The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	0	5752	4658583		Tupanvirus(100.0%)	5	NA	NA
WP_001297659.1|188_1232_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_000339283.1|1348_1900_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001259824.1|2060_3917_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_001170162.1|4083_5100_+	asparaginase	NA	NA	NA	NA	NA
WP_001120535.1|5110_5752_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 2
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	8995	9850	4658583		Indivirus(100.0%)	1	NA	NA
WP_001186365.1|8995_9850_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.5	1.5e-10
>prophage 3
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	13168	17745	4658583		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|13168_14452_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616417.1|14598_16074_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001295489.1|16254_17745_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 4
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	32499	40606	4658583	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|32499_34185_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|34389_34971_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220987.1|35010_35706_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|35763_37674_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_080028908.1|37805_38150_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|38512_38872_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|38991_39171_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|39244_40606_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 5
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	44468	46025	4658583		Moraxella_phage(100.0%)	1	NA	NA
WP_080028671.1|44468_46025_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 6
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	51665	51875	4658583		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|51665_51875_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 7
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	57205	59254	4658583		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|57205_59254_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 8
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	66750	71220	4658583		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|66750_67407_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|67802_68144_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|68156_69029_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|69032_69407_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|69545_69776_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|69877_70534_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_080028672.1|70557_71220_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	1.5e-07
>prophage 9
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	79276	80752	4658583		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|79276_80752_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 10
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	84750	91814	4658583		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|84750_86073_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|86088_87021_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|87099_87855_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|87851_88637_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|88783_89794_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|89802_90414_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|90552_90618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|90688_91291_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|91292_91814_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 11
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	95832	97883	4658583		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639271.1|95832_96651_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|96703_97099_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|97139_97883_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 12
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	104499	106233	4658583	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025306.1|104499_106233_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.2e-86
>prophage 13
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	111463	117107	4658583		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|111463_111853_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|111867_112917_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|112919_113780_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001362832.1|113798_115400_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	6.8e-17
WP_001297437.1|115445_117107_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 14
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	127194	128709	4658583		Cedratvirus(100.0%)	1	NA	NA
WP_001187774.1|127194_128709_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.6e-12
>prophage 15
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	140701	141454	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_001273008.1|140701_141454_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-26
>prophage 16
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	153976	154648	4658583		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080028676.1|153976_154648_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	6.2e-81
>prophage 17
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	177971	180603	4658583		Burkholderia_phage(66.67%)	3	NA	NA
WP_000785994.1|177971_178442_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001157239.1|178422_179841_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365561.1|179907_180603_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
>prophage 18
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	185642	186314	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_001339045.1|185642_186314_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 19
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	189858	191566	4658583		Escherichia_phage(33.33%)	3	NA	NA
WP_001079077.1|189858_190389_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
WP_000436083.1|190793_191219_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	1.7e-36
WP_000624655.1|191215_191566_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	2.4e-39
>prophage 20
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	197378	198887	4658583		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001399082.1|197378_198887_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	4.7e-44
>prophage 21
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	223085	223940	4658583	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_160454217.1|223085_223940_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-67
>prophage 22
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	231579	235745	4658583	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_000998068.1|231579_233118_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
WP_080028679.1|233167_233515_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_001171554.1|233511_233892_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001696684.1|233994_234969_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.1	2.5e-187
WP_001667685.1|234962_235745_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.0e-138
>prophage 23
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	240542	241709	4658583		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001356285.1|240542_241709_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	1.0e-227
>prophage 24
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	249354	250254	4658583		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131774.1|249354_250254_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 25
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	257610	264634	4658583		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_000704869.1|257610_258777_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.3e-110
WP_080028681.1|259025_260432_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	4.7e-38
WP_001248830.1|260494_261910_-	O78 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000208227.1|261906_262641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000600822.1|262637_264260_-	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	27.6	2.9e-39
WP_000821231.1|264256_264634_-	hypothetical protein	NA	M4QRS4	Synechococcus_phage	38.1	4.8e-14
>prophage 26
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	267823	275745	4658583		Bacillus_phage(50.0%)	6	NA	NA
WP_001700823.1|267823_269212_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	1.0e-32
WP_032246641.1|269281_270706_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	28.6	3.4e-44
WP_001021552.1|270702_271812_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000722270.1|271832_272975_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000183059.1|273282_274176_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115970.1|274350_275745_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.2e-19
>prophage 27
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	281253	288047	4658583		Bacillus_phage(25.0%)	6	NA	NA
WP_001356294.1|281253_282624_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079291.1|282816_284253_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_000699721.1|284255_285479_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479826.1|285475_285955_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043652.1|285957_286923_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.4e-86
WP_000048190.1|286925_288047_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 28
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	292290	302766	4658583		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|292290_293130_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137118.1|293307_295470_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|295472_295916_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|295921_297061_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001296218.1|297719_299303_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|299576_301430_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|301451_302033_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|302124_302766_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 29
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	307430	308783	4658583		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|307430_308783_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 30
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	322622	329488	4658583	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675146.1|322622_324026_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_080028684.1|324022_324745_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.1e-30
WP_000929408.1|324935_325268_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|325476_325773_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|325774_326071_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|326173_327535_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|327865_328183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|328588_329488_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 31
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	338710	339715	4658583		Serratia_phage(100.0%)	1	NA	NA
WP_000846217.1|338710_339715_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 32
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	352919	354953	4658583	tRNA	Indivirus(100.0%)	1	NA	NA
WP_080028686.1|352919_354953_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 33
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	366585	376027	4658583		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|366585_367722_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|367718_369719_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|369843_370305_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|370345_370816_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|370862_371582_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|371578_373264_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|373485_374217_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|374276_374384_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|374364_375096_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|375100_376027_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 34
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	396317	397838	4658583		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|396317_397838_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 35
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	401532	405318	4658583		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|401532_402201_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425460.1|402458_403295_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489244.1|403326_405318_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 36
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	409388	410246	4658583		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|409388_410246_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 37
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	424869	429170	4658583		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848216.1|424869_426336_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	3.9e-43
WP_000198822.1|426453_427440_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296828.1|427478_428192_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|428603_429170_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 38
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	434924	442573	4658583		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|434924_436514_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202791.1|436517_436862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|437194_438385_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234850.1|438412_439108_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_080028690.1|439257_441018_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.2e-99
WP_000494183.1|441142_441427_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050795.1|441565_442573_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	3.4e-83
>prophage 39
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	454048	454666	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|454048_454666_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 40
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	464001	469779	4658583		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|464001_465645_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884919.1|465720_466371_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710374.1|466370_467435_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	2.4e-18
WP_000406055.1|467508_468564_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865577.1|468675_469779_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.4e-117
>prophage 41
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	474056	478899	4658583		Hokovirus(50.0%)	2	NA	NA
WP_000876014.1|474056_476906_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|477072_478899_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 42
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	493822	496450	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|493822_496450_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 43
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	501894	509755	4658583		Pseudomonas_phage(50.0%)	6	NA	NA
WP_001075172.1|501894_504180_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332036.1|504414_505545_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|505544_505799_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301049.1|505852_506503_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_080028694.1|507389_508460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000779091.1|508678_509755_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 44
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	515648	516551	4658583	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|515648_516551_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 45
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	519703	524707	4658583		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|519703_520306_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_080028695.1|520613_521753_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	3.8e-30
WP_000461657.1|521756_522725_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860254.1|522724_524707_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 46
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	561038	564266	4658583		Salmonella_phage(50.0%)	3	NA	NA
WP_000813876.1|561038_561638_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	9.1e-07
WP_001012899.1|561696_563529_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203405.1|563615_564266_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	28.0	1.6e-09
>prophage 47
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	574825	576686	4658583		Sodalis_phage(50.0%)	2	NA	NA
WP_000156114.1|574825_575716_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_001293623.1|575912_576686_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 48
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	580897	582415	4658583		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|580897_582415_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 49
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	588891	590028	4658583		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_080028696.1|588891_590028_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.7e-23
>prophage 50
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	598583	599669	4658583		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|598583_599669_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 51
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	617567	618500	4658583		Enterobacteria_phage(100.0%)	1	NA	NA
WP_080028698.1|617567_618500_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
>prophage 52
