The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	814379	860373	5371291	transposase,tRNA,protease,integrase	Escherichia_phage(18.75%)	44	805195:805210	846035:846050
805195:805210	attL	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000450589.1|814379_814712_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|814753_816244_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|816550_818071_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|818224_818848_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065896.1|819124_819889_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_024226841.1|820185_821502_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.4	3.9e-34
WP_080029394.1|821631_822228_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.9	7.7e-99
WP_105466968.1|823543_824756_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_028913479.1|826338_826944_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|826991_827243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047088714.1|827266_827557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|828242_828602_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591995.1|828694_830314_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_106904303.1|830504_831718_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_000134927.1|831851_832127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029785359.1|832507_833287_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|833296_833599_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|833607_833928_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|833920_835624_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_032314756.1|835633_836098_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|836098_836773_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_032314755.1|836784_837402_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|838613_838877_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|839178_839319_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_032314754.1|840189_840861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435660.1|843198_843624_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|843620_843971_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_080029395.1|844001_845615_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.9	4.0e-166
WP_000957249.1|846518_846899_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
846035:846050	attR	CGACCTGTGCCGGAAT	NA	NA	NA	NA
WP_000042916.1|846885_847215_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|847475_847943_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|847960_849169_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_032314753.1|849179_850136_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|850135_851215_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|851216_851990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|851982_853125_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|853134_854193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|854515_855097_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|855096_856254_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|856276_856732_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|856754_857795_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|857843_858422_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|858490_859066_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001358663.1|859176_860373_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	1439297	1498638	5371291	holin,head,tail,tRNA,terminase,transposase,integrase	Salmonella_phage(47.83%)	72	1443444:1443462	1508893:1508911
WP_000997403.1|1439297_1440335_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1440382_1441072_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1441376_1441760_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1441815_1442403_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001443508.1|1442505_1443387_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1443444:1443462	attL	ATGCCGGATGCGGCGTGAA	NA	NA	NA	NA
WP_000399648.1|1443623_1444604_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000219193.1|1444874_1446209_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|1446340_1447078_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_064482903.1|1447062_1448685_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|1448940_1449096_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|1449092_1449668_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|1449700_1450351_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|1450350_1451307_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589068.1|1451303_1451783_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|1451980_1453780_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1453795_1454770_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1455042_1455723_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020739.1|1455719_1456625_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|1456636_1457365_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|1457376_1458108_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|1458107_1458488_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|1458908_1458989_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000054752.1|1459182_1459443_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001138334.1|1459657_1461055_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291430.1|1461051_1461252_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314214.1|1461248_1462643_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	4.9e-213
WP_032314215.1|1462686_1463493_-	DNA-binding protein	NA	B1GS65	Salmonella_phage	54.8	7.4e-20
WP_000043908.1|1463845_1464175_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001382380.1|1464143_1464320_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000312948.1|1464316_1464586_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	1.5e-25
WP_000637724.1|1464575_1464875_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_032314216.1|1464871_1465087_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032314217.1|1465092_1467156_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	3.9e-275
WP_032314218.1|1467182_1467782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314219.1|1467808_1468357_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.0e-65
WP_032314220.1|1468372_1469674_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	2.3e-132
WP_021580224.1|1469676_1470579_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000606440.1|1471358_1472051_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_000708850.1|1472164_1472347_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314221.1|1472339_1474526_+	replication protein	NA	B6SCY1	Bacteriophage	72.9	4.9e-175
WP_032314222.1|1474812_1475247_+	antitermination protein Q	NA	B6SD39	Bacteriophage	62.9	1.1e-41
WP_000781776.1|1475650_1475992_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194117.1|1475995_1476472_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	1.0e-85
WP_000779566.1|1476455_1476980_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|1477041_1477614_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|1477616_1479239_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_032314223.1|1479238_1480705_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.6	2.5e-260
WP_136759112.1|1480595_1481330_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_032314224.1|1481344_1482565_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.3	4.0e-203
WP_021580222.1|1482568_1483075_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	6.4e-70
WP_032314225.1|1483086_1484028_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_001107515.1|1484069_1484291_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001125663.1|1484256_1484664_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	2.5e-69
WP_000008729.1|1484660_1485215_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	2.0e-80
WP_032314226.1|1485201_1485591_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000503647.1|1485565_1486129_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_023565717.1|1486132_1487278_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.8e-160
WP_000109249.1|1487288_1487729_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032314228.1|1487732_1488185_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_032314230.1|1488362_1490351_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.3	3.7e-270
WP_001420197.1|1490350_1490938_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155113.1|1490937_1491240_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	4.1e-48
WP_032314231.1|1491242_1492304_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	4.5e-158
WP_032314234.1|1492307_1492649_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.3	1.8e-31
WP_032314235.1|1492785_1493517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314236.1|1493516_1493939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314237.1|1494002_1494755_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	1.6e-88
WP_001270636.1|1494754_1495108_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_032314238.1|1495107_1496307_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	83.4	4.9e-185
WP_032314239.1|1496303_1496984_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	1.0e-102
WP_033816086.1|1496983_1498060_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	66.3	3.8e-64
WP_033816087.1|1498059_1498638_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.3e-95
1508893:1508911	attR	TTCACGCCGCATCCGGCAT	NA	NA	NA	NA
>prophage 3
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	1565951	1611952	5371291	tail,integrase,terminase,holin	Escherichia_phage(64.81%)	55	1569050:1569066	1610286:1610302
WP_001299507.1|1565951_1567418_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_032314249.1|1567486_1569064_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1569050:1569066	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_032314250.1|1569256_1570513_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	4.4e-237
WP_001055435.1|1570515_1571175_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_032314251.1|1571171_1571822_-	adenine methylase	NA	G9L699	Escherichia_phage	96.3	3.4e-124
WP_001335975.1|1571814_1572066_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1572223_1572472_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_032314252.1|1572521_1573403_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.3	4.9e-158
WP_032314253.1|1573399_1574221_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.5	1.8e-162
WP_032314254.1|1574217_1574517_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	1.3e-46
WP_000836290.1|1574825_1575410_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1575564_1575795_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_080029403.1|1576161_1576953_+	primosomal protein	NA	Q286X4	Escherichia_phage	90.9	4.9e-117
WP_001066741.1|1576949_1577735_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_001231252.1|1577852_1578197_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	4.8e-61
WP_032314256.1|1578925_1579243_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.9	9.9e-45
WP_032314257.1|1579229_1579817_+	ead/Ea22-like family protein	NA	A0A0P0ZBW5	Stx2-converting_phage	60.7	1.0e-39
WP_032314258.1|1579818_1580385_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	90.7	1.1e-35
WP_020231265.1|1580384_1580669_+	DUF4752 family protein	NA	G9L657	Escherichia_phage	97.9	1.0e-48
WP_032314260.1|1580661_1580943_+	RNA-binding protein	NA	A0A2I6PID8	Escherichia_phage	94.6	1.8e-45
WP_032314261.1|1580935_1581274_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	97.3	3.5e-56
WP_001124396.1|1581291_1581504_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001090120.1|1581500_1582175_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_032314262.1|1582171_1583647_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	3.2e-295
WP_032314263.1|1583737_1584109_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	7.7e-57
WP_000335899.1|1584811_1585018_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_032314264.1|1585032_1586712_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.1e-302
WP_000133160.1|1586708_1587005_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001546923.1|1587007_1587703_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000268715.1|1587717_1588704_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_032314265.1|1588755_1589193_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	96.6	5.9e-72
