The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	528413	568987	4992088	protease,transposase	Stx2-converting_phage(36.36%)	30	NA	NA
WP_000080195.1|528413_530027_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001069668.1|531783_532656_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001305029.1|533987_535478_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001296389.1|535598_536171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309742.1|536256_536517_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071528377.1|537410_537560_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001547002.1|537892_538090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221563.1|538288_538858_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271011.1|539024_539408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997995.1|539628_541167_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|542294_542645_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|542641_543067_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|543438_543576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|543727_544645_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|544678_545554_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|545602_547075_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|547078_547909_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|547954_548665_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|548677_549787_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|549848_550772_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|550807_551542_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|551641_552628_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|552779_554007_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|554507_556598_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|557429_557702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|557992_558352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|558355_558571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212789.1|562448_563303_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|563351_564503_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|565099_568987_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 2
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	871602	878742	4992088		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|871602_872241_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|872237_873500_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|873496_874405_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001272542.1|874570_875368_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141293.1|875418_876075_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|876180_878742_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	1455297	1464742	4992088		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1455297_1456224_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1456228_1456960_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1456940_1457048_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1457107_1457839_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1458060_1459746_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1459742_1460462_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1460508_1460979_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1461019_1461481_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1461605_1463609_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1463605_1464742_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 4
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	1558918	1565221	4992088		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1558918_1560313_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1560487_1561381_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1561753_1562839_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1562838_1563738_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1563795_1564674_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1564678_1565221_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 5
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	1588368	1640615	4992088	transposase	Stx2-converting_phage(14.29%)	52	NA	NA
WP_001531805.1|1588368_1588827_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|1588937_1590365_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|1590573_1591740_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|1591858_1592332_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|1592529_1593588_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1593759_1594089_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|1594189_1594372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1594860_1594974_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1594986_1595181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|1595177_1595552_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|1595640_1596009_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|1596024_1596669_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1596687_1596909_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1596971_1597448_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1597463_1597937_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1598030_1598276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1598275_1599094_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1599314_1599725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1600173_1600920_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1600934_1602476_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1602590_1603004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1603139_1604210_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1604206_1605112_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|1605108_1607493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|1607710_1608145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1608573_1610739_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|1610749_1611739_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|1611757_1612816_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|1612812_1613580_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|1613633_1613891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|1614421_1615567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|1616766_1616946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|1617091_1618114_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|1618113_1618806_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000813432.1|1619831_1620434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|1620527_1620806_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|1620929_1622126_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001336659.1|1622889_1623066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221519.1|1623705_1624275_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271042.1|1624440_1624842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221618.1|1624829_1625240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656349.1|1627554_1628589_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739817.1|1628591_1629557_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066372.1|1629610_1630369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667429.1|1630382_1631597_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000589885.1|1632598_1633372_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_077249421.1|1633373_1633955_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000854360.1|1633932_1635129_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001297930.1|1635142_1635796_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_001542270.1|1636843_1638067_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
WP_000502870.1|1638051_1638696_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_000080195.1|1639001_1640615_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 6
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	1735224	1823470	4992088	portal,terminase,holin,integrase,tail,plate,tRNA,capsid,transposase	Escherichia_phage(22.73%)	103	1735039:1735098	1777651:1777775
1735039:1735098	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|1735224_1736241_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|1736209_1736473_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|1736682_1736865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|1736864_1737434_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|1737430_1739647_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|1739677_1739998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|1741008_1741422_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|1741520_1741751_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|1741809_1742286_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|1742325_1742550_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|1742546_1743302_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|1743291_1744707_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|1744745_1745156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|1745157_1745394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1745390_1745702_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|1745698_1745923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|1746604_1747393_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|1747567_1748491_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|1749679_1750378_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|1750840_1751446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1751455_1751944_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|1752342_1752576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1752819_1753461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|1753612_1753792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|1753869_1754466_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|1754462_1754756_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|1754755_1755427_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|1755539_1755923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|1755922_1756195_