The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	91900	102787	5407749		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|91900_95008_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|95062_96328_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|96358_97447_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|97533_97794_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|98091_98952_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|98972_99734_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|99994_100897_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_022644633.1|100908_102174_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|102166_102787_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	330283	470216	5407749	terminase,transposase,tail,integrase,holin	Klebsiella_phage(24.07%)	165	322822:322839	478656:478673
322822:322839	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004152576.1|330283_331150_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|331149_331923_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|331919_333116_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|333115_333469_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|333470_334124_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|334177_334744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|334786_334969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|335018_335360_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|335359_336382_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|336384_336687_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|336687_337287_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|337286_339290_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|339279_339432_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|339467_339893_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|340219_341411_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|341352_341643_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|341653_342799_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|342802_343243_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|343337_343724_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|343723_344230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|344226_344646_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|344614_344896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|344935_345877_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|345888_346383_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|346386_347589_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|347640_348189_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|348244_349696_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|349933_351334_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|351284_352037_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|352138_352459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|352693_353083_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|353079_353610_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|353612_353861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|354266_355049_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|355045_355522_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|355518_356481_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|356482_358141_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|358717_358939_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|359036_359705_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|359875_360190_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|360182_360371_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|360540_360906_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|360898_361153_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|361124_361343_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|361339_361765_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|361761_361956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|361952_362780_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|362884_363403_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|363408_364119_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|364108_364333_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|364329_364542_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|364538_365018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|365196_365439_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|365419_366601_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|366797_367346_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|367544_369077_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|369293_370055_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|370163_371078_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|371378_371567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|371637_371946_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|372113_372983_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|373061_374264_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|374336_375473_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|375645_376530_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|376654_377488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|377718_378105_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|378272_379889_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|380074_380782_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|380778_381744_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|381846_382353_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|382423_383446_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|383577_385119_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|385291_386605_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|386736_387618_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|387707_388769_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|388765_390163_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|390265_390484_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|390512_390872_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|390871_391096_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|391151_391820_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|391987_392962_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|392952_394344_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|394369_395539_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|395710_398020_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|397998_398829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|398939_399845_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|400178_401822_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|401818_402784_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|402988_403660_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|403846_404674_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|404749_406015_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|406016_406436_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|406515_408000_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|408897_409320_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|409912_410617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|410793_411558_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|411941_412082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|412064_412565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|412692_413532_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|413525_413873_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|414036_414828_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|414973_415933_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|415823_416528_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|416776_418720_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|418961_419561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|419785_420517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|420520_423475_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|423551_426620_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|426616_426997_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|427006_427489_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|427669_428134_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_000019473.1|428692_429673_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000019473.1|430174_431155_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|431267_434165_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|434426_434618_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|434842_435199_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|435275_435482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|435619_436102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|436155_437328_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|437351_437744_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|437740_438292_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|438293_438677_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|438663_438897_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|438906_439161_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|439162_439558_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|439879_440833_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|440843_441629_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|442159_443272_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|443255_444656_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|444655_445963_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|445940_446945_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|447807_448053_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|449011_449287_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|449283_449628_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|449624_450164_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|450160_450460_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|450938_451985_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|452210_452900_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|452899_453040_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|453036_453675_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|453667_454336_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|454332_454500_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|454480_454948_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|455468_456497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|456704_456950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|457005_457308_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|457304_458153_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|458149_459010_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|459095_459317_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|459357_459585_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|459696_460395_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|460417_460537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|460682_461759_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|461840_462044_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|462472_462667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|462755_463040_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|463055_463901_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|463897_464185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|464186_464867_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|464863_465292_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|465288_465951_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|466158_467346_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|467522_468413_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|468412_469405_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|469406_470216_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