WP_000012377.1|1589203_1589539_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424495.1|1589589_1589913_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_032314266.1|1589912_1590518_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	3.6e-112
WP_080029404.1|1590517_1592989_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_080029405.1|1592988_1593453_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	2.7e-83
WP_080029406.1|1593452_1594028_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	74.7	4.0e-60
WP_080029407.1|1594027_1596745_+	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	99.6	0.0e+00
WP_080029408.1|1596744_1599759_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	99.4	0.0e+00
WP_046123177.1|1599770_1600334_-	hypothetical protein	NA	G9L6D5	Escherichia_phage	98.4	8.0e-98
WP_000085730.1|1600424_1600856_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	100.0	1.6e-58
WP_001167931.1|1600976_1601144_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	100.0	2.3e-24
WP_080029409.1|1601216_1602161_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	94.9	4.0e-174
WP_000708858.1|1602233_1602395_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001544814.1|1602487_1603033_-	hypothetical protein	NA	G9L6E0	Escherichia_phage	98.9	2.6e-101
WP_032314274.1|1603334_1604045_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	79.8	2.0e-101
WP_032314276.1|1604360_1604618_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	2.4e-41
WP_032314277.1|1607066_1608185_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	28.9	2.7e-28
WP_032314278.1|1608377_1608782_+	membrane protein	NA	G9L6E6	Escherichia_phage	89.5	6.4e-57
WP_032314279.1|1608768_1609077_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	92.2	3.9e-46
WP_032314280.1|1609066_1609696_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.2	9.9e-113
WP_032314281.1|1609692_1610175_+	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	96.2	3.3e-76
WP_000755173.1|1610394_1610934_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
1610286:1610302	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000669402.1|1610949_1611465_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1611778_1611952_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 4
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	1991689	2070642	5371291	holin,capsid,head,tail,tRNA,protease,terminase,integrase	Stx2-converting_phage(43.37%)	91	1994164:1994184	2050009:2050029
WP_000569361.1|1991689_1992616_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1992620_1993352_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1993332_1993440_-	protein YohO	NA	NA	NA	NA	NA
WP_042101647.1|1993499_1994186_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
1994164:1994184	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063636.1|1994221_1995508_-|integrase	site-specific integrase	integrase	Q6HA01	Enterobacteria_phage	100.0	1.2e-253
WP_001193437.1|1995541_1995796_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_015971130.1|1995952_1996195_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	100.0	1.2e-37
WP_000206819.1|1996282_1996873_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	100.0	4.3e-118
WP_001014300.1|1996875_1997067_-	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
WP_015971131.1|1997068_1997839_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	100.0	1.5e-142
WP_000763383.1|1997835_1998057_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447493.1|1998155_1998437_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|1998447_1998639_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|1998611_1998794_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000186851.1|1998790_1999471_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_015971133.1|1999467_2000253_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	100.0	4.8e-149
WP_000995439.1|2000258_2000555_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|2000630_2000774_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|2000742_2000907_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|2000979_2001348_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000167595.1|2001498_2001969_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001479835.1|2002027_2002411_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000687675.1|2002882_2003287_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_080029412.1|2003283_2003940_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	99.5	2.9e-115
WP_000866443.1|2003936_2004224_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|2004360_2005065_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|2005178_2005412_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_080029413.1|2005550_2005847_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	99.0	3.4e-47
WP_000185456.1|2005879_2006818_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788839.1|2006814_2007516_+	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_000145935.1|2007512_2007803_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000127.1|2007873_2008152_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103676.1|2008283_2008499_+	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001281772.1|2008509_2008746_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814575.1|2008702_2009149_+	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_000153288.1|2009145_2009673_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000335901.1|2009854_2010904_+	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	100.0	1.7e-181
WP_001004020.1|2011055_2011778_+	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107963.1|2011777_2012383_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|2012379_2012574_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|2012566_2013001_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|2013507_2014455_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|2014464_2014734_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_080029414.1|2015233_2017171_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.8	0.0e+00
WP_000143462.1|2017306_2017486_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|2017526_2017799_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|2017875_2018091_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|2018095_2018440_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_080029415.1|2018490_2019024_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_001056806.1|2019294_2019864_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2019863_2020010_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2020237_2020423_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2020847_2021075_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2021116_2021482_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|2021772_2022336_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001368653.1|2022332_2023994_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000173079.1|2024057_2025995_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|2026039_2026261_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2028787_2029114_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007889.1|2029124_2029475_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573374.1|2029471_2029918_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2029914_2030259_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_045892104.1|2030317_2031034_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	8.6e-129
WP_001030063.1|2031039_2031414_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2031509_2031719_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_080029416.1|2031770_2035013_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
WP_080029417.1|2035005_2035347_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	99.1	1.9e-62
WP_001357740.1|2035346_2036045_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_001302649.1|2036061_2036382_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2036489_2036663_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_033803895.1|2036733_2037657_+	antirepressor	NA	A0A0N7KZK0	Stx2-converting_phage	98.4	4.6e-175
WP_080029418.1|2037711_2038449_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	94.7	8.2e-143
WP_123003314.1|2038394_2039027_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.1	1.2e-105
WP_080029420.1|2039273_2042750_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_024201786.1|2042816_2043416_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	4.5e-107
WP_080029421.1|2043475_2044792_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.6e-80
WP_032314671.1|2044793_2045063_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_080029422.1|2046127_2047447_-	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	86.9	1.1e-219
WP_001373888.1|2048100_2049357_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	99.8	3.8e-241
WP_001261971.1|2049512_2049761_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_001295431.1|2050297_2051983_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2050009:2050029	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|2051979_2052699_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2052745_2053216_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2053256_2053718_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001443371.1|2053842_2055843_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001294362.1|2056967_2059247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314683.1|2059257_2060346_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636944.1|2060652_2060970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314684.1|2061031_2064664_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_032314685.1|2064673_2068468_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|2068608_2070642_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 5
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	2215235	2304262	5371291	holin,capsid,head,tail,terminase,portal,transposase,integrase	Escherichia_phage(40.62%)	102	2199739:2199756	2250882:2250899
2199739:2199756	attL	TTGCAGGCGCTTTCGCAC	NA	NA	NA	NA
WP_106904303.1|2215235_2216448_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001300307.1|2219727_2220525_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_032314802.1|2220760_2221786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	7.5e-102
WP_000096346.1|2221785_2221989_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001090200.1|2224612_2224804_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2224800_2224989_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|2225559_2225769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|2225769_2226408_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|2226419_2226572_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|2226838_2227258_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|2227357_2227639_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|2227622_2228048_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262348.1|2228119_2229202_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|2229208_2229955_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|2229976_2230693_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|2230725_2231007_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|2231003_2231231_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|2231223_2231535_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|2231662_2231881_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2231882_2232440_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2232673_2232886_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2233005_2233350_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2233471_2233744_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2233745_2234795_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|2234807_2235167_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|2235175_2235730_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2235954_2236152_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2236287_2237001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2237451_2237883_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|2238232_2238376_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_080029427.1|2238361_2240299_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.4	0.0e+00
