The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	710173	723365	4942246	transposase	Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772674.1|710173_711433_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	1.1e-73
WP_000095574.1|711487_712072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000543069.1|712071_712998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040092854.1|713415_713988_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	7.2e-94
WP_000638636.1|714061_714562_-	transactivation protein	NA	NA	NA	NA	NA
WP_080029801.1|714558_715293_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	2.2e-127
WP_001149160.1|715844_716111_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001670844.1|716107_716698_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001244665.1|716690_716978_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459316.1|716970_717426_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|717561_717882_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001016257.1|717970_718717_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|718731_720273_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_040092365.1|720482_722816_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_044815386.1|723170_723365_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
>prophage 2
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	1315646	1322786	4942246		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1315646_1316285_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1316281_1317544_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1317540_1318449_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1318644_1319412_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1319462_1320119_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|1320224_1322786_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	1394197	1401961	4942246	integrase,transposase	Escherichia_phage(66.67%)	6	1385432:1385445	1402271:1402284
1385432:1385445	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_112861249.1|1394197_1395359_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.5e-50
WP_000577245.1|1395511_1397230_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.8	2.7e-306
WP_000214990.1|1397231_1398980_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_024243136.1|1399051_1399468_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	99.3	7.3e-72
WP_001341819.1|1399506_1400736_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1401478_1401961_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1402271:1402284	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 4
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	1906428	1915869	4942246		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569327.1|1906428_1907355_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1907359_1908091_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1908071_1908179_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1908238_1908970_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1909191_1910877_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1910873_1911593_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|1911639_1912110_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_040092297.1|1912149_1912611_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001317947.1|1912735_1914736_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1914732_1915869_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	1928435	1995133	4942246	terminase,integrase,lysis,holin,portal,plate,head,capsid,transposase,tail,tRNA	Enterobacteria_phage(34.09%)	73	1955680:1955706	1990050:1990076
WP_001295427.1|1928435_1930469_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1930600_1931710_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001351454.1|1931972_1932254_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1932546_1933089_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|1933169_1933844_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_040092299.1|1933859_1936340_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|1936355_1937390_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1937471_1937810_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|1938028_1938853_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1938973_1939246_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195588.1|1939468_1940257_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822270.1|1940253_1941054_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001351455.1|1941118_1941937_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1941988_1942735_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|1942708_1943674_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846218.1|1943670_1944675_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_040092300.1|1944671_1945949_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1946205_1947258_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1947567_1948422_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_024243421.1|1948450_1949713_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_024243420.1|1949722_1950175_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|1950205_1950490_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_024243419.1|1950493_1951849_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844220.1|1951896_1952937_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1953036_1953816_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1953897_1954797_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1955202_1955520_+	hypothetical protein	NA	NA	NA	NA	NA
1955680:1955706	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1955785_1956799_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1956914_1957214_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_069915865.1|1957328_1957604_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	98.9	1.4e-47
WP_000217684.1|1957781_1958282_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557701.1|1958345_1958570_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277895.1|1958569_1958872_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
WP_001113264.1|1958871_1959096_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|1959092_1959368_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268583.1|1959357_1961670_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.8	0.0e+00
WP_000237502.1|1961724_1962972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069915864.1|1962958_1964779_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000038165.1|1965121_1966156_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_000156861.1|1966155_1967928_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_057780974.1|1968101_1968956_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	96.8	1.9e-130
WP_016242816.1|1969014_1970088_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	4.3e-201
WP_000203446.1|1970091_1970835_+|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	100.0	1.2e-122
WP_000988633.1|1970934_1971444_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1971443_1971647_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1971650_1971932_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1971931_1972429_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_069915863.1|1972443_1972869_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	1.1e-59
WP_069915862.1|1972856_1973282_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.0e-65
WP_000917189.1|1973389_1973857_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_069915861.1|1973849_1974302_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	3.1e-76