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|1756194_1756674_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|1756681_1756876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|1756935_1757181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|1757549_1758116_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|1758102_1759965_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|1759964_1760198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|1760194_1761769_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|1761768_1763076_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|1763075_1763405_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|1763463_1764498_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|1764532_1764952_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|1764948_1765329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1765360_1766041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|1766037_1766574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|1766554_1767457_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|1767459_1767801_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|1767797_1768718_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|1768720_1769347_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|1769339_1770524_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|1770523_1770913_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|1770909_1772412_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|1772429_1772942_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|1772954_1773236_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|1773344_1774985_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|1775020_1775410_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|1775571_1775796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|1777010_1777430_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|1777901_1778567_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1777651:1777775	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|1778617_1779829_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|1780019_1780259_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|1780296_1780794_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|1780965_1781289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|1781552_1781639_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|1781753_1782005_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|1782082_1782586_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|1783380_1784370_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|1784439_1785954_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000987895.1|1785965_1786955_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|1787121_1787922_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|1787896_1789321_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|1789327_1789756_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|1790535_1790886_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|1790888_1791467_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|1791593_1792481_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|1792477_1793404_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|1793408_1795373_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|1795393_1795897_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|1796041_1797703_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|1797993_1798854_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|1798856_1799906_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1799920_1800310_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|1800320_1800965_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|1801153_1802302_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|1802294_1804373_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|1804372_1804765_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|1804817_1806551_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|1806766_1807333_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|1807346_1808093_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|1808480_1809581_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|1809605_1812035_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|1812070_1813042_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1813038_1813782_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1813822_1814218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|1814270_1815089_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|1815085_1815652_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|1815961_1817734_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|1817726_1818179_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|1818207_1818948_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1818982_1819504_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|1819505_1820108_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|1820178_1820244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1820382_1820994_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|1821002_1822013_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|1822122_1823470_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 7
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	2315191	2384906	4992088	portal,terminase,holin,tail,integrase,head,protease,capsid,transposase	Stx2-converting_phage(25.0%)	78	2344077:2344091	2385870:2385884
WP_000422062.1|2315191_2316241_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2316460_2317219_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2317215_2317806_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2317862_2318171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|2318180_2319167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|2319372_2320248_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|2320460_2322356_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2322383_2323004_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2323000_2323882_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2324019_2324064_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2324155_2325718_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|2325717_2327313_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|2327316_2328675_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2328686_2329880_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2329879_2330686_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2331061_2331337_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2331333_2331891_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|2332302_2332572_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2332628_2333297_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2333495_2333678_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|2333803_2334772_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|2334787_2335315_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|2335345_2335879_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|2335880_2338706_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|2339167_2339914_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2339928_2341470_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|2342110_2345584_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
2344077:2344091	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|2345926_2346559_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|2346504_2347248_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|2347258_2347957_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2347956_2348298_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2348290_2351533_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2351580_2351790_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2351885_2352260_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2352274_2352991_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2353057_2353402_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2353398_2353845_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2353841_2354192_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2354201_2354528_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2354524_2357110_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2357055_2357277_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2357321_2359259_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2359322_2360984_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2360980_2361544_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2361834_2362200_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2362241_2362442_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2362640_2362856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2362941_2363127_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2363348_2363435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2363989_2364523_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|2364628_2364901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2364866_2365211_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2365215_2365431_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2365581_2367435_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2367695_2368031_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2368311_2368443_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2369244_2370294_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2370445_2370643_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2370869_2371691_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2371687_2372068_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2372068_2373124_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2373125_2373398_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2373565_2373778_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2373958_2374624_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2374798_2375224_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2375239_2376010_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2376031_2376778_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2376784_2377747_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2377769_2378195_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2378191_2378407_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2378456_2379173_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2379445_2379601_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2379760_2379979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2380544_2380733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2380729_2380921_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2381013_2383485_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2383549_2383798_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2383775_2384906_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2385870:2385884	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 8