WP_000143464.1|2240434_2240614_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|2240654_2240927_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|2241003_2241219_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001092860.1|2241781_2242315_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_045904330.1|2242585_2243155_+	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000539795.1|2243154_2243301_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2243523_2243709_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2244234_2244549_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2244630_2244855_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_033816199.1|2245240_2245786_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027269.1|2245760_2247686_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2247682_2247889_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_033816198.1|2247885_2249487_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123236.1|2249467_2250787_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|2250796_2251129_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
2250882:2250899	attR	GTGCGAAAGCGCCTGCAA	NA	NA	NA	NA
WP_032314870.1|2251184_2252210_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_000158899.1|2252251_2252647_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|2252658_2253012_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_033816197.1|2253023_2253602_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683137.1|2253598_2253994_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_033816257.1|2254001_2254754_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.4e-134
WP_000479105.1|2254767_2255199_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_062864850.1|2255225_2255630_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	3.4e-42
WP_080025937.1|2255610_2258190_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_033816191.1|2258186_2258516_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
WP_001152217.1|2258515_2259214_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_064482874.1|2259224_2259968_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_072141513.1|2259913_2260546_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_080029428.1|2260792_2264269_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_080029429.1|2264335_2264935_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	1.8e-108
WP_080029490.1|2264999_2266268_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	89.3	7.7e-72
WP_001401301.1|2266289_2266538_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_001079090.1|2269368_2269899_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001317164.1|2270241_2270913_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|2271148_2271784_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740094.1|2271784_2272789_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001397435.1|2272897_2273311_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2273443_2274115_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826749.1|2274114_2275473_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_000218204.1|2275580_2276432_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824367.1|2277023_2278097_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	3.1e-98
WP_001313057.1|2278662_2279028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365559.1|2279067_2279763_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|2279829_2281248_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786005.1|2281228_2281699_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212248.1|2281687_2282608_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|2282780_2283698_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2283776_2283959_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001349973.1|2284129_2285824_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491497.1|2285820_2286636_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2286933_2287161_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|2287269_2287512_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|2287555_2288179_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_032314571.1|2288468_2289254_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2289262_2289532_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2289541_2290279_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001299290.1|2290278_2290644_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2290646_2291060_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2291056_2292061_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133124.1|2292065_2292530_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620091.1|2292634_2293762_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807661.1|2293758_2294202_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_032314572.1|2294220_2295594_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282685.1|2295593_2296280_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2296272_2297268_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994405.1|2297260_2298919_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|2299133_2299448_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2299781_2300114_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|2300282_2300834_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|2300843_2301641_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064734585.1|2303053_2304262_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.3e-209
>prophage 6
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	2406695	2485273	5371291	holin,tail,tRNA,protease,portal,integrase	Escherichia_phage(39.29%)	91	2402893:2402909	2435948:2435964
2402893:2402909	attL	CTGAATGCACTGGGTGA	NA	NA	NA	NA
WP_000916763.1|2406695_2406926_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|2407064_2407439_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879298.1|2407442_2408315_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976476.1|2408327_2408669_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2409061_2410138_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_001311878.1|2410103_2410385_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_024165285.1|2410491_2410680_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.8e-17
WP_001307771.1|2410672_2410867_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	5.8e-32
WP_000186708.1|2410898_2411579_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	96.0	6.9e-128
WP_001484907.1|2411575_2412361_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	95.4	1.3e-141
WP_001484906.1|2412366_2412663_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	82.7	2.3e-40
WP_001358843.1|2414758_2415034_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.2e-44
WP_000258918.1|2415108_2415285_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	70.7	6.3e-17
WP_000560228.1|2415278_2415500_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000935601.1|2415546_2416395_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.8	1.7e-54
WP_001169149.1|2416823_2416976_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_000233812.1|2416986_2417121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253182.1|2417356_2417821_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|2417925_2418201_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|2418184_2418607_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2418619_2419477_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000788990.1|2419483_2420230_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_050923614.1|2420251_2421022_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_001141093.1|2421037_2421430_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_000206794.1|2421486_2422071_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2422186_2422291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|2422479_2422692_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_000119356.1|2422900_2423080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2423098_2423584_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|2424045_2424645_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|2424644_2424935_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2424931_2425486_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_080029432.1|2427027_2428974_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.9	0.0e+00
WP_000143463.1|2429110_2429290_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|2429330_2429576_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2429653_2429869_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_062871796.1|2429873_2430407_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	96.6	2.1e-100
WP_012816791.1|2430623_2430809_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_029786607.1|2430894_2431119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373407.1|2431537_2432014_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_000102415.1|2434129_2434342_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2434341_2435844_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097065.1|2437899_2438226_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
2435948:2435964	attR	CTGAATGCACTGGGTGA	NA	NA	NA	NA
WP_001281350.1|2438218_2438500_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_080029433.1|2438502_2439126_+|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	99.0	5.6e-100
WP_000682716.1|2439138_2439537_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2439544_2440297_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|2440310_2440733_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|2440759_2441068_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_080025946.1|2441111_2443757_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	89.9	0.0e+00
WP_000847298.1|2443753_2444083_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024236480.1|2444082_2444781_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	3.4e-130
WP_001443526.1|2444786_2445530_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	3.6e-146
WP_122994373.1|2445475_2446105_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	7.9e-102
WP_080029435.1|2446345_2449822_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_001230398.1|2449888_2450488_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	9.7e-110
WP_045893719.1|2450552_2451866_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	7.7e-83
WP_001023407.1|2451867_2452137_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000812720.1|2452865_2453522_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.2e-55
WP_001296140.1|2453522_2453714_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2453818_2454055_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001443441.1|2454172_2455612_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_032314101.1|2455691_2458325_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001397201.1|2458293_2459577_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043881.1|2459706_2460204_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_032314102.1|2460300_2460999_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|2461018_2463067_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|2463258_2464140_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127219.1|2464185_2465559_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262182.1|2465735_2466527_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|2466669_2466909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2467067_2467211_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|2467285_2467573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2468241_2468385_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2468397_2468607_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010129.1|2468772_2469582_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001443443.1|2469578_2470157_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|2470585_2471044_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2471098_2471950_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2471962_2472763_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2472825_2473797_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|2474259_2475816_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|2475819_2477418_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|2477548_2478913_-	L-serine dehydratase 1	NA	NA	NA	NA	NA
WP_000456730.1|2479096_2479675_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_080029436.1|2479678_2481040_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	32.9	3.4e-41
WP_000457334.1|2481113_2481293_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|2481412_2481772_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2482133_2482478_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2482609_2484520_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220981.1|2484577_2485273_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	2702844	2765672	5371291	holin,lysis,tail,protease,terminase,portal,integrase	Escherichia_phage(37.04%)	74	2706949:2706965	2740677:2740693