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	621540	622974	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|621540_622974_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 53
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	629627	637204	4658583		Hokovirus(50.0%)	4	NA	NA
WP_080028699.1|629627_633221_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001356214.1|633276_634422_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|634495_635440_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|635509_637204_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 54
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	640895	641816	4658583		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|640895_641816_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 55
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	645634	646369	4658583		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|645634_646369_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 56
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	672061	687431	4658583		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|672061_674077_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|674147_675134_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|675363_676125_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|676309_677281_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|677664_677922_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|677966_679694_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|679734_680244_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|680285_681137_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|681241_681610_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|681612_682524_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021017.1|682657_683755_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.2e-30
WP_000852686.1|683744_684620_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458405.1|684619_685453_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|685452_686469_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517431.1|686639_687431_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 57
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	690909	695847	4658583		Mycobacterium_phage(33.33%)	6	NA	NA
WP_080028704.1|690909_692214_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|692271_693171_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|693266_693842_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|693902_694352_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|694338_694764_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|694977_695847_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 58
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	714401	715352	4658583		Cyanophage(100.0%)	1	NA	NA
WP_080028708.1|714401_715352_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	9.7e-11
>prophage 59
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	733399	734113	4658583		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|733399_734113_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 60
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	755156	759158	4658583		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|755156_756446_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|756531_757158_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|757482_758520_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|758519_759158_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 61
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	765404	771889	4658583		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|765404_765557_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|765574_765766_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|766076_766595_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755162.1|766610_767150_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	94.4	6.4e-44
WP_000138282.1|767244_768822_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|768890_770357_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|770518_771889_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 62
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	780718	781150	4658583		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|780718_781150_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 63
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	791035	797492	4658583		Mycoplasma_phage(20.0%)	8	NA	NA
WP_024228955.1|791035_792319_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|792496_792697_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|792708_793044_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|793045_794896_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|794912_795428_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|795523_795847_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|795863_796250_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|796277_797492_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 64
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	812656	814168	4658583		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001374467.1|812656_814168_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	8.4e-09
>prophage 65
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	819926	831217	4658583		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|819926_821180_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|821508_822699_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|822743_823082_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|823142_824477_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|824466_825180_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_080028716.1|825344_826772_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_080028717.1|827329_831217_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.6	5.0e-130
>prophage 66
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	835336	835597	4658583		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|835336_835597_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 67
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	839056	842798	4658583		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|839056_839737_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|840008_840983_-	signal peptidase I	NA	NA	NA	NA	NA
WP_063077227.1|840998_842798_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 68
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	848569	854828	4658583	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|848569_849904_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|850112_850994_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189203.1|851096_851684_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|851739_852123_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|852427_853117_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|853164_854202_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|854408_854828_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 69
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	860121	861420	4658583		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|860121_861420_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 70
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	867284	869858	4658583		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|867284_869858_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 71
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	875764	876835	4658583		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|875764_876835_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 72
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	890468	894763	4658583	integrase	Staphylococcus_phage(33.33%)	3	882826:882840	897332:897346
882826:882840	attL	CAGTTTGGCTTCTTT	NA	NA	NA	NA
WP_000162574.1|890468_890951_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001062342.1|891694_892924_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_000135615.1|893206_894763_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
897332:897346	attR	AAAGAAGCCAAACTG	NA	NA	NA	NA
>prophage 73
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	898138	904174	4658583		Staphylococcus_phage(66.67%)	3	NA	NA
WP_000101606.1|898138_899686_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.6	4.2e-48
WP_001356249.1|899682_900876_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.7	5.4e-19
WP_001096907.1|900934_904174_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.5	3.7e-62
>prophage 74
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	912739	916791	4658583		Klosneuvirus(50.0%)	4	NA	NA
WP_000097660.1|912739_914020_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001295173.1|914257_915658_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|915678_916341_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|916341_916791_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 75
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	920726	926022	4658583		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|920726_920972_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|920968_921379_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246517.1|921351_923496_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.8e-196
WP_000777965.1|923505_924465_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_000985494.1|924819_926022_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 76
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	939072	944632	4658583	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|939072_939258_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|939492_942123_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140519.1|942250_942751_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|942993_944055_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|944134_944632_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 77
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	950098	951064	4658583		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|950098_951064_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 78
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	958539	959553	4658583		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001350046.1|958539_959553_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	6.0e-27
>prophage 79
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	979020	992203	4658583		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|979020_981582_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_080028723.1|981687_982344_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.8e-48
WP_001272549.1|982394_983192_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|983357_984266_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|984262_985525_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|985521_986160_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|986164_986941_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|987029_988394_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|988487_989480_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|989542_990682_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|990821_991448_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|991441_992203_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 80
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	995315	997348	4658583		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|995315_995921_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_080028724.1|995920_997348_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	2.4e-29
>prophage 81
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1015707	1016493	4658583		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021330.1|1015707_1016493_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.8e-21
>prophage 82
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1020782	1025702	4658583		Vibrio_phage(33.33%)	5	NA	NA
WP_001199979.1|1020782_1021454_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|1021592_1021733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268446.1|1021746_1022619_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1022678_1023977_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1024064_1025702_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 83
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1029734	1033849	4658583		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|1029734_1031036_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_080028728.1|1031092_1033849_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 84
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1041383	1042232	4658583		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1041383_1042232_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 85
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1047000	1047846	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_001214600.1|1047000_1047846_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	7.3e-10
>prophage 86
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1059372	1074701	4658583	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001356254.1|1059372_1060578_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	3.0e-73
WP_000184249.1|1060577_1061021_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117734.1|1061071_1061878_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	3.8e-16
WP_000678646.1|1062116_1063214_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1063573_1064827_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|1065058_1066390_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|1066451_1068278_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285985.1|1068277_1071820_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_001138163.1|1071812_1074701_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 87
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1080178	1086951	4658583		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1080178_1080973_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1080979_1081855_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957912.1|1082005_1084252_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1084264_1084795_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1085479_1086169_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1086237_1086951_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 88
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1096582	1099077	4658583		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1096582_1098001_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1098315_1099077_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 89
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1125658	1126414	4658583		Microcystis_virus(100.0%)	1	NA	NA
WP_029701928.1|1125658_1126414_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.6	2.9e-10
>prophage 90
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1150693	1166085	4658583	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1150693_1152094_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001299798.1|1152111_1153428_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1153463_1154831_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|1154866_1155355_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001356277.1|1155354_1157274_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001356278.1|1157709_1159158_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_080028735.1|1159159_1159285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122633157.1|1159281_1159353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001192804.1|1159407_1159956_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|1159998_1161516_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1161525_1162624_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813212.1|1162714_1164448_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|1164453_1165164_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1165188_1166085_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 91
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1169890	1175263	4658583		Pandoravirus(50.0%)	3	NA	NA
WP_001363803.1|1169890_1171324_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
WP_000951948.1|1171380_1172124_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195049.1|1172389_1175263_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	6.3e-263
>prophage 92
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1183790	1185023	4658583		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1183790_1185023_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 93
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1203074	1203752	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|1203074_1203752_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 94
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1217328	1218483	4658583		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1217328_1218483_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 95
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1272038	1273211	4658583		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|1272038_1273211_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 96
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1295425	1296310	4658583		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1295425_1296310_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 97
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1302386	1311737	4658583		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|1302386_1303214_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|1303413_1304340_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1304390_1304648_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1304690_1306910_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|1307020_1308433_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|1308507_1309245_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1309478_1311737_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 98
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1315047	1315440	4658583		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1315047_1315440_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 99