WP_069915860.1|1974368_1975004_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	4.2e-111
WP_001517504.1|1975000_1975348_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	3.8e-58
WP_001121478.1|1975352_1976261_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_020240769.1|1976253_1976784_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	1.5e-101
WP_001298859.1|1978607_1980149_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1980163_1980910_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001164090.1|1981596_1982124_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	6.2e-92
WP_069915891.1|1982513_1983047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286744.1|1983345_1984536_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_001251414.1|1984548_1985067_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	2.7e-92
WP_001031307.1|1985123_1985399_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1985431_1985551_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_069915892.1|1985543_1987991_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
WP_000978883.1|1988005_1988485_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	4.3e-84
WP_000882982.1|1988484_1989648_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000468308.1|1989729_1989948_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1990220_1991582_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1990050:1990076	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1991684_1991981_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1991982_1992279_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_023281352.1|1992487_1992820_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|1993010_1993733_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|1993729_1995133_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 6
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	2476492	2514517	4942246	terminase,integrase,lysis,head,capsid,tail	Escherichia_phage(28.12%)	53	2504756:2504769	2514823:2514836
WP_024245274.1|2476492_2478919_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	3.5e-214
WP_001295396.1|2479117_2479423_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2479530_2480241_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2480243_2480804_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2480838_2481180_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295394.1|2481844_2483059_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836082.1|2483070_2484090_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|2484147_2484276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040092553.1|2484277_2485558_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001296941.1|2485592_2485829_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_040092551.1|2485916_2488388_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2488481_2488673_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2488669_2488858_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2489257_2489422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2489425_2489644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2489803_2489959_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_040089727.1|2490125_2490533_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2490616_2490847_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705355.1|2490830_2491352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2491332_2492298_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2492338_2492761_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001374839.1|2492757_2493114_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_000955176.1|2494420_2494603_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
WP_001317460.1|2496558_2496891_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|2497093_2497399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2497423_2497663_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2497662_2497950_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2498021_2498177_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2498393_2498645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2498711_2498990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2498991_2500041_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2500054_2500807_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2501084_2501174_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2501228_2501441_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2501741_2501957_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2502710_2502926_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2502930_2503242_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2503238_2503772_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2503768_2504266_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2504629_2504842_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
2504756:2504769	attL	AAAACATTAACTGA	NA	NA	NA	NA
WP_071524604.1|2504852_2505041_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2505043_2505109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2505188_2505344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2505515_2505689_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2505840_2506251_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2506308_2506542_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2506930_2507476_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027295.1|2507450_2509376_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|2509372_2509579_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_080029809.1|2511156_2512476_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001358225.1|2512485_2512818_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_001365132.1|2512879_2513149_+|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_024046419.1|2513281_2514517_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.2	2.2e-100
2514823:2514836	attR	AAAACATTAACTGA	NA	NA	NA	NA
>prophage 7
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	2520416	2547476	4942246	head,tail,capsid,transposase	Enterobacteria_phage(41.67%)	30	NA	NA
WP_040092230.1|2520416_2521457_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.6	5.7e-65
WP_000190778.1|2521466_2521808_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179421.1|2521819_2522203_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071780743.1|2522195_2522411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496061.1|2522628_2522871_+	hypothetical protein	NA	K7PM97	Enterobacterial_phage	46.3	2.3e-09
WP_000918608.1|2522966_2523653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021540094.1|2523845_2524133_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_001469996.1|2524375_2525140_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	97.6	1.1e-137
WP_000158875.1|2525181_2525577_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2525588_2525942_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2525953_2526532_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683128.1|2526528_2526924_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001543784.1|2526931_2527672_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_085947772.1|2527959_2529172_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_077904247.1|2529197_2529371_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.7	8.9e-24