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	2526183	2571892	4992088	portal,terminase,holin,lysis,tail,integrase,head,tRNA,capsid	Enterobacteria_phage(56.0%)	58	2544967:2544981	2573561:2573575
WP_000654172.1|2526183_2526462_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|2526458_2528480_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|2528538_2532021_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|2532081_2532684_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|2532620_2533364_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|2533368_2534067_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|2534066_2534396_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|2534392_2536954_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|2536946_2537381_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|2537362_2537785_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|2537800_2538541_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|2538548_2538944_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|2538940_2539519_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|2539530_2539884_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|2539895_2540294_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|2540335_2541361_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|2541416_2541749_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2541758_2543078_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2543058_2544660_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2544656_2544863_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|2544859_2546785_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
2544967:2544981	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|2546759_2547305_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|2547868_2548051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2548257_2548584_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2549064_2549358_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2549448_2549631_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2549847_2550324_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2550310_2550616_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|2550937_2551627_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|2551623_2551764_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|2551760_2552123_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|2552119_2552410_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|2552402_2552573_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|2552572_2553028_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|2553024_2553126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2553475_2554519_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|2554555_2558821_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|2559070_2559772_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|2559768_2560698_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|2560784_2561324_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|2561393_2561624_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|2561662_2562418_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|2563013_2563220_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|2563295_2563592_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|2563597_2564383_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2564379_2565060_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2565056_2565239_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2565211_2565403_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|2565413_2565695_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|2565793_2566015_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2566014_2566341_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2566324_2566564_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2566703_2566940_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2566929_2568072_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2568185_2569436_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|2569607_2570261_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2570270_2570732_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2570785_2571892_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2573561:2573575	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 9
NZ_CP020116	Escherichia coli strain AR_0104 chromosome, complete genome	4992088	2769000	2895550	4992088	portal,terminase,holin,protease,tail,integrase,plate,head,tRNA,capsid,transposase	Enterobacteria_phage(41.0%)	146	2838928:2838947	2877585:2877604
WP_001295930.1|2769000_2769786_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|2769921_2770701_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|2770677_2771571_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|2771724_2772471_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|2772467_2772650_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|2772701_2773934_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|2773970_2774957_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|2774953_2776702_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|2776738_2779003_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2779208_2779493_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2779652_2781326_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2781436_2782120_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|2782292_2783075_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|2783218_2783608_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|2783579_2784029_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|2784030_2784237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|2784226_2784457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2784453_2785137_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|2785133_2785349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|2785363_2785660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|2785669_2785942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2786230_2786761_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|2786788_2787058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|2787060_2788227_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|2788237_2790007_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|2790022_2790340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|2790339_2791260_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|2791270_2791579_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|2791631_2791820_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|2791913_2792270_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|2792386_2793151_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|2793341_2793557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|2793555_2793960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|2793935_2794664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|2794794_2795145_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|2795147_2795888_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|2795871_2796522_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|2796518_2796845_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|2796844_2797156_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2797155_2797701_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_001295924.1|2797760_2799293_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000090684.1|2799292_2800789_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|2800769_2801591_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|2801593_2802052_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|2802266_2803382_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|2803396_2804350_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|2804359_2804698_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2804699_2805146_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2805145_2805610_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|2805606_2805861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|2805850_2807278_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|2807277_2807799_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|2807801_2808083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|2808180_2808516_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2808439_2808598_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|2808673_2811625_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|2811624_2812509_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|2812505_2812721_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|2812708_2813863_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|2813859_2814456_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|2814510_2814858_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|2814848_2815952_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|2815944_2816523_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|2816525_2817857_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|2817856_2818471_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|2818477_2818939_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000080195.1|2819153_2820767_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2820797_2821148_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2821144_2821570_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000904922.1|2821989_2822562_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|2822817_2824101_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|2824171_2825260_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|2825458_2826151_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|2826280_2828041_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|2828446_2829304_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2829358_2831641_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2831832_2832573_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|2832669_2833818_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|2834131_2834758_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|2834793_2835657_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|2835658_2836276_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|2836286_2838731_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