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1326963	1337925	4658583		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|1326963_1328856_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|1328884_1329466_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1329465_1330293_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1330317_1330740_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917130.1|1330740_1331370_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
WP_000735278.1|1331574_1333056_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1333203_1333875_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1333880_1335041_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188377.1|1335078_1335894_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1336009_1336783_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1336840_1337011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076986.1|1337271_1337925_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	3.7e-46
>prophage 100
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1347440	1348874	4658583		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1347440_1348874_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 101
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1354011	1355250	4658583	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|1354011_1355250_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 102
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1361650	1377846	4658583	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1361650_1362664_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1362901_1363117_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1363227_1364973_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|1365167_1367009_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1367087_1367594_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065905.1|1367847_1368612_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|1368899_1369523_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094741.1|1369676_1371197_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000633381.1|1371503_1372994_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|1373035_1373368_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212468.1|1373586_1374570_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_080028743.1|1374753_1377846_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
>prophage 103
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1390267	1391233	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|1390267_1391233_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 104
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1412277	1414572	4658583		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1412277_1414572_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 105
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1422778	1423924	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|1422778_1423924_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 106
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1446934	1454819	4658583		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|1446934_1447795_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249160.1|1447859_1449896_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246837.1|1449853_1450249_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|1450268_1450859_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|1450868_1451444_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001375265.1|1451648_1452689_-	permease	NA	NA	NA	NA	NA
WP_001295551.1|1452761_1453397_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1453524_1454043_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|1454022_1454466_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|1454516_1454819_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 107
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1460646	1462536	4658583		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1460646_1462536_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 108
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1468017	1474656	4658583		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1468017_1470690_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|1470714_1472202_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1472229_1472682_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207683.1|1473312_1474656_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 109
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1478737	1481610	4658583	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1478737_1479586_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1479675_1481610_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 110
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1488384	1489861	4658583		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1488384_1489356_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|1489582_1489861_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 111
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1493929	1508724	4658583		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1493929_1494739_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|1494948_1495926_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1495939_1496926_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|1496946_1497513_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1497509_1498085_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1498053_1498611_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1498617_1499343_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|1499390_1500824_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1500846_1501134_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1501251_1501743_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1501788_1502643_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1502639_1502912_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|1503125_1503758_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|1503754_1504483_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|1504479_1505133_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1505362_1507699_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001375302.1|1507794_1508724_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	2.0e-16
>prophage 112
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1515473	1520221	4658583		Salmonella_phage(50.0%)	5	NA	NA
WP_000445147.1|1515473_1516601_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|1516660_1517125_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209025.1|1517121_1517997_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1517993_1518683_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108473.1|1518730_1520221_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 113
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1523925	1524423	4658583	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1523925_1524423_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 114
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1528389	1530914	4658583	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1528389_1529757_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1529846_1530914_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 115
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1547409	1548453	4658583		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1547409_1548453_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 116
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1559018	1559903	4658583		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258917.1|1559018_1559903_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
>prophage 117
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1566407	1570561	4658583		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738558.1|1566407_1567433_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019655.1|1567500_1568682_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001297685.1|1568691_1569795_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078339.1|1569802_1570561_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 118
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1581066	1582538	4658583	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1581066_1581576_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004454.1|1581590_1582538_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 119
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1614537	1623096	4658583		Acanthocystis_turfacea_Chlorella_virus(25.0%)	8	NA	NA
WP_000773151.1|1614537_1617231_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|1617522_1618707_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1618777_1620892_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1620988_1621459_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1621555_1621930_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|1622055_1622343_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|1622350_1622710_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|1622709_1623096_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 120
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1628666	1638207	4658583		Tupanvirus(25.0%)	9	NA	NA
WP_000634789.1|1628666_1630580_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
WP_000057380.1|1630579_1631602_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1631595_1631814_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1631867_1632737_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1632791_1633196_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1633497_1634130_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001356225.1|1634180_1636271_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_080028749.1|1636337_1637558_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|1637643_1638207_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 121
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1657328	1666844	4658583	tail	Pseudomonas_phage(41.67%)	16	NA	NA
WP_080028752.1|1657328_1657634_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	56.6	7.8e-23
WP_000123378.1|1657686_1657875_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|1657968_1658325_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|1658441_1659206_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069609.1|1659396_1659612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972293.1|1659610_1660015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028753.1|1659990_1660719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793142.1|1660849_1661200_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	2.6e-22
WP_001104440.1|1661202_1661943_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264664.1|1661926_1662577_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|1662573_1662900_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|1662899_1663211_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|1663210_1663756_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_001409579.1|1663815_1665348_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	3.1e-184
WP_064767240.1|1665771_1666212_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|1666271_1666844_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
>prophage 122
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1671522	1672359	4658583		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1671522_1672359_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 123
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1689334	1693101	4658583		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|1689334_1690957_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|1691032_1692385_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1692381_1693101_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 124
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1699664	1700543	4658583		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|1699664_1700543_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 125
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1706512	1708906	4658583		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1706512_1708906_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 126
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1713285	1714512	4658583		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105503.1|1713285_1714512_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 127
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1723741	1726189	4658583		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1723741_1726189_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 128
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1743946	1745757	4658583		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073592.1|1743946_1744690_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000907798.1|1744686_1745757_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 129
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1749298	1750781	4658583		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|1749298_1750012_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|1750013_1750781_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 130
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1757263	1760082	4658583		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1757263_1758118_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1758362_1759421_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1759413_1760082_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 131
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1763085	1767217	4658583		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1763085_1763712_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|1763785_1765984_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|1766085_1766331_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|1766551_1767217_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 132
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1775110	1780993	4658583		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|1775110_1775917_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|1775922_1776324_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|1776443_1776803_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001314210.1|1777133_1778258_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|1778257_1780993_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 133
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1794405	1796448	4658583		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|1794405_1796448_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 134
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1799793	1801928	4658583		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|1799793_1800147_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001324556.1|1800200_1801490_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.7e-172
WP_000065777.1|1801502_1801928_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.1e-51
>prophage 135
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1805316	1805964	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1805316_1805964_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 136
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1853427	1855412	4658583		Bacillus_virus(50.0%)	2	NA	NA
WP_080028762.1|1853427_1854432_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
WP_001196486.1|1854428_1855412_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 137
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1865795	1868129	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_000024005.1|1865795_1868129_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	7.0e-71
>prophage 138
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1871783	1871996	4658583		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1871783_1871996_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 139
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1876220	1877216	4658583		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|1876220_1877216_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 140
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1882534	1884076	4658583		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|1882534_1884076_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 141
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1908262	1918400	4658583	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582465.1|1908262_1910107_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.8e-16
WP_000206275.1|1910103_1911495_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|1911592_1912201_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_080028763.1|1912429_1916551_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	1.6e-25
WP_000072850.1|1916571_1917414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139249532.1|1917566_1918400_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 142
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1940528	1950033	4658583		Rhizobium_phage(20.0%)	8	NA	NA
WP_000024392.1|1940528_1940780_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|1940921_1941353_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|1941597_1943142_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|1943151_1944435_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|1944438_1945398_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000646014.1|1946655_1947681_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|1947690_1948887_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587749.1|1949100_1950033_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
>prophage 143
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1953432	1955526	4658583		Catovirus(50.0%)	2	NA	NA
WP_000063997.1|1953432_1954416_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364782.1|1954500_1955526_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
>prophage 144
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1962964	1978690	4658583		uncultured_Mediterranean_phage(11.11%)	19	NA	NA