WP_001260840.1|2702844_2703666_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2703765_2703849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314137.1|2703941_2704277_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2704673_2705927_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2706033_2706927_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2706949:2706965	attL	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|2707061_2708282_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2708406_2709102_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071529404.1|2709054_2710347_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2710505_2711120_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526498.1|2711162_2712017_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213020.1|2712018_2712636_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074014489.1|2712646_2715070_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	1.4e-207
WP_032314140.1|2715130_2717557_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
WP_001295396.1|2717755_2718061_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2718168_2718879_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2718881_2719442_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2719476_2719818_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2719952_2720279_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001397147.1|2720484_2721699_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_000836079.1|2721710_2722730_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|2722787_2722898_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|2722917_2724213_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|2724232_2724469_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000102122.1|2724556_2727019_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|2727111_2727300_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2727296_2727485_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2728049_2728259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050869509.1|2728259_2728898_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2728909_2729062_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2729354_2729693_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2730084_2730327_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_050867085.1|2730310_2730736_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2730804_2731848_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_050867088.1|2731879_2732302_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.2e-71
WP_050867086.1|2732335_2733061_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.2	9.7e-80
WP_050867087.1|2733076_2733499_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.1e-64
WP_072096035.1|2733499_2733913_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.0e-57
WP_001224685.1|2734006_2734189_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	2.6e-26
WP_050869511.1|2734354_2735050_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	65.3	6.7e-70
WP_000555106.1|2735198_2735912_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_001278450.1|2736027_2736132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018429.1|2736320_2736533_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001341388.1|2736700_2736979_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265156.1|2736980_2738030_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_080029440.1|2738042_2738402_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	9.5e-36
WP_000640023.1|2738410_2738953_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_080029441.1|2739962_2741909_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.7	0.0e+00
2740677:2740693	attR	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000143464.1|2742045_2742225_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|2742265_2742538_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|2742614_2742830_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_054432902.1|2743392_2743926_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.2	1.5e-98
WP_001255337.1|2743922_2744390_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_029786607.1|2744413_2744638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373407.1|2745056_2745533_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077626.1|2745529_2747653_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2747649_2747862_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|2747861_2749364_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114424.1|2749308_2751333_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2751420_2751747_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|2751739_2752021_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001450644.1|2752023_2752647_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_000682716.1|2752659_2753058_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2753065_2753818_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|2753831_2754254_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000533450.1|2754280_2754589_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	98.0	6.6e-54
WP_080029442.1|2754632_2757278_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|2757274_2757604_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_080029443.1|2757603_2758302_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	4.0e-131
WP_080029444.1|2758312_2759056_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	1.6e-149
WP_155120697.1|2759001_2759634_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	97.6	8.7e-109
WP_080029446.1|2759880_2763357_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.7	0.0e+00
WP_001230496.1|2763423_2764023_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_080029491.1|2764087_2765401_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	5.1e-79
WP_001023379.1|2765402_2765672_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
>prophage 8
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3047959	3099908	5371291	holin,head,tail,protease,terminase,transposase	Enterobacteria_phage(25.0%)	58	NA	NA
WP_000422045.1|3047959_3049009_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|3049228_3049987_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|3049983_3050574_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3050613_3051486_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|3051586_3052207_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3052203_3053085_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3053222_3053267_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|3053358_3054921_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3054920_3056516_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|3056519_3057878_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|3057889_3059083_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|3059082_3059889_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3060269_3060449_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3060534_3061035_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|3061080_3061587_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071529157.1|3062088_3062307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096846282.1|3063883_3065046_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	8.1e-52
WP_001386222.1|3065111_3065261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000938103.1|3065307_3065877_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3065942_3066854_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3066960_3067083_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106425100.1|3070164_3070359_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	8.2e-10
WP_000767050.1|3070303_3070846_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023388.1|3071066_3071336_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	6.4e-45
WP_032314473.1|3071337_3072642_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	87.3	3.0e-71
WP_001216293.1|3072706_3073330_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	1.0e-69
WP_074390344.1|3073396_3074623_-	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	99.8	2.0e-218
WP_085947772.1|3074677_3075891_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_072023064.1|3075911_3076031_-|head	head protein	head	A0A0P0ZAJ3	Stx2-converting_phage	100.0	1.6e-11
WP_001417827.1|3076094_3077756_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_047661669.1|3077752_3078316_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.6	7.1e-86
WP_000074669.1|3080315_3080540_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3080621_3080936_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_137524955.1|3081463_3081649_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	8.3e-20
WP_047661548.1|3081865_3082363_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|3082362_3082569_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023143.1|3083016_3084867_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001059384.1|3086386_3087076_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_032314810.1|3087098_3087437_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.4e-33
WP_010917803.1|3088495_3088774_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3088843_3089101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|3089321_3089534_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_080029451.1|3089812_3090571_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|3091269_3091434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|3091430_3092165_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001443510.1|3092198_3092621_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	6.5e-76
WP_032314809.1|3092652_3093693_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	5.1e-90
WP_000705622.1|3093664_3094216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3094199_3094427_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3094503_3094911_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3095175_3095475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3095547_3095766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3095788_3096196_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3096173_3096407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3096400_3096568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3096967_3097156_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3097152_3097344_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064482945.1|3097436_3099908_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.8	8.0e-57
>prophage 9
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3204558	3271777	5371291	holin,capsid,head,tail,tRNA,terminase,transposase,integrase	Stx2-converting_phage(36.17%)	71	3253351:3253371	3279487:3279507
WP_001297484.1|3204558_3205665_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3205700_3206342_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3206345_3207716_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265480.1|3207883_3208555_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3208554_3210015_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3210090_3211212_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_080029454.1|3211260_3212487_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|3212736_3213873_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_062865033.1|3213856_3214720_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.9	1.1e-10
WP_000938111.1|3215082_3216444_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|3216820_3220222_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|3220813_3223162_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3223181_3223271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380479.1|3223377_3223647_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000741894.1|3223648_3224965_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.9	3.1e-76
WP_001230281.1|3225024_3225624_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	1.6e-107
WP_080029455.1|3225690_3229164_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.2	0.0e+00
WP_047085664.1|3229402_3230035_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_080029456.1|3229980_3230724_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.1e-147
WP_001152217.1|3230734_3231433_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_000807964.1|3231432_3231774_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_080029457.1|3231766_3235009_-|tail	phage tail tape measure protein	tail	Q6H9T7	Enterobacteria_phage	99.8	0.0e+00
