The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	1463831	1471614	3547915		Acinetobacter_phage(50.0%)	8	NA	NA
WP_054065000.1|1463831_1465067_+	polyamine aminopropyltransferase	NA	Q5GQE8	Synechococcus_phage	38.9	3.1e-09
WP_080025342.1|1465144_1465759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054065002.1|1466176_1467676_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	30.2	1.6e-39
WP_054065003.1|1467672_1468023_+	chorismate mutase	NA	NA	NA	NA	NA
WP_054065004.1|1468019_1468601_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.4	1.3e-63
WP_054065005.1|1468748_1469783_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.0	1.7e-77
WP_054065006.1|1469851_1470652_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.9	8.3e-64
WP_054065007.1|1470894_1471614_+	uracil-DNA glycosylase	NA	A0A0Y0A6W9	Macropodid_alphaherpesvirus	46.1	1.5e-40
>prophage 2
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	2789332	2824761	3547915	integrase,transposase	Pseudomonas_phage(52.94%)	47	2790840:2790855	2799630:2799645
WP_054066345.1|2789332_2789956_-	DUF3164 family protein	NA	A0A2H4IYN0	uncultured_Caudovirales_phage	54.0	1.6e-54
WP_054066346.1|2789970_2790264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054066347.1|2790275_2790686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054066348.1|2790682_2790934_-	hypothetical protein	NA	NA	NA	NA	NA
2790840:2790855	attL	ACCAGGGCGGCCAGCG	NA	NA	NA	NA
WP_162777410.1|2790930_2791089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162777411.1|2791090_2792386_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	42.6	1.5e-75
WP_054066372.1|2792400_2794179_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9STP5	Pseudomonas_phage	33.8	4.7e-75
WP_080025243.1|2794209_2795133_-	DUF3102 domain-containing protein	NA	A0A0S4L093	Pseudomonas_phage	33.0	3.0e-17
WP_054066351.1|2795157_2795460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054066352.1|2795456_2795774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054066353.1|2795763_2796249_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	39.7	1.3e-24
WP_054066354.1|2796343_2796637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066355.1|2796715_2796970_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_080025244.1|2797081_2797477_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	55.1	5.8e-18
WP_162777412.1|2797670_2797997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080025245.1|2798209_2798425_+	hypothetical protein	NA	Q6QID9	Burkholderia_phage	67.3	7.7e-09
WP_080025377.1|2798534_2798966_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	48.8	3.6e-13
WP_054066360.1|2798969_2799596_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	50.3	1.5e-36
WP_054066361.1|2799592_2800105_+	hypothetical protein	NA	NA	NA	NA	NA
2799630:2799645	attR	CGCTGGCCGCCCTGGT	NA	NA	NA	NA
WP_054066362.1|2800101_2800335_+	TraR/DksA family transcriptional regulator	NA	A0A2I7RNJ6	Vibrio_phage	47.1	4.2e-08
WP_054066363.1|2800331_2800688_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	55.8	1.7e-24
WP_054066364.1|2800691_2801006_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	78.4	2.7e-42
WP_054066365.1|2801009_2801585_+	DUF3486 family protein	NA	Q5ZQY6	Pseudomonas_phage	59.9	6.0e-48
WP_054066366.1|2801584_2803126_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	50.4	3.7e-129
WP_054066367.1|2803295_2804912_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	58.4	2.3e-166
WP_054066368.1|2804901_2806146_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	56.3	1.1e-126
WP_054066369.1|2806262_2806811_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	43.1	1.9e-27
WP_080025246.1|2806868_2808083_+	hypothetical protein	NA	A0A0U5KMY7	unidentified_phage	48.5	3.9e-73
WP_080025247.1|2808119_2808530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054065230.1|2808574_2809489_+	hypothetical protein	NA	M4SRT6	Rhodobacter_phage	48.7	3.3e-77
WP_054065231.1|2809506_2810025_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	57.0	2.1e-44
WP_054065232.1|2810021_2810462_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	45.0	2.4e-25
WP_054065233.1|2810470_2810677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054065234.1|2810706_2811501_+	hypothetical protein	NA	L7P7U8	Pseudomonas_phage	49.4	3.0e-58