WP_001171866.1|1962964_1963444_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|1963482_1964292_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|1964389_1964557_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1964577_1964814_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|1965030_1965699_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050158.1|1965870_1967091_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	1.7e-44
WP_000976070.1|1967068_1967527_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000818601.1|1967633_1968230_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_000340183.1|1968275_1969235_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	28.0	5.7e-11
WP_000806177.1|1969532_1970174_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001247089.1|1970239_1970956_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_000621336.1|1971082_1971946_+	YicC family protein	NA	NA	NA	NA	NA
WP_001356259.1|1972166_1972769_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	51.1	5.1e-50
WP_000924289.1|1973059_1973677_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001324607.1|1973673_1975191_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	4.3e-21
WP_000638625.1|1975212_1975470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295237.1|1975609_1976233_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|1976287_1976563_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|1976581_1978690_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 145
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1983811	1985203	4658583		environmental_Halophage(100.0%)	1	NA	NA
WP_001297380.1|1983811_1985203_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.9e-71
>prophage 146
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	1997319	1998654	4658583		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|1997319_1998654_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 147
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2005958	2015120	4658583		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|2005958_2007647_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|2007752_2007851_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2008415_2008505_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|2008923_2010108_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|2010115_2010613_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2010609_2010972_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2010961_2011309_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|2011418_2011868_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|2011914_2013408_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|2013404_2015120_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 148
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2022013	2022427	4658583		Cyanophage(100.0%)	1	NA	NA
WP_001243437.1|2022013_2022427_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 149
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2026854	2028003	4658583		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2026854_2028003_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 150
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2032709	2040078	4658583		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2032709_2035124_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2035152_2036226_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2036225_2037326_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2037330_2038734_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2039030_2039111_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2039340_2039481_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2039497_2039857_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2039820_2040078_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 151
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2050277	2051615	4658583		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2050277_2051615_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 152
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2062603	2066444	4658583		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|2062603_2063377_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2063467_2064358_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2064357_2065317_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_032221449.1|2065403_2066444_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.0	1.4e-50
>prophage 153
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2071975	2075337	4658583		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|2071975_2073805_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|2073966_2075337_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 154
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2087289	2088282	4658583		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845141.1|2087289_2088282_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 155
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2091450	2097303	4658583		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2091450_2093319_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001364631.1|2093485_2093905_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387756.1|2093912_2095418_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	3.9e-14
WP_000211858.1|2095422_2096388_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2096412_2097303_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 156
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2110695	2112342	4658583		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_080028773.1|2110695_2112342_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	3.9e-68
>prophage 157
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2120757	2126169	4658583		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|2120757_2122779_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001356299.1|2122825_2124310_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2124443_2125709_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2125839_2126169_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 158
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2130211	2136355	4658583		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|2130211_2131342_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|2131338_2132601_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_080028774.1|2132600_2133668_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000676056.1|2133686_2134568_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|2134545_2135220_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612036.1|2135224_2136355_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
>prophage 159
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2154820	2158679	4658583		Bacillus_phage(100.0%)	3	NA	NA
WP_000130686.1|2154820_2155717_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
WP_001213584.1|2155716_2156433_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|2156516_2158679_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 160
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2164397	2166227	4658583		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2164397_2166227_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 161
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2178639	2181926	4658583		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2178639_2180280_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|2180358_2180628_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2180631_2181147_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2181149_2181926_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 162
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2190708	2191323	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|2190708_2191323_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 163
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2205013	2207800	4658583		uncultured_virus(100.0%)	1	NA	NA
WP_080028777.1|2205013_2207800_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 164
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2211878	2214349	4658583		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|2211878_2213288_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2213299_2214349_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 165
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2230717	2233497	4658583		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718896.1|2230717_2231614_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
WP_000621656.1|2231781_2232678_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|2232711_2233497_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 166
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2240818	2243869	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2240818_2243869_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 167
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2258567	2263428	4658583		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|2258567_2259188_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166066.1|2259447_2260431_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270266.1|2260579_2261254_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2261359_2262733_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2262729_2263428_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 168
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2275000	2279504	4658583		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2275000_2275846_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2276271_2276517_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2276601_2277087_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2277179_2278106_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|2278172_2279504_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 169
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2285141	2289314	4658583		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080028780.1|2285141_2289314_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.7e-25
>prophage 170
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2302305	2309552	4658583		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|2302305_2302968_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174083.1|2302979_2305481_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004451.1|2305789_2306869_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2306883_2307204_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184822.1|2307254_2309552_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 171
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2321668	2322883	4658583		Oenococcus_phage(100.0%)	1	NA	NA
WP_080028781.1|2321668_2322883_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.9	1.0e-44
>prophage 172
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2329633	2331478	4658583		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|2329633_2331478_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 173
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2339817	2342870	4658583		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2339817_2340768_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2341685_2342870_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 174
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2346986	2355315	4658583		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2346986_2351015_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2351091_2355315_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 175
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2364531	2366295	4658583		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2364531_2365203_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2365245_2365836_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2366022_2366295_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 176
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2371663	2373253	4658583		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2371663_2373253_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 177
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2389034	2392718	4658583		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|2389034_2392718_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 178
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2404601	2405393	4658583		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|2404601_2405393_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 179
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2421255	2422371	4658583		Mycoplasma_phage(100.0%)	1	NA	NA
WP_080028783.1|2421255_2422371_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 180
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2431586	2432195	4658583		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2431586_2432195_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 181
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2438816	2441364	4658583		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2438816_2440232_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|2440284_2441364_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 182
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2445571	2449184	4658583		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2445571_2448394_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2448647_2449184_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 183
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2453001	2454351	4658583		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2453001_2454351_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 184
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2459935	2461894	4658583		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2459935_2461894_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 185
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2471176	2473324	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2471176_2473324_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 186
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2478569	2484938	4658583		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001307516.1|2478569_2480555_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
WP_001171692.1|2480827_2481757_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|2481740_2482436_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|2482446_2483427_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235260.1|2483405_2484938_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 187
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2491104	2492720	4658583		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611419.1|2491104_2491785_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	3.2e-08
WP_001075526.1|2491961_2492720_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 188
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2498280	2499069	4658583		Cedratvirus(100.0%)	1	NA	NA
WP_001193397.1|2498280_2499069_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 189
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2503908	2505411	4658583		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2503908_2505411_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 190
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2526606	2529818	4658583	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|2526606_2528124_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856841.1|2528360_2529818_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
>prophage 191
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2544095	2546079	4658583		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2544095_2544389_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2544432_2546079_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 192
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2550592	2551126	4658583		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2550592_2551126_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 193
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2556046	2557024	4658583		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2556046_2557024_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 194
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2565007	2565553	4658583		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2565007_2565553_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 195
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2569589	2582620	4658583	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|2569589_2570927_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|2570936_2572784_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2572776_2573727_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2573812_2574121_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2574196_2575477_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2575562_2576822_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2576824_2577829_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2577910_2578108_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2578211_2579510_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2579714_2580140_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2580178_2582620_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 196
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2586552	2587716	4658583		Ralstonia_phage(100.0%)	1	NA	NA
WP_001299837.1|2586552_2587716_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	3.7e-81
>prophage 197
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2629255	2635743	4658583		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|2629255_2629786_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|2630095_2631052_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001375995.1|2631191_2632694_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|2632707_2633730_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|2633716_2634712_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2634744_2635743_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 198
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2639857	2642620	4658583		Vibrio_phage(100.0%)	2	NA	NA
WP_001106226.1|2639857_2640322_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|2640481_2642620_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 199