478656:478673	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 3
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	759182	775262	5407749		Salmonella_phage(50.0%)	14	NA	NA
WP_004199491.1|759182_759458_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
WP_004199521.1|759431_760001_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	86.8	3.9e-84
WP_071784388.1|760124_761621_+	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	34.5	7.9e-68
WP_022644621.1|761819_762014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644622.1|762024_763536_-	hypothetical protein	NA	H6X4Y6	Enterobacteria_phage	33.5	1.3e-57
WP_004199504.1|764533_764686_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_009308366.1|764682_765213_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
WP_004191039.1|765209_765749_-	lysozyme	NA	H6WRZ4	Salmonella_phage	78.1	1.0e-81
WP_004191041.1|765750_765966_-	hypothetical protein	NA	A5LH82	Enterobacteria_phage	55.9	1.4e-10
WP_022644619.1|766178_767429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127897200.1|767876_768200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644617.1|768196_770914_-	hypothetical protein	NA	Q858F8	Salmonella_phage	51.2	8.5e-262
WP_022644616.1|770913_772755_-	hypothetical protein	NA	Q858F9	Salmonella_phage	33.4	9.4e-79
WP_022644615.1|772754_775262_-	transglycosylase SLT domain-containing protein	NA	Q858G0	Salmonella_phage	26.4	7.6e-55
>prophage 4
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	780378	803034	5407749	tail,integrase,head	Pectobacterium_phage(28.57%)	33	771158:771172	804118:804132
771158:771172	attL	AACTGCGCAAACTGA	NA	NA	NA	NA
WP_004191050.1|780378_780852_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_004191051.1|780890_781886_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004199538.1|781896_782634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199528.1|782620_782944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141558.1|782946_784611_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004199513.1|784610_786005_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.4	2.4e-58
WP_004199526.1|786089_786542_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.1e-49
WP_004199477.1|786548_786809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|786792_787026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199492.1|787087_787612_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	2.5e-45
WP_004199525.1|787652_788093_-	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_022644607.1|788098_788446_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071570746.1|788433_788757_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_004199500.1|788746_789340_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_029499143.1|789408_789600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409673.1|789780_790119_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	8.6e-47
WP_022644604.1|790131_790749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141582.1|790745_790976_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_022644602.1|791695_792481_-	chromosome partitioning protein ParB	NA	C7BGF1	Burkholderia_phage	54.9	7.8e-67
WP_022644601.1|792520_792754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644600.1|792757_793408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644599.1|793446_794835_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	46.6	7.5e-105
WP_022644598.1|794831_795800_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
WP_016197573.1|795817_795976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|796059_796506_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_022644596.1|796566_796761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|796841_797228_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_024623105.1|798169_798403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644594.1|798410_798656_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_022644593.1|798685_800815_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
WP_022644592.1|800814_801381_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004199480.1|801777_802002_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|802005_803034_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
804118:804132	attR	AACTGCGCAAACTGA	NA	NA	NA	NA
>prophage 5
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	890683	983634	5407749	terminase,lysis,tail,protease,plate,portal,integrase,capsid,tRNA,head	Salmonella_phage(56.9%)	93	946209:946227	983709:983727
WP_002898139.1|890683_891976_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|892066_893410_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|893418_894030_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|894152_898406_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|898541_899036_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|899541_900537_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|900651_902418_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|902418_904140_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|904184_904886_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|905239_905458_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|905578_907858_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|907888_908206_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|908531_908753_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|908829_910770_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|910766_911882_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|912028_913687_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|914106_914802_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|914917_915817_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|915960_917613_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|917623_918592_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|918803_919238_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|919389_921108_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|921146_922148_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|922158_923601_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|923688_924702_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|924698_925529_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|925560_926700_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|927577_928093_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|928319_929048_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|929068_929800_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|929806_930523_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|930522_931191_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|931374_932106_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|932148_933621_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|933617_934334_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|934412_935540_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|935581_936070_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|936127_936973_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|936969_937923_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|937933_939067_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|939230_940343_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|940691_941171_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|941259_942162_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|942983_943271_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|943473_943737_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|943743_944127_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|944393_946079_+	transporter	NA	NA	NA	NA	NA