WP_054065235.1|2811513_2812044_+	hypothetical protein	NA	Q5ZQX1	Pseudomonas_phage	35.2	3.4e-13
WP_114070874.1|2812190_2815106_+	hypothetical protein	NA	A0A1V0E821	Vibrio_phage	27.6	1.0e-39
WP_054065237.1|2815108_2815981_+	hypothetical protein	NA	A0A0S0N9A6	Pseudomonas_phage	43.7	2.2e-57
WP_054065238.1|2815980_2816916_+	hypothetical protein	NA	A0A0M3MX86	Stenotrophomonas_phage	33.9	5.9e-37
WP_162777356.1|2817122_2818631_+	hypothetical protein	NA	Q5ZQW3	Pseudomonas_phage	49.6	1.7e-134
WP_054065240.1|2818627_2819446_+	DUF2163 domain-containing protein	NA	A0A0U3DZV3	Pseudomonas_phage	38.6	3.9e-45
WP_054065241.1|2819455_2819671_+	hypothetical protein	NA	Q6UYJ6	Burkholderia_phage	60.3	1.6e-17
WP_054065283.1|2819689_2819944_+	hypothetical protein	NA	Q5ZQW0	Pseudomonas_phage	62.5	3.8e-15
WP_054065242.1|2819933_2822105_+	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	47.9	2.7e-186
WP_080025249.1|2822250_2822484_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	57.4	1.2e-10
WP_054065243.1|2822404_2823196_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	71.6	1.1e-111
WP_080025250.1|2823205_2823919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080025251.1|2824107_2824761_-	hypothetical protein	NA	F8J196	Lactobacillus_virus	53.9	3.6e-25
>prophage 3
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	2849513	2859220	3547915	capsid,head,portal	Aurantimonas_phage(33.33%)	8	NA	NA
WP_080025256.1|2849513_2851097_+|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	35.7	4.3e-72
WP_054065270.1|2851093_2852449_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.8	2.2e-53
WP_054065271.1|2852479_2852860_+|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	48.3	8.0e-17
WP_054065272.1|2852889_2853930_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	43.4	4.1e-71
WP_054065273.1|2853944_2854283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054065274.1|2854269_2854674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054065287.1|2854696_2855500_+	hypothetical protein	NA	A0A2D1GMD2	Marinobacter_phage	40.1	5.6e-44
WP_054065275.1|2855596_2859220_+	tape measure protein	NA	A0A2D1GNK1	Pseudomonas_phage	34.5	7.9e-29
>prophage 4
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	2934899	2944338	3547915		Faecalibacterium_phage(16.67%)	7	NA	NA
WP_054066593.1|2934899_2938382_-	type I restriction-modification system endonuclease	NA	A0A2K9V3E9	Faecalibacterium_phage	24.8	4.5e-13
WP_054066607.1|2939093_2939321_+	glutaredoxin-like protein NrdH	NA	A0A160DD22	Gordonia_phage	43.2	1.9e-10
WP_054066594.1|2939324_2939753_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.3	6.5e-07
WP_054066595.1|2939749_2941882_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.9	2.3e-209
WP_054066596.1|2941894_2942854_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	69.2	8.8e-129
WP_080025384.1|2943076_2943613_+	DUF2796 domain-containing protein	NA	NA	NA	NA	NA
WP_054066609.1|2943621_2944338_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.8	2.1e-18
>prophage 5
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	3134712	3163768	3547915	capsid,tail,terminase	Pseudomonas_phage(36.84%)	36	NA	NA
WP_162777478.1|3134712_3135951_-	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	30.0	2.0e-24
WP_054067865.1|3135947_3136700_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	33.1	7.1e-17
WP_054067864.1|3136699_3137137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162777477.1|3137133_3142782_-	DUF1983 domain-containing protein	NA	C4ML20	Xanthomonas_virus	43.6	4.6e-201
WP_054067862.1|3143171_3143702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067861.1|3143721_3144123_-	hypothetical protein	NA	I7HBC4	Xanthomonas_virus	39.0	7.9e-15
WP_054067860.1|3144122_3144587_-	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	40.0	1.2e-27
WP_080025388.1|3144583_3144859_-	hypothetical protein	NA	Q52PL1	Xanthomonas_phage	36.7	4.2e-07
WP_080025286.1|3144940_3147799_-|tail	phage tail tape measure protein	tail	A0A059VJZ1	Pseudomonas_phage	33.0	1.1e-17