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2646258	2652355	4658583		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181312.1|2646258_2647206_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2647390_2647444_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|2647584_2650281_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|2650486_2650873_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2650945_2651407_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2651419_2652355_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 200
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2660659	2671042	4658583	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416407.1|2660659_2663515_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|2663514_2663958_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2664311_2665823_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|2666089_2667190_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2667189_2668272_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|2668390_2669893_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|2670022_2671042_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
>prophage 201
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2674793	2676013	4658583		Caulobacter_phage(50.0%)	2	NA	NA
WP_000085626.1|2674793_2675123_-	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_000190110.1|2675452_2676013_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
>prophage 202
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2679169	2685728	4658583	transposase	Rhizobium_phage(16.67%)	7	NA	NA
WP_000594911.1|2679169_2679994_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|2680042_2680615_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|2680715_2681066_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|2680985_2682137_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|2683188_2683446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|2684003_2684771_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|2684771_2685728_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 203
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2693719	2693911	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_000937736.1|2693719_2693911_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
>prophage 204
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2699335	2709274	4658583	transposase	Yersinia_phage(25.0%)	6	NA	NA
WP_080028797.1|2699335_2700154_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.8e-45
WP_080028799.1|2700796_2701084_+	toxin	NA	NA	NA	NA	NA
WP_162780333.1|2701080_2701539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114145253.1|2701804_2703017_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	6.9e-163
WP_080028800.1|2703257_2706149_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.6	3.0e-289
WP_001570878.1|2706169_2709274_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	29.1	2.1e-38
>prophage 205
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2713964	2714945	4658583	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001583085.1|2713964_2714945_-|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	56.0	2.7e-101
>prophage 206
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2718304	2719981	4658583		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|2718304_2718907_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|2719384_2719981_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 207
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2730183	2731644	4658583		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208196.1|2730183_2731644_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 208
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2738213	2738768	4658583		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2738213_2738768_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 209
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2751381	2756905	4658583	transposase	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_080028808.1|2751381_2753046_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_080028809.1|2753094_2754456_-	MFS transporter	NA	NA	NA	NA	NA
WP_000019440.1|2754626_2755607_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001520416.1|2755882_2756905_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	3.6e-11
>prophage 210
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2760129	2761409	4658583		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|2760129_2760867_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|2760869_2761409_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 211
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2769338	2772214	4658583		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|2769338_2770928_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|2771320_2771926_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2772052_2772214_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 212
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2778292	2779615	4658583		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477828.1|2778292_2779615_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.8e-79
>prophage 213
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2787390	2792746	4658583		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093812.1|2787390_2788623_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_074502458.1|2788930_2790598_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	3.7e-42
WP_000409472.1|2790808_2792746_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	5.2e-11
>prophage 214
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2796029	2798143	4658583		Bacillus_phage(50.0%)	2	NA	NA
WP_074502451.1|2796029_2796719_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219588.1|2796718_2798143_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 215
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2809910	2820328	4658583	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130185.1|2809910_2810864_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|2810978_2811566_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|2811600_2812167_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_016244256.1|2812315_2813029_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843565.1|2813054_2813459_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|2813835_2815752_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118475.1|2815840_2816971_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_001300563.1|2817233_2818346_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|2818423_2818633_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681362.1|2819161_2820328_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
>prophage 216
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2823373	2826190	4658583	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286888.1|2823373_2826190_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.1e-77
>prophage 217
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2830633	2831782	4658583		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2830633_2831782_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 218
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2837252	2842913	4658583		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|2837252_2838806_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_000349926.1|2838879_2840097_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|2840225_2841368_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|2841398_2842913_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 219
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2850807	2852207	4658583		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|2850807_2851287_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|2851364_2852207_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 220
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2859951	2865374	4658583		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|2859951_2862858_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035637.1|2863022_2865374_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.9e-37
>prophage 221
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2871737	2872436	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|2871737_2872436_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 222
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2885138	2886863	4658583		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|2885138_2886863_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 223
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2912952	2913996	4658583		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217342.1|2912952_2913996_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	4.1e-103
>prophage 224
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2918241	2918793	4658583		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2918241_2918793_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 225
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2927303	2928728	4658583		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2927303_2928728_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 226
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2936434	2943057	4658583		Mamastrovirus(33.33%)	5	NA	NA
WP_001189623.1|2936434_2937985_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001324194.1|2938186_2940577_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2940782_2941319_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2941359_2942022_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2942130_2943057_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 227
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2946319	2947222	4658583		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|2946319_2947222_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 228
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2957916	2964722	4658583	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|2957916_2959335_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|2959373_2960300_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|2960336_2960792_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_080028818.1|2960969_2961674_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|2961688_2962219_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001356280.1|2962292_2964722_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 229
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2969911	2970709	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158933.1|2969911_2970709_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.8	4.6e-14
>prophage 230
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2976620	2976965	4658583		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2976620_2976965_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 231
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2980894	2982319	4658583	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|2980894_2982319_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 232
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	2994061	2994820	4658583		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2994061_2994820_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 233
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3003648	3007762	4658583		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569401.1|3003648_3004245_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	3.9e-26
WP_001294757.1|3004279_3007762_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 234
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3020720	3021752	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3020720_3021752_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 235
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3028274	3036126	4658583		Indivirus(25.0%)	8	NA	NA
WP_000997010.1|3028274_3029078_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648601.1|3029074_3029989_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3030229_3031030_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|3031924_3033283_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|3033354_3034110_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3034143_3034866_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3034862_3035330_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|3035394_3036126_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
>prophage 236
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3051814	3055127	4658583		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|3051814_3052393_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_080028823.1|3052598_3053366_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3053336_3054077_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000009291.1|3054368_3055127_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
>prophage 237
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3065101	3079129	4658583	integrase	Enterobacteria_phage(20.0%)	16	3057084:3057100	3076016:3076032
3057084:3057100	attL	TTTATCCACCAGCGCCA	NA	NA	NA	NA
WP_000749881.1|3065101_3066157_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3066444_3067548_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|3067559_3068813_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_021511808.1|3069168_3070383_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	1.3e-132
WP_000035054.1|3070810_3071014_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_080028824.1|3071013_3071445_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.3	1.1e-27
WP_080028825.1|3071457_3072291_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	2.6e-20
WP_000476150.1|3072283_3072466_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080028826.1|3072459_3073527_+	ash family protein	NA	NA	NA	NA	NA
WP_001065661.1|3073519_3073714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024679.1|3073710_3073974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3073970_3074192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058743.1|3074184_3074787_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
WP_000628966.1|3074797_3075139_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208877.1|3075131_3075503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028827.1|3077812_3079129_+	phage DNA ejection protein	NA	Q9AYY9	Salmonella_phage	60.1	1.2e-75
3076016:3076032	attR	TGGCGCTGGTGGATAAA	NA	NA	NA	NA
>prophage 238
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3082996	3083452	4658583		Paenibacillus_phage(100.0%)	1	NA	NA
WP_001371753.1|3082996_3083452_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	34.2	1.9e-17
>prophage 239
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3086522	3088721	4658583		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667031.1|3086522_3088721_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
>prophage 240
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3108930	3110256	4658583		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046317.1|3108930_3110256_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 241
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3115832	3122890	4658583	holin,transposase	Catovirus(33.33%)	5	NA	NA
WP_001159094.1|3115832_3117503_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089055.1|3117516_3118989_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001299022.1|3119002_3119590_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3119718_3121752_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_000019440.1|3121909_3122890_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 242
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3134061	3135111	4658583		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692742.1|3134061_3135111_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 243
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3143486	3149176	4658583		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|3143486_3145373_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|3145704_3146964_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|3146953_3148237_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000952485.1|3148276_3149176_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 244
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3153717	3157997	4658583		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177931.1|3153717_3156792_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.0	0.0e+00
WP_000805902.1|3156914_3157997_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 245
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3163407	3165368	4658583		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044302.1|3163407_3164358_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013496.1|3164354_3165368_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
>prophage 246
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3168446	3169556	4658583		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3168446_3169556_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 247
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3182561	3183719	4658583		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830742.1|3182561_3183719_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 248
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3191134	3192250	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3191134_3192250_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 249
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3196540	3206512	4658583		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3196540_3197452_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219312.1|3197576_3198485_+	fructokinase	NA	NA	NA	NA	NA
WP_000755825.1|3198627_3199812_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_080028829.1|3199937_3203081_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|3203077_3204280_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3204469_3205159_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893611.1|3205216_3206512_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 250