WP_000459457.1|2529352_2529787_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840337.1|2529779_2532359_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_000847331.1|2532355_2532685_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152624.1|2532684_2533383_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|2533388_2534132_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2534068_2534701_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_080029810.1|2534761_2538241_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001568881.1|2538308_2538908_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
WP_072024347.1|2538972_2542044_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_040093009.1|2542043_2542619_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_000086527.1|2542716_2543307_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2543623_2543857_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2543925_2544039_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_040093007.1|2544643_2545927_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527756.1|2546015_2547476_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
>prophage 8
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	2743277	2803817	4942246	terminase,integrase,lysis,tail,tRNA	Escherichia_phage(46.15%)	66	2740988:2741003	2802978:2802993
2740988:2741003	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837924.1|2743277_2744411_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2744551_2744986_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286867.1|2745570_2746485_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983721.1|2746484_2747312_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2747308_2748166_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_080029814.1|2748162_2748999_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_021558792.1|2749232_2749817_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_080029815.1|2749816_2753215_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_032250472.1|2753279_2753879_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	4.8e-109
WP_080029816.1|2753949_2757447_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_021514630.1|2757507_2758155_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_077580620.1|2758052_2758796_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_016232668.1|2758800_2759499_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	8.4e-129
WP_000024051.1|2759498_2759837_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_033866456.1|2759829_2763063_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.1e-112
WP_012565075.1|2763536_2763896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2764046_2765009_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2765035_2765428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033865388.1|2765424_2765805_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524259.1|2765805_2766189_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
WP_021552292.1|2766188_2766584_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.0	2.2e-09
WP_000918483.1|2766806_2767946_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_021552291.1|2768044_2768809_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	65.0	6.2e-85
WP_024181861.1|2768913_2770026_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	2.7e-113
WP_000763706.1|2770009_2771416_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	1.4e-186
WP_000625349.1|2771418_2772720_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
WP_080029817.1|2772700_2773795_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_000126788.1|2773798_2774008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204031.1|2773985_2774918_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_016232661.1|2774910_2775702_-	phage protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_001097895.1|2775839_2777297_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2777493_2777679_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135310.1|2777895_2778393_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|2778392_2778608_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_080029857.1|2778859_2779234_-	tolA family protein	NA	NA	NA	NA	NA
WP_000506936.1|2779405_2779834_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_053000474.1|2780878_2781421_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	7.5e-77
WP_000228023.1|2781417_2781708_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	3.3e-47
WP_080029818.1|2781707_2782307_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.3e-106
WP_001586998.1|2782769_2782982_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	59.7	1.9e-12
WP_001586997.1|2783254_2784313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046788432.1|2784284_2785718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586995.1|2785748_2786267_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	57.4	5.8e-34
WP_001586994.1|2786427_2786850_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	82.7	6.7e-57
WP_061348540.1|2786866_2787628_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	2.3e-119
WP_000788970.1|2787650_2788397_-	Rac prophage; DNA replication protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2788403_2789261_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2789273_2789696_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2789718_2790015_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2790138_2790615_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|2790923_2791058_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2791068_2791224_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2791220_2791709_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2792150_2792372_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2792371_2792542_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2792616_2792892_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_080029819.1|2792993_2795594_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	5.1e-248
WP_000166319.1|2795586_2796396_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2796452_2796647_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_032234345.1|2796639_2796849_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	3.0e-26
WP_000079604.1|2796927_2797143_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2797144_2798380_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|2798431_2799367_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123785.1|2799495_2800869_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2801346_2802330_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2802584_2803817_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2802978:2802993	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 9
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	3103856	3196911	4942246	terminase,integrase,lysis,holin,protease,head,transposase,tail	Enterobacteria_phage(40.58%)	103	3129150:3129165	3196583:3196598
WP_155120809.1|3103856_3105018_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	8.9e-51
WP_000409883.1|3105059_3106418_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_040092733.1|3107004_3109428_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024245154.1|3109436_3111455_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_072039439.1|3111447_3112773_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|3112774_3113188_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001307105.1|3113237_3114161_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199172.1|3114644_3115916_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|3115921_3117049_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3117106_3117937_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|3118479_3119988_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_001299828.1|3120409_3124372_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295606.1|3124411_3125050_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001345642.1|3125337_3126429_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001345643.1|3126428_3127121_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|3127132_3127519_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_024175282.1|3127526_3128327_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001190.1|3128336_3128927_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3128937_3129432_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