WP_080025287.1|3147858_3148068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080025288.1|3148078_3148414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067855.1|3148470_3148920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067854.1|3148932_3149472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067853.1|3149570_3149900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067852.1|3149899_3150232_-	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	39.8	3.7e-10
WP_054067851.1|3150320_3150974_-	hypothetical protein	NA	A0A0H5BBY3	Pseudomonas_phage	40.0	1.3e-30
WP_054067850.1|3151053_3151452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067849.1|3151448_3151844_-	HK97 gp10 family phage protein	NA	A0A088FBW9	Salmonella_phage	38.9	1.3e-17
WP_054067848.1|3151843_3152224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067847.1|3152227_3152644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162777476.1|3152647_3152809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162777475.1|3152846_3153839_-|capsid	phage major capsid protein	capsid	A0A2I6PG17	Plesiomonas_phage	60.2	1.1e-105
WP_054067878.1|3153854_3154559_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	62.9	6.2e-63
WP_054067845.1|3154728_3155241_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	46.6	2.5e-21
WP_054067844.1|3155352_3155655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067843.1|3155668_3156778_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	48.8	2.1e-97
WP_080025390.1|3156777_3158115_-	DUF4055 domain-containing protein	NA	A0A125SA34	Pseudomonas_phage	37.9	4.9e-69
WP_054067841.1|3158163_3159438_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	65.4	8.3e-159
WP_054067840.1|3159424_3159922_-|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	60.7	1.4e-45
WP_054067839.1|3159970_3160195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054067838.1|3160589_3160946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067836.1|3161215_3161422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080025289.1|3161418_3161892_-	DUF1367 family protein	NA	NA	NA	NA	NA
WP_054067834.1|3161888_3162389_-	hypothetical protein	NA	G9BW80	Planktothrix_phage	31.7	1.4e-08
WP_054067877.1|3162414_3162870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067833.1|3162886_3163768_-	helix-turn-helix domain-containing protein	NA	F8TUJ5	EBPR_podovirus	35.8	7.6e-10
>prophage 6
NZ_CP020121	Comamonas kerstersii strain 8943 chromosome, complete genome	3547915	3455401	3516486	3547915	plate,capsid,head,tail,protease,terminase,tRNA,integrase,portal	Burkholderia_phage(34.38%)	67	3477128:3477148	3511508:3511528
WP_054066059.1|3455401_3456808_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054066058.1|3456804_3458019_-	O-succinylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.5	1.2e-16
WP_054066057.1|3458201_3459710_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.5	3.2e-85
WP_054066056.1|3459787_3460279_-	CvpA family protein	NA	NA	NA	NA	NA
WP_054066055.1|3460311_3461178_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054066054.1|3461201_3462527_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_054066062.1|3462574_3462943_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_054066053.1|3463073_3463886_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_054066052.1|3463975_3464293_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_054066051.1|3464381_3465713_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	80.2	5.8e-54
WP_054066050.1|3465895_3467893_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	3.5e-79
WP_054066049.1|3468126_3468747_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	29.6	1.0e-16
WP_054066048.1|3469293_3470628_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	3.0e-26
WP_114070906.1|3470624_3471728_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_114070905.1|3471847_3472864_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_054066046.1|3473159_3473849_+	DUF3334 family protein	NA	NA	NA	NA	NA
WP_054066045.1|3474027_3476253_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	3.3e-17
WP_054066044.1|3476289_3476907_-	hypothetical protein	NA	NA	NA	NA	NA
3477128:3477148	attL	GTGGTGCCCCGAGCCGGAATC	NA	NA	NA	NA