946209:946227	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|946298_946517_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|946608_947709_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|947705_948191_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|948187_950815_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|950807_950927_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|950941_951241_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|951293_951809_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|951818_952991_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|953129_954206_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|954235_954439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|954435_955167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|955170_958122_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|958123_958723_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|958715_959624_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|959610_959973_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|959969_960542_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|960636_961329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|961325_961772_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|961764_962196_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|962291_962720_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|962716_963100_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|963104_963614_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|963594_963810_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|963813_964017_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|964016_964481_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|964576_965227_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|965230_966289_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|966305_967139_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|967281_969048_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|969047_970073_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|970134_971877_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|972152_972830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|972944_973178_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|973188_973377_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|973530_975945_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|975941_976799_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|976795_977023_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|977022_977256_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|977323_977665_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|977628_977829_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|977836_978346_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|978378_978600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|978745_979624_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|979635_980580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|980678_982163_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|982581_983634_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
983709:983727	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	1431961	1478337	5407749	lysis,transposase,integrase,tRNA,head	Escherichia_phage(25.93%)	64	1425174:1425220	1475409:1475455
1425174:1425220	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|1431961_1434439_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|1434425_1434821_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|1434817_1435288_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|1435287_1435707_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|1435806_1439253_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|1439345_1439849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|1439976_1440762_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_080031229.1|1440827_1441541_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|1441530_1441701_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|1441800_1442160_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|1442176_1442647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|1442940_1443195_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|1443197_1443953_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|1444128_1444806_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|1444858_1445611_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|1445679_1446072_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|1446068_1446494_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|1446496_1446859_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|1446858_1447032_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|1447031_1447412_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|1447414_1447654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|1447664_1448759_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|1448770_1449199_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|1449202_1450588_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|1450660_1451137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|1451178_1452183_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|1452157_1453579_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|1453591_1455064_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|1455063_1455666_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|1456036_1456366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|1456471_1456936_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|1456932_1457463_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|1457465_1457714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644626.1|1458450_1459497_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151283.1|1459724_1460414_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|1460410_1460941_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|1460933_1461071_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|1461067_1461703_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|1461695_1461866_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|1461865_1462321_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|1462821_1463469_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|1463641_1464484_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|1464590_1465097_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|1465093_1465387_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|1465386_1466817_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|1466806_1467706_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|1467930_1468152_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|1468192_1468426_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|1468553_1469243_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|1469593_1469809_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|1469908_1470103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|1470191_1470476_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|1470491_1471337_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|1471333_1472014_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|1472010_1472169_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|1472165_1472822_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|1472818_1473586_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|1473582_1473801_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|1473802_1474018_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|1474019_1474355_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|1474231_1475395_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|1475825_1476692_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1475409:1475455	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|1476693_1476906_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1476951_1478337_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 7
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	1687892	1699546	5407749	integrase	Enterobacteria_phage(70.0%)	13	1688342:1688356	1711399:1711413
WP_004144574.1|1687892_1688996_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1688342:1688356	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|1689006_1690260_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|1690612_1691803_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|1691790_1692741_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|1692740_1693166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|1693734_1694301_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|1694318_1694564_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|1694560_1695298_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|1695839_1696106_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|1696102_1696660_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|1696656_1696884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|1696880_1697201_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|1697212_1699546_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
1711399:1711413	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 8
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	3246202	3279460	5407749	terminase,protease,tail,portal,integrase,capsid,tRNA,head	uncultured_Caudovirales_phage(73.33%)	33	3263810:3263827	3279805:3279822
WP_002919147.1|3246202_3247150_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|3247164_3247674_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|3247802_3248927_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|3248898_3249372_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|3249397_3249940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|3249944_3250517_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|3250520_3251339_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|3251335_3251593_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|3251568_3252123_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|3257918_3258140_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|3258433_3261544_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|3261556_3262696_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|3263074_3263725_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
3263810:3263827	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|3264000_3265227_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|3265319_3266261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|3266442_3266727_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|3266737_3267517_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|3267968_3268238_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|3268230_3268419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|3268411_3268726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3268722_3269091_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|3269087_3269453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3269452_3271588_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|3271930_3272266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|3272314_3272827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|3273090_3274257_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|3274308_3274869_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|3274870_3276112_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|3276108_3276444_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|3276440_3276740_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|3276739_3277183_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|3277458_3277815_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|3277798_3279460_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
3279805:3279822	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 9