WP_001513217.1|3235056_3235266_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030067.1|3235361_3235736_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001275471.1|3235741_3236458_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|3236523_3236868_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3236864_3237311_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3237307_3237658_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3237667_3237994_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063094.1|3240520_3240742_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173079.1|3240786_3242724_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_080029458.1|3242787_3244449_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|3244445_3245009_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001372000.1|3245298_3245664_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_001302977.1|3245705_3245891_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3246020_3246161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3246517_3246742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3246806_3247013_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|3247659_3248193_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|3248352_3248625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|3248880_3249087_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000143049.1|3249379_3251230_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|3252400_3253222_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|3253218_3253593_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
3253351:3253371	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265175.1|3253605_3254655_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|3254656_3254935_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000884071.1|3255102_3255315_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001278450.1|3255503_3255608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627694.1|3255723_3256308_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001118159.1|3256364_3256760_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000450874.1|3256775_3257546_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000788938.1|3257571_3258312_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|3258318_3259281_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|3259303_3259729_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3259712_3260036_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|3260160_3260637_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443692.1|3260955_3261111_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_001171966.1|3261270_3261489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|3261492_3261657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3262057_3262246_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3262242_3262434_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048412.1|3262526_3264998_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|3265059_3265329_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|3265297_3266416_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001113310.1|3266492_3266960_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000824186.1|3266937_3267141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580316.1|3267449_3268244_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|3268240_3269287_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000076381.1|3269344_3269806_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000713472.1|3269802_3270591_+	membrane protein	NA	NA	NA	NA	NA
WP_000399648.1|3270796_3271777_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
3279487:3279507	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3356720	3429473	5371291	holin,lysis,capsid,tail,protease,portal,terminase,bacteriocin,transposase,integrase	Escherichia_phage(51.95%)	86	3367657:3367672	3431194:3431209
WP_085947598.1|3356720_3357882_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000979516.1|3358133_3358343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314678.1|3358397_3362360_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3362399_3363038_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3363325_3364417_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3364416_3365109_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|3365120_3365507_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_000777653.1|3365514_3366315_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|3366324_3366915_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3366925_3367420_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_032314677.1|3367440_3368769_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	4.5e-232
3367657:3367672	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_001273658.1|3368851_3369025_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000203845.1|3369986_3370604_+	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	89.0	2.8e-96
WP_000763353.1|3370651_3370873_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3370869_3371154_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000426668.1|3372038_3372434_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3372667_3372880_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3372999_3373344_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000331694.1|3373894_3382276_-	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	99.8	0.0e+00
WP_000012450.1|3382345_3383611_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3383621_3383873_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3383882_3384329_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3384331_3384988_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3385081_3385483_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3385539_3385680_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835359.1|3385912_3386647_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
WP_001301884.1|3386737_3387355_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3387360_3387639_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_016241167.1|3387653_3388922_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	98.1	2.1e-218
WP_016241166.1|3388918_3390544_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.8	0.0e+00
WP_001303606.1|3390838_3391027_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3391165_3391435_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_024183271.1|3391436_3393473_-|tail	tail fiber protein	tail	A0A0P0ZD90	Stx2-converting_phage	100.0	9.4e-88
WP_000207923.1|3393469_3394120_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3394119_3394683_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3394666_3395128_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3395177_3395567_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3395622_3396837_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3396860_3397868_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3398025_3400170_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_045907200.1|3400169_3401876_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_001086073.1|3401856_3402663_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000738505.1|3403071_3403365_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3403396_3403861_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3403868_3404018_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3404017_3404587_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3404861_3405395_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3405399_3405615_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3405691_3405964_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3406004_3406184_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3406318_3408256_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_001204880.1|3409477_3409912_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3409904_3410099_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3410095_3410701_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004020.1|3410700_3411423_-	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_000335901.1|3411574_3412624_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	100.0	1.7e-181
WP_000153288.1|3412805_3413333_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_000814575.1|3413329_3413776_-	recombination protein NinB	NA	Q8HA08	Enterobacteria_phage	100.0	1.4e-81
WP_001281772.1|3413732_3413969_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103676.1|3413979_3414195_-	hypothetical protein	NA	Q8HA10	Enterobacteria_phage	100.0	1.2e-33
WP_001000127.1|3414326_3414605_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145935.1|3414675_3414966_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788839.1|3414962_3415664_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_000438541.1|3416603_3416900_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3417038_3417266_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3417344_3418052_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3418112_3418454_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|3418521_3418983_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3418976_3420023_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|3420678_3421062_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167592.1|3421120_3421591_+	hypothetical protein	NA	G9L670	Escherichia_phage	100.0	3.7e-88
WP_000776961.1|3421734_3422046_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001198860.1|3422118_3422283_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000995464.1|3422471_3422768_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3422773_3423559_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3423555_3424236_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3424232_3424415_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3424387_3424579_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077758510.1|3424589_3424871_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	9.3e-47
WP_000774248.1|3424969_3425191_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_033815964.1|3425187_3425826_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.3	6.1e-94
WP_033815965.1|3425827_3426019_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	2.0e-24
WP_000022062.1|3427071_3427353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155120693.1|3427440_3427740_+	hypothetical protein	NA	G9L655	Escherichia_phage	99.0	9.3e-53
WP_001208773.1|3427825_3428110_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3428162_3429473_+|integrase	site-specific integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
3431194:3431209	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
>prophage 11
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3460749	3503473	5371291	transposase,tail,protease,holin	Escherichia_phage(30.56%)	51	NA	NA
WP_032314674.1|3460749_3461337_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3461333_3462041_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3462059_3463853_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3463849_3464968_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_032175067.1|3465586_3465970_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	83.5	2.2e-54
WP_032314673.1|3467379_3468018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314672.1|3468082_3469063_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	3.5e-88
WP_032314671.1|3469239_3469509_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	5.4e-44
WP_064482948.1|3469510_3470824_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	2.2e-82
WP_001360257.1|3470888_3471512_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_080029461.1|3471580_3475057_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	99.0	0.0e+00
WP_000649829.1|3475190_3475718_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_052915903.1|3475908_3476541_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_053895436.1|3476486_3477230_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_001357740.1|3477240_3477939_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|3477938_3478268_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_106904299.1|3480241_3481454_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	7.9e-167