WP_080025313.1|3477509_3477707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066042.1|3477967_3478456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066041.1|3478563_3478941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066040.1|3479031_3479580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066039.1|3479788_3480820_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	56.8	8.6e-106
WP_080025399.1|3480820_3482704_-|terminase	terminase	terminase	E5FFI8	Burkholderia_phage	66.0	5.2e-226
WP_054066038.1|3482859_3483705_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	48.9	5.0e-59
WP_054066037.1|3483750_3484767_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	57.4	1.3e-98
WP_054066036.1|3484859_3485591_+	hypothetical protein	NA	K4NX86	Burkholderia_phage	44.9	2.4e-41
WP_054066035.1|3485701_3486190_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	49.4	4.6e-33
WP_054066034.1|3486195_3486408_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	58.5	7.1e-15
WP_054066033.1|3486410_3486695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066032.1|3486691_3487246_+	lysozyme	NA	NA	NA	NA	NA
WP_054066031.1|3487242_3487797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054066030.1|3487780_3488281_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	35.4	2.7e-20
WP_054066029.1|3488284_3488737_+	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	39.7	8.0e-24
WP_162777393.1|3488789_3489506_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_054066027.1|3489505_3489844_+	hypothetical protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	51.8	6.6e-23
WP_054066026.1|3489840_3490701_+	hypothetical protein	NA	A0A218M4K5	Erwinia_phage	42.0	1.9e-53
WP_054066025.1|3490693_3491335_+|tail	phage tail protein I	tail	A4PE44	Ralstonia_virus	38.5	1.8e-24
WP_080025315.1|3491331_3493584_+	hypothetical protein	NA	A0A0A7RTP0	Clostridium_phage	40.6	2.1e-27
WP_054067027.1|3493822_3494167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054067026.1|3494267_3495461_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	63.2	7.3e-141
WP_054067025.1|3495492_3496002_+|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	52.1	6.5e-46
WP_054067024.1|3496073_3496376_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	54.8	1.6e-20
WP_080025316.1|3496384_3496513_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_054067023.1|3496518_3499458_+|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	30.3	7.5e-46
WP_054067022.1|3499486_3499933_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	56.3	5.0e-34
WP_054067021.1|3499937_3500948_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	50.2	3.0e-71
WP_162777450.1|3500951_3501716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054067019.1|3501718_3502039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162777449.1|3502041_3503349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080025318.1|3503403_3503739_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	43.5	2.6e-11
WP_054067017.1|3503838_3504057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080025319.1|3504069_3504570_+	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	52.0	3.8e-14
WP_054067016.1|3504681_3505035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162777447.1|3505031_3505184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162777446.1|3505183_3505399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054067015.1|3505589_3505991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054067014.1|3505999_3507916_+	replication protein A	NA	A4JWW0	Burkholderia_virus	39.9	2.9e-70
WP_054067013.1|3507941_3508178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162777445.1|3508246_3508489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162781742.1|3508542_3508773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054067010.1|3508795_3509023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080025320.1|3509215_3509590_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054067009.1|3509586_3510306_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054067008.1|3510306_3511323_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	39.8	8.9e-47
WP_054067007.1|3512658_3515100_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	4.4e-217
3511508:3511528	attR	GTGGTGCCCCGAGCCGGAATC	NA	NA	NA	NA
WP_054067006.1|3515223_3516486_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	5.6e-131