2838928:2838947	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023739.1|2839030_2840023_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|2840092_2840434_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|2840538_2841060_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|2841064_2841487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|2841493_2841685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|2841822_2842173_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|2842183_2842462_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|2842473_2842716_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|2842712_2842826_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|2842919_2843330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2843353_2843557_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|2843553_2843820_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|2843816_2844116_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|2844127_2844745_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000599382.1|2844741_2845107_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|2845113_2847936_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|2848012_2848972_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|2848976_2849291_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|2849374_2850217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|2850256_2850754_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|2851477_2852002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|2852016_2853063_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|2853062_2854814_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|2854968_2855805_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|2855828_2856881_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|2856926_2857727_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|2857828_2858323_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|2858322_2858523_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|2858525_2858849_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|2858845_2859238_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|2859234_2859630_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|2859768_2861646_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|2861669_2862137_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|2862129_2862765_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|2862761_2863343_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|2863339_2863690_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|2863693_2864590_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|2864582_2865113_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_021538277.1|2865115_2867101_+|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000972134.1|2867103_2867637_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|2867665_2868193_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_023363133.1|2868194_2868980_-	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000905061.1|2869207_2869807_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|2869835_2870324_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|2870336_2873144_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|2873130_2873286_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|2873294_2873669_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|2873724_2874237_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|2874236_2875421_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|2875578_2876688_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|2876728_2876989_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2877180_2877321_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|2877626_2878919_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
2877585:2877604	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|2879009_2880353_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2880363_2880975_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|2881133_2885240_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2885374_2885869_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|2886412_2887378_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|2887500_2889267_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|2889267_2890989_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|2891030_2891735_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2892019_2892238_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2892922_2895199_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2895229_2895550_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 1
NZ_CP020117	Escherichia coli strain AR_0104 plasmid unitig_5, complete sequence	107210	2714	54231	107210	transposase,protease	Escherichia_phage(30.77%)	54	NA	NA
WP_001067858.1|2714_3419_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000117179.1|3513_5472_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000845940.1|5526_5961_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276232.1|5957_6677_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_085947770.1|6922_8291_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001312861.1|8402_8561_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032143370.1|9061_9250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|9482_9770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|9888_10710_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000243712.1|11006_11609_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151566.1|11939_12323_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001348626.1|12456_13134_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_072277695.1|13221_13443_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001348757.1|14238_14559_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001617873.1|14685_14970_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059829.1|14956_15502_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_071571857.1|15431_15779_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001348758.1|15726_16152_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_000944328.1|16138_17512_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007062.1|17508_20328_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000605862.1|20346_20844_+	entry exclusion protein	NA	NA	NA	NA	NA
WP_000850429.1|20875_21607_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199914.1|21809_22589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047605472.1|22585_24811_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001617867.1|24810_30081_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205718.1|30100_30847_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|30901_31462_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|31592_31805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|32141_32567_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|32563_32914_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|32944_34558_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_023144756.1|34993_35128_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083850.1|35424_35679_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_031943482.1|35915_35990_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001617855.1|35982_36840_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|37779_38433_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|38525_38783_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|38715_39117_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|39401_40712_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|40988_41849_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|42147_42852_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065897011.1|43167_44079_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|44110_45310_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|45415_46042_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|46073_46310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|46363_47200_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|47199_48003_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|48063_48879_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_024192851.1|49186_49399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|49423_50128_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|50249_51155_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|51151_52390_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|52389_52974_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|53466_54231_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP020117	Escherichia coli strain AR_0104 plasmid unitig_5, complete sequence	107210	85739	89952	107210		Escherichia_phage(66.67%)	6	NA	NA
WP_080029215.1|85739_86132_-	pdcB	NA	A0A077SLM1	Escherichia_phage	82.1	6.5e-46
WP_001513661.1|86159_86339_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|86343_86724_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|86723_86945_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|87127_88684_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|88680_89952_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
>prophage 1
NZ_CP020118	Escherichia coli strain AR_0104 plasmid unitig_6, complete sequence	111212	0	38754	111212	portal,tail,terminase,tRNA	Salmonella_phage(92.31%)	44	NA	NA
WP_097638511.1|699_1365_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	93.1	5.9e-23