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3213464	3222445	4658583	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3213464_3214592_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3214614_3214947_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3214974_3216822_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3216832_3217804_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3217932_3218280_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3218456_3219341_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|3219639_3220179_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3220329_3220779_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|3220782_3221886_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|3221974_3222445_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 251
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3244004	3249051	4658583	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3244004_3244628_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3244753_3246028_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3246215_3248570_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3248778_3249051_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 252
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3252179	3252875	4658583		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|3252179_3252875_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 253
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3256198	3259745	4658583		Bacillus_phage(100.0%)	2	NA	NA
WP_001235609.1|3256198_3257971_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256174.1|3257963_3259745_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 254
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3268581	3271731	4658583		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3268581_3271731_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 255
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3278739	3287301	4658583		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3278739_3279291_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|3279419_3281351_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3281403_3281733_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3281732_3282338_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678213.1|3282447_3284322_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	4.0e-117
WP_001220233.1|3284502_3285147_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|3285382_3286345_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801846.1|3286341_3287301_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
>prophage 256
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3295545	3298505	4658583		Escherichia_phage(50.0%)	2	NA	NA
WP_001361120.1|3295545_3295887_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
WP_000078271.1|3296000_3298505_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.1e-114
>prophage 257
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3303044	3303722	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_001157550.1|3303044_3303722_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 258
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3306858	3307545	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3306858_3307545_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 259
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3314451	3316233	4658583		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|3314451_3316233_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 260
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3322423	3323569	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299453.1|3322423_3323569_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	1.8e-48
>prophage 261
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3335088	3338219	4658583	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|3335088_3336474_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|3336509_3337031_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3337138_3337351_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3337352_3338219_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 262
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3359913	3364673	4658583		Ralstonia_phage(33.33%)	3	NA	NA
WP_000103231.1|3359913_3361815_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
WP_000253805.1|3362551_3364000_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770944.1|3363989_3364673_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	1.0e-30
>prophage 263
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3367818	3370962	4658583		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|3367818_3370962_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 264
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3383248	3389291	4658583		Tupanvirus(50.0%)	3	NA	NA
WP_000077801.1|3383248_3387130_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096719.1|3387345_3388479_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|3388475_3389291_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 265
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3403837	3405660	4658583		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|3403837_3404467_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029813.1|3404439_3405660_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 266
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3408768	3410883	4658583		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3408768_3410334_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|3410454_3410883_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 267
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3426308	3426955	4658583		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3426308_3426518_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939749.1|3426571_3426955_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 268
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3431770	3434210	4658583		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3431770_3432982_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|3433121_3434210_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 269
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3441220	3443803	4658583	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3441220_3443803_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 270
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3453540	3454266	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|3453540_3454266_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 271
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3462162	3463242	4658583		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3462162_3463242_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 272
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3467336	3469001	4658583		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337078.1|3467336_3469001_-	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	1.0e-84
>prophage 273
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3473767	3477645	4658583	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023123.1|3473767_3475714_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
WP_001287154.1|3475980_3477645_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 274
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3481929	3482694	4658583		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|3481929_3482694_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 275
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3489349	3502058	4658583		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|3489349_3490027_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001324644.1|3490023_3492708_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001324645.1|3492700_3493273_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087966.1|3493281_3495330_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741137.1|3495352_3497026_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|3497025_3497115_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|3497427_3497634_+	YbfA family protein	NA	NA	NA	NA	NA
WP_080028843.1|3497876_3502058_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
>prophage 276
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3507175	3510117	4658583		Hokovirus(50.0%)	2	NA	NA
WP_000207146.1|3507175_3508594_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
WP_001032695.1|3508635_3510117_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 277
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3513495	3514287	4658583		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114028.1|3513495_3514287_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	1.7e-08
>prophage 278
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3550424	3553944	4658583		Vibrio_phage(33.33%)	4	NA	NA
WP_080028846.1|3550424_3551144_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	31.8	3.0e-20
WP_000951290.1|3551140_3552082_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	3.7e-23
WP_000784351.1|3552195_3552576_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109192.1|3552891_3553944_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
>prophage 279
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3558300	3564874	4658583		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|3558300_3559317_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_080028847.1|3559577_3561050_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147436.1|3561117_3561906_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3562034_3562184_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101993.1|3562350_3563124_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3563123_3563813_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|3563815_3564874_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 280
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3575229	3576519	4658583		Klosneuvirus(100.0%)	1	NA	NA
WP_001356070.1|3575229_3576519_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
>prophage 281
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3583000	3583909	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3583000_3583909_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 282
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3594506	3609318	4658583		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996090.1|3594506_3596243_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976389.1|3596235_3597234_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001361582.1|3597233_3597905_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|3598133_3599498_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145127.1|3599729_3600212_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_001340191.1|3600331_3602482_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|3602509_3603472_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|3603612_3604698_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|3604926_3605187_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|3605451_3605718_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|3605791_3606469_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_080028852.1|3606510_3608793_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|3609057_3609318_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 283
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3613002	3618227	4658583		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|3613002_3613725_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_080028853.1|3613721_3614381_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|3614519_3615266_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3615669_3616173_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|3616471_3617359_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3617593_3617659_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3617711_3618227_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 284
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3623224	3631566	4658583		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|3623224_3624817_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|3625057_3626323_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114234.1|3626474_3627290_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209314.1|3627435_3629868_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|3629873_3630773_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424890.1|3630903_3631566_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
>prophage 285
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3634781	3636653	4658583		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|3634781_3636653_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 286
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3647988	3649191	4658583		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3647988_3649191_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 287
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3657757	3666907	4658583		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|3657757_3658015_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|3658174_3658462_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|3658445_3659168_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3659228_3660131_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3660218_3660695_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126053.1|3661045_3662158_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|3662252_3663386_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_001093864.1|3663395_3664349_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_080028856.1|3664345_3665191_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3665250_3665739_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|3665779_3666907_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 288
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3670244	3672982	4658583		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|3670244_3670973_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270738.1|3671190_3671706_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3671831_3672155_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080028857.1|3672151_3672982_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 289
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3676569	3678288	4658583		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|3676569_3678288_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 290
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3687585	3711382	4658583	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188182.1|3687585_3689532_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|3689604_3689829_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3690151_3690472_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934045.1|3690502_3692779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
WP_001040187.1|3693463_3693682_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|3693966_3694671_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|3694712_3696434_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043619.1|3696434_3698201_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|3698323_3699289_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|3699832_3700327_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077063.1|3700461_3704568_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3704722_3705334_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|3705344_3706688_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|3706778_3708071_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850315.1|3708309_3710754_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.9e-221
WP_000213098.1|3710764_3711382_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 291
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3717691	3720906	4658583		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|3717691_3718432_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292815.1|3718623_3720906_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 292
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3725004	3726093	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057147.1|3725004_3726093_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	5.4e-82
>prophage 293
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3731179	3735720	4658583		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|3731179_3731464_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705679.1|3731670_3733935_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|3733971_3735720_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 294
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3750425	3761558	4658583	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|3750425_3750974_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|3751000_3751648_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|3751869_3753060_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|3753244_3754333_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3754934_3756335_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|3756503_3757706_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|3757971_3760584_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|3760790_3761558_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 295
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3777480	3779388	4658583		Tupanvirus(100.0%)	1	NA	NA
WP_000053069.1|3777480_3779388_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	2.4e-53
>prophage 296
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3791999	3794054	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|3791999_3794054_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 297
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3798287	3798947	4658583	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3798287_3798947_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 298
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3818217	3830473	4658583		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|3818217_3818430_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|3818440_3818629_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001323678.1|3818603_3818834_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3818823_3818997_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829660.1|3819045_3820119_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_080028862.1|3820190_3822935_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|3823017_3824046_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|3824018_3824711_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001323677.1|3824840_3826013_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|3826012_3828559_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|3828555_3829155_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|3829247_3829553_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|3829552_3830473_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 299