3129150:3129165	attL	AAATACACTTAGCGCC	NA	NA	NA	NA
WP_001379667.1|3129452_3130781_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	6.9e-233
WP_001273658.1|3130863_3131037_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|3131409_3132006_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3132026_3132254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040092256.1|3132291_3133533_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000787869.1|3133825_3134074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535358.1|3134191_3135082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420617.1|3135342_3136263_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|3136262_3136568_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_040092254.1|3136660_3137260_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062104.1|3137256_3139803_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|3139802_3140975_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3141104_3141797_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|3141769_3142798_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121567.1|3143275_3143929_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001002867.1|3143941_3144640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|3144840_3145422_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|3145412_3145607_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|3145551_3146094_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023455.1|3146315_3146585_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000279086.1|3146586_3147900_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001230450.1|3147964_3148564_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_000515383.1|3148631_3152027_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_000090913.1|3152087_3152690_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_000194779.1|3152626_3153370_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_033812398.1|3153375_3154074_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	3.6e-132
WP_000847379.1|3154073_3154403_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_080029823.1|3158557_3158953_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.1e-69
WP_000753019.1|3159538_3159892_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_040092234.1|3161422_3161755_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	1.2e-53
WP_000123311.1|3161764_3163084_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
WP_000198149.1|3164663_3164870_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_062871792.1|3164866_3166792_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3166766_3167312_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001443307.1|3167700_3167895_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_000881324.1|3168082_3168700_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	1.5e-92
WP_001299305.1|3168849_3169287_-|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	93.8	6.7e-68
WP_001135302.1|3169283_3169781_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000284515.1|3169780_3169996_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|3170138_3170537_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3170617_3170776_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3170861_3171605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3171857_3172481_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028835.1|3172477_3173143_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	2.9e-131
WP_001223930.1|3173139_3173742_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001108084.1|3173716_3174283_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000612803.1|3174858_3176631_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_024182502.1|3177134_3177317_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	95.0	1.8e-27
WP_000814619.1|3177313_3177724_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	1.8e-70
WP_000344548.1|3177923_3178244_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.7	1.4e-35
WP_000229806.1|3178261_3178468_-	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000145931.1|3178540_3178831_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788878.1|3178827_3179529_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185469.1|3179525_3180425_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	2.3e-171
WP_000195204.1|3180457_3180754_-	Regulatory protein CII from phage origin	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	1.5e-47
WP_001180318.1|3180860_3181088_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250469.1|3181166_3181874_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_040093238.1|3181971_3182514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528775.1|3182501_3183278_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001434513.1|3183721_3184057_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	64.9	5.0e-31
WP_071533307.1|3184135_3184315_+	restriction endonuclease	NA	M1FQU1	Enterobacteria_phage	98.3	4.3e-29
WP_000065374.1|3184518_3184887_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|3184959_3185124_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_001371715.1|3185092_3185257_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	7.1e-23
WP_000995439.1|3185310_3185607_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100844.1|3185612_3186398_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186784.1|3186394_3187075_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000149544.1|3187071_3187254_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3187226_3187418_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|3187428_3187710_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|3187808_3188030_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|3188026_3188434_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582233.1|3188435_3189191_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	3.2e-142
WP_000208001.1|3189201_3189990_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.6	3.3e-49
WP_001277762.1|3190086_3190266_+	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
WP_001281197.1|3190368_3190713_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|3190830_3191049_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|3191026_3192100_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_072039424.1|3192194_3194939_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	4.6e-37
WP_000818472.1|3195010_3196084_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3196131_3196305_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_032226876.1|3196294_3196525_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3196499_3196688_-	cold-shock protein	NA	NA	NA	NA	NA
3196583:3196598	attR	AAATACACTTAGCGCC	NA	NA	NA	NA
WP_000066490.1|3196698_3196911_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 10
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	3307051	3393566	4942246	terminase,integrase,lysis,protease,portal,plate,head,capsid,tail,tRNA	Salmonella_phage(56.9%)	93	3300013:3300028	3396137:3396152