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	4483985	4490892	5407749	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|4483985_4484849_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|4484859_4485633_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|4485875_4486769_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|4487014_4488376_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|4488694_4489417_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|4489413_4490892_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 10
NZ_CP020108	Klebsiella pneumoniae strain AR_0098, complete genome	5407749	4774412	4830898	5407749	protease,plate,transposase	Staphylococcus_phage(16.67%)	52	NA	NA
WP_002910830.1|4774412_4775159_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|4775570_4776584_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|4776576_4777377_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|4777363_4777537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|4778154_4779096_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|4779189_4780179_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|4780204_4781536_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|4781563_4782772_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|4782800_4785095_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|4785525_4786641_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|4786750_4787665_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|4787674_4788952_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|4788948_4789824_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|4789820_4790540_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|4790545_4791439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|4791722_4793366_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|4793415_4793892_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|4793990_4794917_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|4795220_4796516_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|4796530_4797337_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|4797311_4798211_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|4798320_4798803_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4798993_4799692_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|4799717_4800302_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|4800371_4800701_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|4800787_4801033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|4801269_4802610_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|4802606_4803260_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|4803263_4804961_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|4807924_4809280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|4809280_4809790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|4809786_4810293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|4810529_4811039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|4812689_4813613_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|4813754_4813937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|4813933_4814263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|4814259_4814766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|4814811_4815042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004155011.1|4815147_4816257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|4816280_4816586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|4816607_4817501_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|4817684_4818578_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|4818753_4819647_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|4819822_4820713_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|4821049_4822030_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|4822153_4822390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|4822578_4822836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|4823133_4823400_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|4823403_4824561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|4824544_4827955_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|4828088_4829852_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|4829851_4830898_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP020109	Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence	169952	30602	73933	169952	transposase,integrase	Escherichia_phage(17.65%)	34	34615:34631	66876:66892
WP_000019473.1|30602_31583_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_003032875.1|31726_33202_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|33452_33884_+	silver-binding protein SilE	NA	NA	NA	NA	NA
34615:34631	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_085955172.1|35312_36519_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|37559_39557_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|39619_40897_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_020444838.1|41879_43334_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|43935_44193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152067.1|44865_45789_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|45853_46165_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000019473.1|46772_47753_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_001515717.1|49482_50223_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|50939_51950_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|52701_53868_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|53867_54839_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|57790_59062_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|59061_59487_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152765.1|59892_61377_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|61610_61841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|62361_62787_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|63023_63278_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|63312_63630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|64411_64639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198570.1|64730_64961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178068.1|65012_66368_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004152645.1|66415_66979_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
66876:66892	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_004152644.1|67754_68297_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|68345_68594_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|68663_70700_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152641.1|70766_71198_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|71194_71923_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004199358.1|71919_72246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152638.1|72301_72676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004220208.1|72853_73933_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020109	Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence	169952	116839	144362	169952	bacteriocin,transposase,integrase	Escherichia_phage(27.27%)	29	121882:121898	142769:142785
WP_004178051.1|116839_119161_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|119162_119441_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004152294.1|119709_120261_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004199332.1|120581_120860_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|121076_121154_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|121146_122004_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
121882:121898	attL	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
WP_004118217.1|123276_123912_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|123908_125021_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|125013_126402_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_016197752.1|126401_126632_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|127609_128269_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|128469_128847_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|128913_131880_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|131882_132443_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|132568_132919_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|133121_134135_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|134279_134777_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|134888_135179_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|135184_135976_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|136139_136487_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|136480_137320_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|137447_137651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|137806_139012_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|139022_139328_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|139554_140319_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|140811_141396_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|141395_142634_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|142630_143536_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
142769:142785	attR	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
WP_001067855.1|143657_144362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP020110	Klebsiella pneumoniae strain AR_0098 plasmid tig00000002, complete sequence	73467	56715	66220	73467	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_004152765.1|56715_58200_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|58608_59040_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|59039_60311_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_006797589.1|60392_61370_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|61366_62572_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|62986_63256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|63432_64299_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_001067855.1|65515_66220_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP020111	Klebsiella pneumoniae strain AR_0098 plasmid tig00000003, complete sequence	43381	28973	39271	43381	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000516402.1|28973_29636_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|30016_30679_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|30765_31005_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|31397_32102_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|32238_33099_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|33119_33881_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|34142_35045_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|36253_39271_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