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3834779	3836879	4658583		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|3834779_3834953_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001347171.1|3835035_3836364_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	9.1e-233
WP_001028095.1|3836384_3836879_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 300
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3851654	3852578	4658583		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|3851654_3852578_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 301
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3859397	3864021	4658583	integrase	Bacillus_phage(50.0%)	4	3860273:3860287	3865379:3865393
WP_000409883.1|3859397_3860756_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
3860273:3860287	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000627409.1|3860796_3861288_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611856.1|3861284_3862271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|3862818_3864021_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
3865379:3865393	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
>prophage 302
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3872396	3883547	4658583		Stx2-converting_phage(62.5%)	9	NA	NA
WP_000233440.1|3872396_3874757_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	6.9e-34
WP_000035067.1|3874774_3874963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440936.1|3875406_3875670_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.8	4.1e-44
WP_001420502.1|3875666_3876071_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	93.3	2.4e-64
WP_000624622.1|3877220_3877568_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3877567_3878245_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_080028865.1|3879138_3879489_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	5.2e-39
WP_000422761.1|3879485_3879911_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	87.6	3.6e-42
WP_032179876.1|3881456_3883547_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.0e-08
>prophage 303
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3899594	3907771	4658583		Mycobacterium_phage(20.0%)	9	NA	NA
WP_001285507.1|3899594_3900827_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
WP_000502842.1|3900811_3901450_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_000226519.1|3901528_3901798_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|3901818_3902463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422761.1|3903462_3903888_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	87.6	3.6e-42
WP_000624715.1|3903884_3904175_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.7	1.9e-34
WP_005067636.1|3904426_3905170_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_032171718.1|3905219_3906587_-	MFS transporter	NA	NA	NA	NA	NA
WP_000705119.1|3906658_3907771_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	26.0	1.3e-27
>prophage 304
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3932566	3933828	4658583		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000214398.1|3932566_3933052_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186738.1|3933067_3933544_+	RadC family protein	NA	NA	NA	NA	NA
WP_001220314.1|3933606_3933828_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 305
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3936880	3940679	4658583		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
WP_080028866.1|3936880_3937819_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.2	7.8e-05
WP_000283664.1|3937873_3938611_+	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001001902.1|3938634_3939189_+	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_001297187.1|3939290_3939782_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001189321.1|3939845_3940679_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 306
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3944813	3945347	4658583		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|3944813_3945347_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 307
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3954655	3955576	4658583		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3954655_3955576_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 308
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3960238	3960484	4658583		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3960238_3960484_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 309
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3976364	3977306	4658583		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001323587.1|3976364_3977306_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 310
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3989664	3990846	4658583		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|3989664_3990399_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3990609_3990846_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 311
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	3994118	3995761	4658583		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|3994118_3994760_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|3994756_3995761_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 312
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4008092	4008350	4658583		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4008092_4008350_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 313
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4015639	4019362	4658583		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|4015639_4016341_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251389.1|4016340_4017585_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|4017613_4018525_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4018540_4019362_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 314
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4022638	4024616	4658583		Mycoplasma_phage(100.0%)	2	NA	NA
WP_080028868.1|4022638_4023496_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.9	1.1e-10
WP_000531601.1|4023479_4024616_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 315
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4029637	4031008	4658583		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|4029637_4031008_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 316
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4034144	4037873	4658583		Enterobacteria_phage(66.67%)	5	NA	NA
WP_080028869.1|4034144_4035395_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_001307134.1|4035497_4035821_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|4036353_4036464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|4036516_4036921_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|4037141_4037873_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 317
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4043740	4046062	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_001683996.1|4043740_4046062_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 318
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4054597	4056285	4658583		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4054597_4055017_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|4055016_4056285_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 319
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4083044	4085796	4658583		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4083044_4084724_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4084848_4085796_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 320
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4088932	4095736	4658583		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|4088932_4090015_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456448.1|4090014_4090848_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200376.1|4090844_4091237_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4091240_4092050_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4092085_4092940_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|4093087_4093195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|4093623_4093731_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001295620.1|4094135_4095236_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146442.1|4095505_4095736_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 321
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4106867	4117232	4658583		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|4106867_4108406_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571680.1|4108402_4109113_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4109112_4109790_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4110870_4111713_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|4111762_4112221_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4112333_4113239_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4113330_4114344_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4114545_4115454_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4115597_4116011_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068067.1|4116614_4117232_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	3.9e-53
>prophage 322
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4125642	4127657	4658583		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|4125642_4126656_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4126652_4127657_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 323
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4135592	4166828	4658583	holin,integrase,tail	Escherichia_phage(32.26%)	37	4135429:4135456	4167424:4167451
4135429:4135456	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113680.1|4135592_4136723_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.6e-103
WP_000113189.1|4136700_4136949_-	excisionase	NA	NA	NA	NA	NA
WP_032279702.1|4137013_4139458_-	exonuclease	NA	A0A0U2I1R6	Escherichia_phage	68.2	7.3e-188
WP_032279700.1|4139557_4139833_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	85.7	7.3e-36
WP_032279699.1|4139907_4140189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032279698.1|4140205_4141057_-	rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000358771.1|4141624_4141903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339605.1|4141862_4142264_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_032355724.1|4142275_4142428_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000362153.1|4142693_4143113_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4143213_4143495_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|4143478_4143904_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|4143926_4144889_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001759950.1|4144895_4145642_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	1.2e-112
WP_000450661.1|4145664_4146426_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	3.3e-118
WP_001403739.1|4146441_4146873_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_000385105.1|4147066_4148221_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_032183377.1|4148195_4150460_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_080028872.1|4150868_4151147_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.6e-11
WP_080028873.1|4151148_4152204_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	9.8e-89
WP_000140012.1|4152204_4152585_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
WP_080028874.1|4152581_4153403_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	4.2e-79
WP_000917767.1|4153629_4153827_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_080028875.1|4153977_4155027_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.3	3.0e-183
WP_001438304.1|4155828_4155960_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|4156240_4156576_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|4156836_4158690_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
WP_000284510.1|4158840_4159056_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|4159060_4159405_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_032237853.1|4159673_4160273_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.0e-107
WP_080028876.1|4160424_4163331_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	45.7	1.2e-117
WP_080028877.1|4163346_4163874_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.1	3.2e-72
WP_000972097.1|4163904_4164438_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_080028878.1|4164439_4165225_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.4	1.8e-108
WP_001421220.1|4165452_4165635_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|4165833_4166502_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|4166558_4166828_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
4167424:4167451	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
>prophage 324
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4171310	4174268	4658583		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001297118.1|4171310_4172669_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|4172672_4174268_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 325
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4179200	4184492	4658583	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559280.1|4179200_4179959_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|4180178_4181228_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4181263_4181515_-	YciN family protein	NA	NA	NA	NA	NA
WP_001681014.1|4181894_4184492_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.0e-86
>prophage 326
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4189416	4190007	4658583		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4189416_4190007_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 327
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4197821	4203479	4658583		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|4197821_4199756_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001356195.1|4199823_4200951_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4201095_4201884_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968837.1|4202251_4202605_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573412.1|4202672_4203479_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 328
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4216269	4217535	4658583		Klosneuvirus(100.0%)	1	NA	NA
WP_080028880.1|4216269_4217535_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	7.8e-24
>prophage 329
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4231550	4232633	4658583		Indivirus(100.0%)	1	NA	NA
WP_000057979.1|4231550_4232633_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 330
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4242311	4243463	4658583	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254876.1|4242311_4243463_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
>prophage 331
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4250475	4250991	4658583		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|4250475_4250991_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 332
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4257317	4264587	4658583	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628065.1|4257317_4258550_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|4258804_4259788_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123718.1|4260265_4261639_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.2e-51
WP_000081418.1|4261767_4262703_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|4262878_4263313_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|4263453_4264587_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 333
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4269548	4270538	4658583		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4269548_4270538_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 334
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4301824	4305727	4658583		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|4301824_4305727_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 335
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4309666	4310615	4658583		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|4309666_4310197_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4310441_4310615_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 336
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4322421	4332573	4658583	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_001700630.1|4322421_4323630_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.7e-206
WP_001323465.1|4323669_4324884_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429152.1|4324936_4325473_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001301045.1|4325545_4327507_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|4327598_4327829_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|4328250_4328667_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760615.1|4328745_4330152_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047445.1|4330396_4331542_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|4331559_4332573_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 337
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4339705	4341808	4658583		Salmonella_phage(100.0%)	1	NA	NA
WP_080028888.1|4339705_4341808_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	6.9e-134
>prophage 338
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4346717	4353114	4658583		Ralstonia_phage(50.0%)	2	NA	NA
WP_080028889.1|4346717_4348826_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	1.8e-25
WP_080028890.1|4348893_4353114_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.2	2.2e-22
>prophage 339