3300013:3300028	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3307051_3308344_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3308434_3309778_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3309788_3310400_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_024243448.1|3310554_3314661_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3314795_3315290_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3315833_3316799_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_024243447.1|3316921_3318688_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3318688_3320410_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3320451_3321156_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3321440_3321659_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3322343_3324620_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3324650_3324971_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3325293_3325518_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3325590_3327537_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3327533_3328649_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|3328799_3329756_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_024245416.1|3329752_3331411_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3331836_3332532_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3332988_3333888_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3334031_3335684_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3335695_3336664_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_040092250.1|3336796_3338515_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	3.1e-31
WP_000566372.1|3338551_3339553_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3339563_3340994_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3341092_3342106_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024243854.1|3342102_3342933_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|3342929_3343253_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3343378_3343894_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3344111_3344840_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3344857_3345589_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3345595_3346312_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3346311_3346980_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3347270_3348002_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3348176_3349304_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3349344_3349833_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3349892_3350738_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|3350734_3351688_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996017.1|3351697_3352831_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|3352925_3354038_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3354388_3354865_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_040092251.1|3354952_3355855_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	1.5e-37
WP_000189162.1|3355915_3356638_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3356621_3356909_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3357068_3357326_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681112.1|3357355_3357733_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3358002_3359688_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|3359923_3360142_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001420863.1|3360232_3361333_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	6.5e-176
WP_080029824.1|3361329_3361815_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_080029825.1|3361811_3364889_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3364881_3365001_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3365015_3365318_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3365372_3365888_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|3365897_3367070_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905010.1|3367212_3367779_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_080029826.1|3367809_3368220_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	1.3e-65
WP_001008234.1|3368240_3368684_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_080029827.1|3368655_3369258_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	2.0e-99
WP_080029828.1|3369257_3370805_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.0	1.4e-197
WP_001086824.1|3370801_3371407_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000268280.1|3371399_3372308_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|3372294_3372654_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|3372650_3373229_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829157.1|3373297_3373744_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_001039949.1|3373736_3374168_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
WP_080029829.1|3374263_3374692_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	2.9e-47
WP_000727850.1|3374688_3375066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137550543.1|3375067_3375541_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	3.1e-79
WP_000171568.1|3375560_3375776_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3375779_3375983_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3375982_3376447_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3376542_3377193_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|3377196_3378255_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216903.1|3378271_3379105_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	2.4e-122
WP_080029832.1|3379247_3381014_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520351.1|3381013_3382060_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	4.9e-173
WP_077249005.1|3382085_3383840_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115044.1|3384062_3384479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020716.1|3384471_3384735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000764102.1|3384737_3385631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217573.1|3385767_3386001_-	DinI family protein	NA	E5G6M1	Salmonella_phage	97.4	2.3e-35
WP_001154434.1|3386011_3386200_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_080029833.1|3386353_3388768_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_080029834.1|3388764_3389622_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	3.1e-157
WP_000752613.1|3389618_3389846_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3389845_3390079_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001504055.1|3390146_3390488_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_000956182.1|3390451_3390652_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|3390659_3391169_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3391201_3391423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|3391548_3392118_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|3392133_3392325_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001593237.1|3392513_3393566_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3396137:3396152	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 11
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	3473402	3525582	4942246	terminase,integrase,lysis,holin,protease,portal,head,capsid,tail	Enterobacteria_phage(42.19%)	74	3504184:3504199	3526793:3526808
WP_024243846.1|3473402_3474692_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	7.7e-19