WP_001303940.1|3481889_3482114_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001303878.1|3482195_3482510_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3483035_3483221_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3483442_3483556_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3483776_3484310_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3484469_3484742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3484997_3485204_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|3485652_3487503_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|3488270_3488984_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3489121_3489319_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_033815881.1|3489605_3490424_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3490575_3490947_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3490936_3491308_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3491320_3492370_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|3492371_3492650_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|3492817_3493030_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|3493218_3493323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|3493438_3494308_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|3494318_3494582_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|3494583_3494748_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|3494833_3495046_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|3495096_3495453_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|3495430_3495892_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|3495888_3496185_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151153.1|3496181_3496604_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|3496644_3497715_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|3497786_3498212_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3498208_3498424_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|3498473_3499190_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|3499462_3499615_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|3499626_3500001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3500532_3500721_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3500717_3500909_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064482952.1|3501001_3503473_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.4	1.0e-59
>prophage 12
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3609339	3660205	5371291	capsid,tail,tRNA,protease,terminase,integrase	uncultured_Caudovirales_phage(10.0%)	54	3613785:3613804	3654298:3654317
WP_001241678.1|3609339_3610044_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3610328_3610547_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3611231_3613508_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3613538_3613859_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
3613785:3613804	attL	TGGCGGTTTTAGCGCGTCGC	NA	NA	NA	NA
WP_000562896.1|3614837_3615761_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_001229493.1|3615923_3616412_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_001018605.1|3616541_3616703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|3616706_3616901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557482.1|3617031_3617283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080029462.1|3617569_3619318_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	2.7e-91
WP_000770151.1|3619314_3619614_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000659213.1|3619851_3620043_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000920689.1|3620042_3620228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072141637.1|3620220_3620919_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001075374.1|3620928_3621153_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000775337.1|3621244_3622018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085207.1|3622014_3623238_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000410785.1|3623642_3623867_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032314545.1|3623939_3625886_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3625882_3626998_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001397058.1|3627148_3628105_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599823.1|3628101_3629760_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_080029463.1|3630186_3630882_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3631377_3632277_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458832.1|3632420_3634073_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032314543.1|3634084_3635053_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3635185_3636904_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_016246997.1|3636940_3637942_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3637952_3639383_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3639481_3640495_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3640491_3641322_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3641318_3641642_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3641767_3642283_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3642500_3643229_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3643246_3643978_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3643984_3644701_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3644700_3645369_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3645660_3646392_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149738.1|3646566_3647694_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_000389260.1|3647734_3648223_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3648282_3649128_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3649124_3650078_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_032314541.1|3650087_3651221_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_032314540.1|3651315_3652428_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3652778_3653255_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3653342_3654245_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_032314539.1|3654305_3655028_-	nitroreductase NfsA	NA	NA	NA	NA	NA
3654298:3654317	attR	TGGCGGTTTTAGCGCGTCGC	NA	NA	NA	NA
WP_001201560.1|3655011_3655299_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3655458_3655716_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681112.1|3655745_3656123_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3656392_3658078_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|3658313_3658532_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032314538.1|3658622_3659723_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
WP_032314536.1|3659719_3660205_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.1e-66
>prophage 13
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3663271	3692396	5371291	lysis,capsid,plate,head,tail,terminase,portal,integrase	Salmonella_phage(85.29%)	36	3683960:3683974	3695601:3695615
WP_000763311.1|3663271_3663391_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3663405_3663708_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3663762_3664278_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_007866350.1|3664287_3665460_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_080029464.1|3665851_3666973_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	28.2	2.4e-32
WP_032314534.1|3667153_3667573_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	60.0	8.0e-26
WP_033815906.1|3667574_3668996_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	83.2	6.9e-162
WP_032314532.1|3668992_3669598_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268301.1|3669590_3670499_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_032314531.1|3670485_3670845_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.2	8.8e-50
WP_024220192.1|3670841_3671420_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_032314530.1|3671488_3671935_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_021546575.1|3671927_3672359_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_032314528.1|3672454_3672883_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.4e-46
WP_016245845.1|3672879_3673257_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_001442491.1|3673258_3673732_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|3673751_3673967_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3673970_3674174_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3674173_3674638_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|3674733_3675384_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032314526.1|3675387_3676446_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_032314525.1|3676462_3677296_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.6e-118
WP_032314522.1|3679205_3680237_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.9e-170
WP_001059831.1|3682688_3683024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314521.1|3683216_3683450_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	6.1e-36
WP_001154431.1|3683460_3683649_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_032314520.1|3683801_3686216_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
3683960:3683974	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
WP_000104175.1|3686212_3687070_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000752619.1|3687066_3687294_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|3687293_3687527_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963473.1|3687594_3687936_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|3687899_3688100_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460897.1|3688107_3688617_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3688649_3688871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649891.1|3689583_3691260_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	7.5e-83
WP_000290933.1|3691343_3692396_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3695601:3695615	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
>prophage 14
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	3991395	4031597	5371291	transposase,holin,integrase,protease	Enterobacteria_phage(56.76%)	48	4007201:4007247	4031611:4031657
WP_105466968.1|3991395_3992609_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	6.7e-166
WP_074390353.1|3992671_3996892_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.3	8.6e-19
WP_001443483.1|3996925_3997189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314806.1|3997201_3998092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420919.1|3998720_3999857_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383934.1|4000125_4002363_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001396984.1|4002349_4005322_+	phage receptor	NA	NA	NA	NA	NA
WP_001224569.1|4005322_4006213_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|4006395_4007157_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
4007201:4007247	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|4007669_4008623_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|4008809_4010294_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000075135.1|4010699_4011197_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000411802.1|4011196_4011403_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085947772.1|4012212_4013426_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_080029467.1|4013446_4014961_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	5.6e-287
WP_000499454.1|4015258_4015417_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4015502_4016246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314960.1|4016498_4017122_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.4e-111
WP_001028854.1|4017118_4017784_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|4017780_4018401_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|4018393_4018564_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|4018560_4018743_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000153280.1|4018739_4019267_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|4019263_4019704_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145940.1|4019777_4020068_-	protein ren	NA	K7P7K7	Enterobacteria_phage	99.0	8.2e-46
WP_001372464.1|4020064_4020766_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000185506.1|4020762_4021662_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000251067.1|4021694_4021988_-	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000437875.1|4022106_4022307_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274762.1|4022407_4023121_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	100.0	1.1e-131
WP_001207141.1|4023171_4023606_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_001278659.1|4023602_4024205_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	96.6	7.6e-46
WP_001443534.1|4024632_4024956_+	antitermination protein	NA	K7P718	Enterobacteria_phage	98.1	4.2e-51
WP_001278766.1|4024948_4025443_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000213977.1|4025652_4025853_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