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4359986	4361531	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_080028892.1|4359986_4361531_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 340
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4368415	4368706	4658583		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001324550.1|4368415_4368706_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	64.0	1.0e-24
>prophage 341
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4375074	4376515	4658583		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|4375074_4375359_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642403.1|4375504_4376515_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	8.1e-24
>prophage 342
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4379788	4381694	4658583		Planktothrix_phage(100.0%)	2	NA	NA
WP_080028894.1|4379788_4380715_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193507.1|4380707_4381694_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.1e-17
>prophage 343
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4386010	4389817	4658583		Klosneuvirus(50.0%)	2	NA	NA
WP_001604421.1|4386010_4388410_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|4388434_4389817_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 344
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4395096	4402032	4658583		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001384488.1|4395096_4397892_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
WP_000832431.1|4397936_4400309_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628542.1|4400346_4402032_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	5.9e-11
>prophage 345
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4418610	4420011	4658583		Escherichia_phage(100.0%)	1	NA	NA
WP_001384495.1|4418610_4420011_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.5	2.4e-106
>prophage 346
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4427436	4428972	4658583		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001194882.1|4427436_4428972_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	7.5e-13
>prophage 347
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4436853	4437801	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_001373503.1|4436853_4437801_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 348
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4446016	4448146	4658583		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|4446016_4446400_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|4446431_4446650_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012617.1|4446745_4448146_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.2	7.0e-26
>prophage 349
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4455650	4456541	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|4455650_4456541_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 350
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4461907	4477345	4658583		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|4461907_4462111_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527753.1|4462146_4463607_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000151243.1|4463695_4465063_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836058.1|4465120_4466140_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_080028899.1|4466151_4467366_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_000598292.1|4467571_4467898_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_080028900.1|4468032_4468374_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4468408_4468969_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4468971_4469682_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|4469789_4470095_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|4470293_4472720_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001342404.1|4472780_4475204_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000213028.1|4475214_4475832_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526490.1|4475833_4476688_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|4476730_4477345_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 351
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4495107	4496409	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|4495107_4496409_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 352
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4506304	4508116	4658583		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945912.1|4506304_4508116_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 353
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4527999	4529274	4658583	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4527999_4529274_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 354
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4536184	4537683	4658583		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|4536184_4536706_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250668.1|4536786_4537683_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 355
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4546485	4555277	4658583		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|4546485_4547301_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|4547428_4548010_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|4548155_4549325_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|4549490_4549580_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|4549878_4550904_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|4550900_4551833_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|4551945_4553157_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|4553447_4554596_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|4554635_4555277_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 356
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4560781	4563048	4658583		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587555.1|4560781_4561594_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|4561597_4562383_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|4562379_4563048_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 357
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4571337	4576421	4658583		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|4571337_4572558_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_080028904.1|4572554_4573826_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948878.1|4573800_4574547_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000089364.1|4574556_4576044_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|4576052_4576421_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 358
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4595014	4614608	4658583	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553715.1|4595014_4596715_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
WP_000069386.1|4596771_4599150_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000426520.1|4599482_4600316_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082237.1|4600472_4601519_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	4.2e-84
WP_001270809.1|4601650_4601842_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175705.1|4601845_4603282_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|4603344_4604058_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|4604304_4604769_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029479.1|4604846_4605596_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|4605595_4606147_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|4606209_4607190_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|4607290_4607590_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|4607594_4609982_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|4609996_4610980_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4611263_4611308_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4611430_4611787_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4611839_4612037_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4612133_4612676_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144208.1|4612679_4614608_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	2.5e-130
>prophage 359
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4625877	4628139	4658583		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|4625877_4628139_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 360
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4634265	4635093	4658583		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|4634265_4635093_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 361
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4642569	4643790	4658583		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|4642569_4643790_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 362
NZ_CP020055	Escherichia coli strain AR_0069 chromosome, complete genome	4658583	4650554	4651208	4658583		Bacillus_phage(100.0%)	1	NA	NA
WP_001299561.1|4650554_4651208_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 1
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	0	2607	136975		Wolbachia_phage(100.0%)	3	NA	NA
WP_000591076.1|309_738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201087.1|771_1632_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000829617.1|1647_2607_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	30.5	1.6e-16
>prophage 2
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	6265	7381	136975		unidentified_phage(100.0%)	1	NA	NA
WP_000946104.1|6265_7381_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	8.3e-46
>prophage 3
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	14756	15029	136975		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000356489.1|14756_15029_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 4
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	22357	23869	136975		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|22357_23869_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 5
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	27028	91562	136975	transposase,integrase	Salmonella_phage(23.53%)	61	15600:15620	96737:96757
15600:15620	attL	AAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
WP_004201184.1|27028_27898_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|27902_28913_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|28915_29452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|29750_30032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|30301_30904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|30919_31372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|31542_31983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201176.1|35215_36856_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|36911_37202_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|37395_37725_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|37729_38761_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|38771_39410_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|39414_39780_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|39783_40596_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_001183923.1|43106_43406_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|43489_43732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|43859_44699_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|44692_45040_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_032488579.1|45208_45763_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845039.1|45993_47007_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|47312_47870_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|47872_50845_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|50923_51928_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000714163.1|52109_52331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268337.1|52403_52682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|52668_54396_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077336.1|54573_54960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032043.1|55066_55213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|55418_56270_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|56344_56902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|56975_57194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|57207_57477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|57469_58075_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050847.1|58146_58350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200877.1|58404_58839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087759376.1|59306_60427_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_000039319.1|60725_62522_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000170087.1|62606_63884_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000706865.1|64083_65094_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001282585.1|65156_66146_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|66240_66771_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_000739139.1|66831_67740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|67750_68719_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_001186917.1|68938_69124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|69427_69748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|70042_70684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709517.1|70806_71667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447718.1|71705_74513_-	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000983282.1|74616_75624_-	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_000575345.1|75620_76292_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001447719.1|76288_77554_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_001010740.1|77516_78047_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_000351984.1|78043_78361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637384.1|78375_80823_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001259346.1|80819_81527_-	DsbC family protein	NA	NA	NA	NA	NA
WP_000606835.1|81675_87162_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001447736.1|87207_87633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118520.1|87889_88207_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001221666.1|88203_88737_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_015058212.1|88830_89976_-	class C beta-lactamase CMY-6	NA	NA	NA	NA	NA
WP_000608644.1|90299_91562_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
96737:96757	attR	AAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
>prophage 6
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	105301	121672	136975		Streptococcus_phage(12.5%)	25	NA	NA
WP_000366823.1|105301_107494_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_004201072.1|107508_107997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|108087_108387_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|108598_109216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|109271_109928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|109927_111355_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|111358_111859_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_002210541.1|111867_112179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|112184_112616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|112683_113358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342216.1|113344_113464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|113606_113984_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|114310_114454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|114545_115181_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|115233_115506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|115554_116736_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151305.1|116739_117525_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-10
WP_014342215.1|117552_117684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380893.1|117698_118010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053910.1|117991_118441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348523.1|118454_119702_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001258026.1|119691_120054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096360.1|120056_120299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532167.1|120536_120734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268394.1|120733_121672_-	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.2e-69
>prophage 7
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	126132	130152	136975		Phormidium_phage(50.0%)	5	NA	NA
WP_004201081.1|126132_127596_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000434070.1|127669_128602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342198.1|128796_128967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062185.1|129163_129661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273096.1|129663_130152_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
>prophage 8
NZ_CP020056	Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence	136975	133755	134613	136975		Sodalis_phage(50.0%)	2	NA	NA
WP_001043046.1|133755_134028_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.6e-19
WP_004201083.1|134085_134613_-	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	32.4	2.0e-05
>prophage 1
NZ_CP020057	Escherichia coli strain AR_0069 plasmid unitig_3, complete sequence	31196	13561	21650	31196	transposase	Enterobacteria_phage(28.57%)	11	NA	NA
WP_001043260.1|13561_14377_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000131876.1|14713_14917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251694.1|14907_15129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001415369.1|15363_15693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|15879_16740_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|17030_17735_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000571065.1|17830_18340_+	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_000144779.1|18336_18993_+	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_001067855.1|19029_19734_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001340323.1|19996_20332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218107.1|20669_21650_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.3	4.2e-86