WP_000767389.1|3474750_3475227_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|3475730_3476384_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|3476396_3476618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3476701_3477082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|3477282_3477858_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_021351651.1|3478301_3478673_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652080.1|3478776_3479625_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_000950982.1|3479848_3480730_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|3480835_3481105_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_080029835.1|3481106_3482420_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	99.1	1.3e-77
WP_001230450.1|3482484_3483084_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_080029836.1|3483151_3486628_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_137519761.1|3486863_3487496_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.3	7.1e-103
WP_000194790.1|3487441_3488185_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_080029838.1|3488190_3488889_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.8	3.1e-131
WP_000847306.1|3488888_3489218_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_080029839.1|3489214_3491794_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.8	0.0e+00
WP_000533403.1|3491774_3492188_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|3492214_3492646_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001143019.1|3492659_3493412_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683084.1|3493419_3493815_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	84.0	2.3e-59
WP_000974985.1|3493811_3494345_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204554.1|3494360_3494714_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_001299692.1|3494706_3495090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040092825.1|3495141_3496170_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_000256723.1|3496227_3496575_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253992.1|3496611_3498117_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	4.6e-100
WP_000831794.1|3498106_3499699_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000259002.1|3499695_3499902_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040092826.1|3499885_3501814_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	4.6e-262
WP_000235436.1|3501785_3502295_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|3502689_3502884_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|3503071_3503689_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092318.1|3503838_3504276_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
3504184:3504199	attL	GATGGCGTTATCACGG	NA	NA	NA	NA
WP_052512571.1|3504332_3504770_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	3.8e-79
WP_000411802.1|3504769_3504976_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023271.1|3505423_3507274_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024245216.1|3507572_3507731_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_137558987.1|3507816_3508560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3508744_3509434_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3509448_3509571_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3509908_3510868_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_024238680.1|3511079_3511745_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	4.7e-129
WP_001569612.1|3511741_3512362_-	recombination protein NinG	NA	Q716C3	Shigella_phage	94.2	7.0e-95
WP_000567000.1|3512354_3512525_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3512521_3512704_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3512700_3513141_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145926.1|3513214_3513505_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788871.1|3513501_3514203_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_001473331.1|3514199_3515099_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.3	9.3e-173
WP_000442609.1|3515131_3515428_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|3515569_3515785_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|3515858_3516554_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_000968517.1|3517146_3517899_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|3518175_3518358_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|3518335_3518608_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_001066173.1|3518624_3519206_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_000213978.1|3519419_3519620_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	95.5	2.5e-30
WP_000065381.1|3519802_3520171_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	5.9e-65
WP_001198860.1|3520243_3520408_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372924.1|3520376_3520520_+	host cell division inhibitory peptide Kil	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|3520595_3520892_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3520897_3521683_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_024243933.1|3521679_3522357_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.3e-130
WP_000682316.1|3522353_3522536_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3522508_3522700_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_077815297.1|3522710_3522992_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	3.6e-46
WP_024238365.1|3523090_3523312_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_024238366.1|3523311_3523596_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	91.5	2.6e-44
WP_000545733.1|3523668_3523836_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|3523864_3524209_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|3524315_3524534_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|3524511_3525582_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
3526793:3526808	attR	CCGTGATAACGCCATC	NA	NA	NA	NA
>prophage 12
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	3743098	3799821	4942246	terminase,integrase,lysis,protease,portal,head,capsid,transposase,tail	Enterobacteria_phage(68.42%)	68	3740810:3740826	3800340:3800356
3740810:3740826	attL	GAAGGTAAAACCGTCTG	NA	NA	NA	NA
WP_000420934.1|3743098_3744235_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|3744503_3746741_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3746727_3749700_+	phage receptor	NA	NA	NA	NA	NA
WP_001224569.1|3749700_3750591_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3750773_3751535_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001201825.1|3752047_3753001_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|3753187_3754672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3754855_3755161_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_072039443.1|3755225_3755885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885574.1|3755939_3756524_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_080029841.1|3756523_3759919_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230375.1|3759983_3760583_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_080029842.1|3760649_3764048_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_000090891.1|3764108_3764741_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|3764677_3765421_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_080029843.1|3765426_3766125_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847345.1|3766124_3766454_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_080029844.1|3766450_3769012_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.6	0.0e+00
WP_000459457.1|3769004_3769439_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3769420_3769843_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3769858_3770599_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3770606_3771002_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|3770998_3771577_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753019.1|3771588_3771942_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_032318908.1|3771953_3772349_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.9e-53