WP_000506720.1|2166_2556_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000004356.1|2593_3694_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_061093517.1|3851_5885_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_050586635.1|6124_6346_+	hypothetical protein	NA	J9Q750	Salmonella_phage	53.7	1.9e-15
WP_023908297.1|6516_7707_+	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
WP_162781834.1|9303_9519_+	hypothetical protein	NA	J9Q804	Salmonella_phage	88.7	9.4e-31
WP_049076861.1|9657_9987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|10141_10453_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_032217431.1|10579_10975_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	2.4e-32
WP_001351976.1|11056_11467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001711139.1|11802_12084_+	hypothetical protein	NA	J9Q753	Salmonella_phage	80.6	9.4e-39
WP_001009193.1|12287_12770_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_000470243.1|13386_13617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273880.1|13664_14315_-	hypothetical protein	NA	J9Q754	Salmonella_phage	86.1	6.9e-101
WP_061093519.1|14597_14777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208379.1|14909_15434_-	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_052988639.1|15438_15861_-	hypothetical protein	NA	J9Q806	Salmonella_phage	76.4	1.8e-54
WP_001291060.1|15929_16208_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
WP_061093515.1|16210_17770_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.3e-278
WP_000382660.1|17852_18533_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_000161986.1|18532_19201_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000049676.1|19197_19863_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_061093514.1|19859_20750_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.3e-166
WP_000176292.1|20759_21026_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|21222_21855_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_001007299.1|21854_23111_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_001717193.1|23137_24712_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001055285.1|24733_25621_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	89.3	7.1e-133
WP_001130339.1|25646_26522_+	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_061093513.1|26595_27516_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	80.2	1.8e-123
WP_000801187.1|27560_27995_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_000057118.1|27994_28828_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_001027663.1|28907_29252_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|29242_29716_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001755481.1|29717_30101_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	4.7e-57
WP_000072377.1|30175_30922_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_000163861.1|30977_31295_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000952686.1|31420_31645_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_061093512.1|31652_36224_+	tape measure protein	NA	J9Q712	Salmonella_phage	85.7	0.0e+00
WP_061093511.1|36266_36602_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.0e-52
WP_000511445.1|36684_37383_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000526939.1|37375_38173_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_061093510.1|38160_38754_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.4	3.4e-99
>prophage 2
NZ_CP020118	Escherichia coli strain AR_0104 plasmid unitig_6, complete sequence	111212	48392	62858	111212		Salmonella_phage(87.5%)	18	NA	NA
WP_114145537.1|48392_49655_+	hypothetical protein	NA	J9Q6E3	Salmonella_phage	60.6	3.1e-97
WP_053271986.1|49721_50504_+	receptor-recognizing protein	NA	C4MYP9	Escherichia_phage	84.2	5.4e-52
WP_000064173.1|50578_50902_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_032084069.1|50915_51608_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	94.3	1.0e-123
WP_000901559.1|51609_51861_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_000072677.1|52029_52551_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001351987.1|52558_52828_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000161228.1|53146_53815_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160394000.1|53820_54174_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.2e-44
WP_061093507.1|54225_55932_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.1	2.2e-13
WP_053271988.1|56113_56854_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	8.3e-127
WP_000137333.1|56897_58238_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_024175975.1|58385_59498_+	hypothetical protein	NA	J9Q720	Salmonella_phage	93.8	2.6e-209
WP_023145136.1|59576_60353_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.4e-52
WP_001718054.1|60633_60891_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
WP_023145134.1|60887_62210_+	ATP-dependent DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	1.8e-241
WP_000636536.1|62206_62422_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_000067985.1|62567_62858_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
>prophage 3
NZ_CP020118	Escherichia coli strain AR_0104 plasmid unitig_6, complete sequence	111212	65918	71862	111212	integrase	Salmonella_phage(50.0%)	6	62418:62437	72289:72308
62418:62437	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_000156433.1|65918_66164_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_000797845.1|66375_67479_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282576.1|67473_67860_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001098353.1|68111_68324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023145131.1|68422_70531_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.0	2.5e-229
WP_021520134.1|70626_71862_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.0	6.7e-198
72289:72308	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
>prophage 4
NZ_CP020118	Escherichia coli strain AR_0104 plasmid unitig_6, complete sequence	111212	75864	111058	111212	transposase	Salmonella_phage(90.0%)	41	NA	NA
WP_024175973.1|75864_76080_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	75.7	3.8e-24
WP_001240351.1|76409_76973_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_001090697.1|77512_77944_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_000047684.1|78061_79090_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001755518.1|79150_80095_+	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_000920224.1|80094_80361_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_160378289.1|80408_81437_+	recombinase	NA	J9Q736	Salmonella_phage	94.7	1.1e-188
WP_021533191.1|81529_81730_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_000715581.1|81733_82564_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_023145172.1|82655_83081_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_001755515.1|83136_83412_+	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.0e-33
WP_000644408.1|83627_83963_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001229345.1|83962_84175_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001293471.1|84664_85720_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
WP_000364573.1|86462_87107_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000174803.1|87362_88448_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_001404451.1|88677_90594_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	4.5e-249
WP_000008655.1|90583_91327_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
WP_000037962.1|91336_91906_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_016607527.1|91979_94295_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000122502.1|94400_95543_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011861.1|95620_96490_+	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_024175984.1|96661_97765_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.5	8.4e-192
WP_012640765.1|97766_98180_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.9	1.6e-63
WP_160378288.1|98182_98653_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	2.8e-80
WP_061093506.1|98652_99297_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	2.3e-96
WP_014962280.1|99358_99778_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
WP_061093505.1|99787_100342_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	78.1	8.2e-79
WP_085949154.1|101119_102267_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000559568.1|102748_103342_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_032203380.1|103527_103758_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
WP_162630521.1|104288_104936_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.3	1.1e-98
WP_032203382.1|105081_105576_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	54.5	5.7e-23
WP_021533180.1|105585_105783_+	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
WP_021533179.1|105876_106302_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
WP_014962273.1|106301_106460_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001718087.1|106599_107169_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_000467662.1|107508_108123_+	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_021520151.1|108226_109912_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_001061713.1|109973_110678_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.9	1.0e-86
WP_061093518.1|110677_111058_+	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
>prophage 1
NZ_CP020119	Escherichia coli strain AR_0104 plasmid unitig_7, complete sequence	51515	39769	48159	51515	transposase,integrase	Burkholderia_phage(42.86%)	8	41692:41709	48876:48893
WP_001749982.1|39769_40489_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|41218_41788_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
41692:41709	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|42180_43194_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|43349_43823_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|44043_44310_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|44452_45217_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|45477_46692_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|46725_48159_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
48876:48893	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
