antirepressor Ant	NA	A0A1W6JRI1	Corynebacterium_phage	89.4	1.5e-137
WP_003850203.1|2029049_2029250_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010934095.1|2029246_2029489_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	59.0	1.9e-19
WP_010934096.1|2029500_2029725_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	44.4	6.4e-06
WP_010934097.1|2029721_2029868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129060495.1|2029857_2030145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934103.1|2031420_2032629_+	hypothetical protein	NA	A0A220NQT1	Corynebacterium_phage	66.0	2.4e-131
WP_010934104.1|2032621_2033236_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	85.1	1.4e-90
WP_003850222.1|2033287_2033605_+	HNH endonuclease	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_003850225.1|2033757_2034102_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	50.5	3.5e-19
WP_003850227.1|2034091_2035693_+	hypothetical protein	NA	A0A1W6JRF6	Corynebacterium_phage	77.2	3.6e-159
WP_010934105.1|2035705_2036956_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	93.0	2.5e-224
WP_003850232.1|2036952_2037996_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	91.7	3.4e-182
WP_010934106.1|2037992_2039243_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	88.9	5.8e-205
WP_010934107.1|2039242_2039443_+	hypothetical protein	NA	A0A1W6JRE2	Corynebacterium_phage	63.6	6.7e-15
WP_003850235.1|2039464_2039947_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	93.8	1.6e-83
WP_010934108.1|2039943_2040306_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	93.3	3.6e-59
WP_003850237.1|2040298_2040565_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	94.3	1.5e-38
WP_010934110.1|2040554_2040932_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	88.0	1.1e-58
WP_010934111.1|2040960_2041908_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	83.8	4.3e-152
WP_010934112.1|2042005_2042383_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	91.2	2.7e-57
WP_010934113.1|2042544_2042754_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	88.4	9.1e-31
WP_010934114.1|2042766_2048409_+|tail	phage tail tape measure protein	tail	A0A1W6JRG1	Corynebacterium_phage	81.8	0.0e+00
WP_003850245.1|2048418_2049171_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	88.0	1.0e-127
WP_010934115.1|2049171_2050032_+	hypothetical protein	NA	Q37921	Corynephage	99.7	5.2e-165
WP_010934116.1|2050031_2051147_+	hypothetical protein	NA	Q37922	Corynephage	88.1	1.6e-150
WP_010934117.1|2051146_2052574_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	48.8	1.7e-43
WP_010934118.1|2052573_2053248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628116.1|2053991_2054768_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JY73	Gordonia_phage	54.1	9.8e-70
WP_010934120.1|2054770_2055094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934121.1|2055099_2055564_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	73.5	2.5e-57
WP_010934122.1|2055560_2055899_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	88.4	1.2e-48
WP_003850266.1|2056248_2057931_+	diphtheria toxin	NA	A7UH54	Corynephage	98.0	0.0e+00
2058218:2058241	attR	GGTTTTCGTGTTCTTGAGTTCGAG	NA	NA	NA	NA