WP_024232991.1|3772390_3773416_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	7.6e-187
WP_040092234.1|3773471_3773804_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	1.2e-53
WP_001529148.1|3775112_3776714_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000198149.1|3776710_3776917_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_024221415.1|3776913_3778839_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_080029845.1|3778813_3779359_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	6.2e-95
WP_001307652.1|3779747_3779942_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_016232484.1|3780192_3780399_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	94.1	9.3e-28
WP_001403557.1|3780684_3781095_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
WP_000738492.1|3781385_3781679_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_001228695.1|3781769_3781952_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075162.1|3782168_3782666_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_000839596.1|3782665_3782881_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|3783454_3784552_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204791.1|3784741_3785125_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971095.1|3785210_3785351_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001099521.1|3785347_3785710_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_000774498.1|3785706_3785997_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	6.7e-48
WP_000224914.1|3785989_3786160_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053009.1|3786159_3786615_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072142085.1|3786611_3786713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3786805_3787258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3787254_3787815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3788300_3788594_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001734999.1|3788590_3789292_-	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	97.4	1.2e-127
WP_016232481.1|3789288_3790218_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	1.6e-111
WP_001182866.1|3790304_3790844_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	6.8e-62
WP_000184665.1|3790874_3791102_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|3791212_3791905_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_040092959.1|3791986_3792451_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	60.9	1.5e-49
WP_112861249.1|3792497_3793659_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.5e-50
WP_001288169.1|3793717_3794650_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_000233576.1|3795134_3795341_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995441.1|3795416_3795713_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
WP_000100847.1|3795718_3796504_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3796500_3797181_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3797177_3797360_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3797332_3797524_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3797534_3797816_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3797914_3798133_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3798180_3798459_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3798430_3798802_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|3798657_3799821_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
3800340:3800356	attR	CAGACGGTTTTACCTTC	NA	NA	NA	NA
>prophage 13
NZ_CP020107	Escherichia coli strain 13E0767 chromosome, complete genome	4942246	4121001	4180633	4942246	integrase,plate,transposase	Enterobacteria_phage(25.0%)	50	4118829:4118846	4183006:4183023
4118829:4118846	attL	TCAATTGTTTCAGCATCA	NA	NA	NA	NA
WP_000772656.1|4121001_4122210_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
WP_000893278.1|4122563_4123817_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|4123828_4124932_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749879.1|4125219_4126275_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_000174677.1|4126313_4126715_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4126772_4128017_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4128108_4128567_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|4128827_4130285_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4130341_4130956_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001316884.1|4130952_4132119_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
WP_072039437.1|4132337_4132790_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|4132786_4133842_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001408335.1|4133912_4134683_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001306917.1|4134642_4136382_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|4136486_4136765_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4136757_4137114_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543897.1|4137170_4137944_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
WP_000729704.1|4138129_4138390_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615982.1|4138392_4138671_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4138826_4139567_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4139537_4140305_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4140510_4141089_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4141328_4143773_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4143815_4144289_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118037.1|4144442_4145210_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|4147880_4148066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939263.1|4147980_4148463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080029852.1|4148446_4152685_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	1.3e-22
WP_000103319.1|4152760_4154902_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4155111_4155630_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|4156325_4156826_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4156860_4157085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|4157135_4158611_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|4158617_4159031_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4159034_4160885_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024243485.1|4160848_4161931_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4161955_4163236_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4163232_4163757_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246424.1|4163759_4165091_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024245316.1|4165095_4165857_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069915887.1|4165865_4168655_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	5.2e-81
WP_040092921.1|4168651_4169395_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|4169399_4170812_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_137519763.1|4170920_4174355_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_040092917.1|4174365_4175718_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4175741_4176224_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|4176267_4177182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236643.1|4177191_4177671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|4178330_4179077_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4179091_4180633_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
4183006:4183023	attR	TCAATTGTTTCAGCATCA	NA	NA	NA	NA