WP_000065358.1|4026035_4026404_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_001198861.1|4026476_4026641_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|4026609_4026753_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995433.1|4026827_4027124_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|4027129_4027915_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|4027911_4028592_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|4028588_4028750_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|4028742_4029300_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|4029310_4029592_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_080029468.1|4029690_4029909_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	4.1e-34
WP_000488407.1|4029956_4030235_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|4030206_4030578_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|4030433_4031597_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
4031611:4031657	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 15
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	4277145	4338848	5371291	transposase,holin,integrase,capsid	Enterobacteria_phage(25.0%)	54	4300134:4300151	4317156:4317173
WP_000131043.1|4277145_4279179_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|4279307_4279895_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_080029472.1|4279908_4281381_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159099.1|4281394_4283065_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.6e-61
WP_001209103.1|4283277_4283946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370300.1|4284188_4284884_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001102114.1|4286313_4287033_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4287559_4288414_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|4288639_4289965_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|4290073_4290310_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032314451.1|4290321_4290915_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001396940.1|4291074_4291944_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_032314452.1|4292192_4293050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032314453.1|4293170_4297424_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|4298539_4298641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803990.1|4299004_4299268_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4299267_4299408_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|4299442_4299670_-	hypothetical protein	NA	NA	NA	NA	NA
4300134:4300151	attL	GTTCCTGACCAATATAAA	NA	NA	NA	NA
WP_001296902.1|4300492_4301035_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4301109_4301697_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4301754_4302423_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131094.1|4302448_4304974_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001323478.1|4304963_4306607_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|4306575_4307286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|4307598_4307928_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4308175_4308790_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|4309207_4309897_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643323.1|4309893_4310850_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_064482965.1|4310846_4313045_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	5.6e-38
WP_000121330.1|4313054_4314011_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|4313989_4314400_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314454.1|4314628_4315963_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080029473.1|4316044_4316758_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.3	1.9e-48
WP_032314455.1|4316792_4318622_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.4	1.6e-30
4317156:4317173	attR	TTTATATTGGTCAGGAAC	NA	NA	NA	NA
WP_001308407.1|4318640_4318841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314456.1|4318927_4319956_-|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_074014476.1|4319971_4320169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089646617.1|4320218_4321380_+|transposase	IS3-like element IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	8.1e-52
WP_032314825.1|4321591_4321804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314826.1|4322148_4322484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129165.1|4322485_4322896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314827.1|4323025_4323304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314828.1|4323320_4324010_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032314829.1|4324253_4324442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314830.1|4326471_4327011_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.1	1.6e-26
WP_000893255.1|4328415_4329669_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|4329680_4330784_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|4331071_4332127_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|4332165_4332567_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_032314831.1|4332624_4333869_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4333960_4334419_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|4334679_4336137_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4336193_4336808_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001358663.1|4337651_4338848_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	4365931	4452581	5371291	plate,head,tail,tRNA,protease,transposase,integrase	Shigella_phage(47.83%)	96	4373655:4373674	4412239:4412258
WP_000611742.1|4365931_4366345_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4366348_4368199_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4368162_4369245_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4369269_4370550_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4370546_4371071_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246415.1|4371073_4372405_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_080029474.1|4372409_4373099_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000077537.1|4373336_4373867_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
4373655:4373674	attL	GCCCTCTTTAAGCCACTCAA	NA	NA	NA	NA
WP_001310454.1|4374057_4374306_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_080029475.1|4374307_4376398_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	1.5e-165
WP_000129793.1|4376468_4377401_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	9.0e-70
WP_000268103.1|4377403_4377625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4377637_4377892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4377893_4378175_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4378171_4378444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|4378448_4378742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4378753_4379284_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|4379381_4379924_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000564281.1|4379927_4380461_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|4380460_4380976_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_080029476.1|4380979_4381531_+	AsnC family protein	NA	NA	NA	NA	NA
WP_001310453.1|4381752_4382085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080029478.1|4382077_4382275_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	9.5e-06
WP_000370523.1|4382264_4382561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214359.1|4382557_4383067_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000852377.1|4383136_4383562_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4383633_4384134_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4384168_4384597_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|4384580_4384799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|4384808_4385036_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4385016_4385325_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4385321_4385612_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4385614_4386196_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057669.1|4386195_4387860_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	72.8	3.8e-228
WP_001400311.1|4387859_4389449_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	4.2e-168
WP_000046892.1|4389432_4390764_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	8.7e-151
WP_000094808.1|4390885_4391359_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4391535_4392660_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4392659_4393607_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002056.1|4393650_4394049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4394045_4394465_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4394461_4395022_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4395022_4395268_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4395264_4396767_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4396775_4397141_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4397155_4397632_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|4397758_4399834_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146117.1|4399820_4401170_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098807.1|4401153_4402278_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4402267_4402882_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4402874_4403312_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4403311_4404394_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|4404384_4404945_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469167.1|4404944_4405856_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	6.4e-28
WP_000420351.1|4405890_4406412_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4406491_4406695_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4406916_4407477_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4407576_4409616_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4409762_4409945_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_032324862.1|4409980_4410226_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001310452.1|4410844_4411045_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|4410998_4411736_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_080029479.1|4411728_4411953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032314738.1|4411961_4414733_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	8.9e-81
4412239:4412258	attR	TTGAGTGGCTTAAAGAGGGC	NA	NA	NA	NA
WP_000088862.1|4414729_4415473_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|4415477_4416890_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122996272.1|4416998_4420433_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_089647483.1|4421018_4422231_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	7.1e-168
WP_096844020.1|4422215_4423109_+	VasL domain-containing protein	NA	NA	NA	NA	NA
WP_001284199.1|4423132_4423615_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032314855.1|4423658_4424573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4424582_4425062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4426519_4427251_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4427315_4427783_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|4427779_4428502_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|4428535_4429291_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4429362_4430721_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211688.1|4430769_4431540_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4431617_4432418_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|4432658_4433573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080029480.1|4433569_4434373_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_001140175.1|4440271_4440847_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4441034_4442066_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4442058_4442712_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4442751_4443567_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4443684_4444089_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094018.1|4444085_4444793_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260721.1|4444903_4446622_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032314432.1|4446674_4447499_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4447702_4448683_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239173.1|4448932_4449643_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4449656_4450079_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4450075_4450621_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4450786_4450987_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4450973_4451234_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_032314410.1|4451282_4452581_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	4668195	4744317	5371291	holin,capsid,head,tail,tRNA,portal,terminase,integrase	Enterobacteria_phage(36.84%)	87	4709805:4709819	4745503:4745517
WP_001223164.1|4668195_4668882_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4669281_4669422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4669517_4670234_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920323.1|4670293_4671646_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|4671703_4673128_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188666.1|4673127_4673817_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4673829_4674303_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4674513_4675383_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4675379_4676027_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001338221.1|4676078_4676591_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4676632_4676959_-	trp operon repressor	NA	NA	NA	NA	NA
WP_032314751.1|4677048_4678986_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4679196_4680864_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4681170_4682403_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|4682423_4683806_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4683854_4684823_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4684928_4685573_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|4685600_4686617_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4687072_4687792_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4687871_4689095_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477808.1|4689146_4690469_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_001295412.1|4690595_4691375_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143248.1|4691632_4693183_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088395.1|4693154_4694018_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563066.1|4694130_4694913_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4694909_4695983_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4696104_4696266_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4696392_4696998_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4697390_4698977_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4699196_4699445_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|4699871_4699985_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|4700053_4700287_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|4700666_4701257_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_032314750.1|4701354_4701930_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	9.4e-102
WP_033815940.1|4701929_4705283_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_064217532.1|4705347_4705947_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	6.3e-109
WP_062874753.1|4706013_4709412_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000090873.1|4709471_4710104_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
4709805:4709819	attL	GGCAATGGCGGCAGC	NA	NA	NA	NA
WP_064482969.1|4710040_4710784_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	1.5e-144
WP_001152217.1|4710794_4711493_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.6	2.8e-132
WP_033816191.1|4711492_4711822_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
WP_062874814.1|4711818_4714380_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	87.8	0.0e+00
WP_000459457.1|4714372_4714807_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|4714788_4715211_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001345558.1|4715226_4715967_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000683138.1|4715974_4716370_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_033816197.1|4716366_4716945_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000753019.1|4716956_4717310_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|4717321_4717717_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_032314870.1|4717758_4718784_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	4.4e-187
WP_001299443.1|4718839_4719172_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|4719181_4720501_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_033816198.1|4720481_4722083_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|4722079_4722286_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|4722282_4724208_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_033816199.1|4724182_4724728_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_032314362.1|4725116_4725311_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	1.4e-25
WP_000548592.1|4725561_4725768_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|4726063_4726237_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|4726409_4726565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4726712_4726901_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4726911_4727124_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4727487_4727985_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4727981_4728515_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|4728628_4728889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074390338.1|4728836_4729388_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	2.9e-36
WP_000839581.1|4729392_4729608_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066486.1|4730360_4730576_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000087755.1|4730876_4731089_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122632654.1|4731143_4731233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047103.1|4731511_4732264_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_001519432.1|4732277_4733267_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_032314364.1|4733274_4734072_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.2e-150
WP_000767115.1|4734091_4734481_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210173.1|4734477_4734804_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_000066918.1|4734800_4735454_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_001331408.1|4735453_4735948_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
WP_032314365.1|4735944_4736862_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	84.7	1.5e-125
WP_001250269.1|4736851_4737031_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001440240.1|4737206_4737758_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_032314368.1|4737750_4738011_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	97.7	1.0e-39
WP_032314369.1|4738108_4738801_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	9.5e-125
WP_000549626.1|4739147_4739354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|4739325_4739760_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_021537118.1|4740304_4740841_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_021537117.1|4741802_4742822_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_032314370.1|4743093_4744317_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.8	1.2e-236
4745503:4745517	attR	GGCAATGGCGGCAGC	NA	NA	NA	NA
>prophage 18
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	4984049	4993157	5371291	transposase,protease	Stx2-converting_phage(66.67%)	6	NA	NA
WP_000422741.1|4984049_4984475_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4984471_4984822_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032314460.1|4986134_4987706_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_000624626.1|4987725_4988073_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	7.5e-46
WP_000993931.1|4988072_4988723_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	1.8e-16
WP_001034103.1|4989257_4993157_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	1.6e-237
>prophage 19
NZ_CP020106	Escherichia coli strain 13E0780 chromosome, complete genome	5371291	5083293	5131667	5371291	holin,capsid,head,tail,tRNA,portal,terminase,integrase	Enterobacteria_phage(39.22%)	58	5078672:5078686	5092413:5092427
5078672:5078686	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_000918363.1|5083293_5084709_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|5084791_5085775_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891402.1|5085940_5086183_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|5086316_5087354_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|5087442_5088540_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_001217547.1|5088601_5088850_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.8	1.2e-37
WP_099561169.1|5088986_5089109_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001132160.1|5089095_5089686_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144078.1|5089867_5090518_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.1e-25
WP_000442133.1|5090669_5091092_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.8	2.5e-72
WP_001023455.1|5091252_5091522_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_074390343.1|5091523_5092828_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	97.3	1.8e-71
5092413:5092427	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_047661541.1|5092892_5093492_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q6H9T1	Enterobacteria_phage	99.5	3.3e-110
WP_080029488.1|5093558_5096957_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	86.4	0.0e+00
WP_123123568.1|5097192_5097825_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.2e-103
WP_053895436.1|5097770_5098514_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_001357740.1|5098524_5099223_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|5099222_5099552_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_047661462.1|5099548_5102128_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.8	0.0e+00
WP_000533402.1|5102108_5102522_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|5102548_5102980_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235110.1|5102993_5103746_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|5103753_5104149_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974985.1|5104145_5104679_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204560.1|5104694_5105048_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_080029489.1|5105040_5105424_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|5105475_5106504_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256821.1|5106561_5106909_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_001253987.1|5106945_5108451_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001397759.1|5108440_5110033_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	5.5e-184
WP_000259002.1|5110029_5110236_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032314862.1|5110219_5112148_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.0e-261
WP_000235436.1|5112119_5112629_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001303940.1|5113020_5113245_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|5113326_5113641_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|5114167_5114353_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|5114575_5114722_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|5114721_5115291_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|5115561_5116095_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000411802.1|5116493_5116700_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_064482927.1|5117147_5118998_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000917759.1|5120176_5120329_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	1.1e-17
WP_001204806.1|5120544_5120925_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_001443262.1|5120942_5121932_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.0e-192
WP_001223333.1|5121941_5122457_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_032314711.1|5122472_5123288_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	1.1e-148
WP_000767110.1|5123439_5123835_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210151.1|5123831_5124158_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_001355692.1|5124154_5124808_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_024145951.1|5124902_5125271_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	5.1e-69
WP_001250270.1|5125851_5126064_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000515867.1|5126239_5126791_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	9.9e-101
WP_000649477.1|5126834_5127035_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859461.1|5127125_5127800_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.6	1.3e-131
WP_000135680.1|5128466_5128829_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081299.1|5128894_5129719_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	5.0e-149
WP_000008182.1|5129846_5130371_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-96
WP_001093922.1|5131385_5131667_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	94.6	2.0e-41
