The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020058	Escherichia coli strain AR_0061 chromosome, complete genome	4595238	51644	61085	4595238		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|51644_52571_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_004016985.1|52575_53307_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|53287_53395_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|53454_54186_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|54407_56093_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|56089_56809_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|56855_57326_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|57365_57827_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_004016981.1|57951_59952_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001292779.1|59948_61085_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 2
NZ_CP020058	Escherichia coli strain AR_0061 chromosome, complete genome	4595238	151061	157368	4595238		Enterobacteria_phage(50.0%)	6	NA	NA
WP_004016736.1|151061_152456_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_004016734.1|152630_153524_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.7e-46
WP_000699403.1|153896_154982_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_004016730.1|154981_155881_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.3e-28
WP_004016728.1|155939_156818_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_001100804.1|156822_157368_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 3
NZ_CP020058	Escherichia coli strain AR_0061 chromosome, complete genome	4595238	832994	853940	4595238	lysis,tRNA,transposase,tail	Enterobacteria_phage(25.0%)	25	NA	NA
WP_000837924.1|832994_834128_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|834268_834703_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|835480_835594_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|835662_835896_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|836212_836803_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000885599.1|836900_837476_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_012565075.1|837743_838103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077636664.1|838253_838619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001742940.1|838554_839487_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	9.3e-83
WP_001742941.1|839479_840271_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	6.3e-48
WP_001742942.1|840408_841866_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228688.1|842062_842248_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001194112.1|842464_842941_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
WP_080025563.1|843088_844432_+	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	95.5	8.7e-175
WP_080025564.1|844424_845135_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	70.7	4.0e-86
WP_000878218.1|845162_846029_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|846025_846325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072130784.1|846575_846770_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	92.2	9.3e-30
WP_001302840.1|846762_846951_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|847050_847266_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_080025565.1|847267_848503_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.9e-237
WP_001157377.1|848554_849490_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123737.1|849618_850992_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|851469_852453_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|852707_853940_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 4
NZ_CP020058	Escherichia coli strain AR_0061 chromosome, complete genome	4595238	1872304	1954699	4595238	integrase,portal,head,tail,plate,holin,capsid,terminase,transposase,protease	Enterobacteria_phage(36.51%)	95	1876678:1876692	1951091:1951105
WP_000131044.1|1872304_1874338_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|1874466_1875054_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004014313.1|1875067_1876540_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|1876553_1878224_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
1876678:1876692	attL	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001209100.1|1878436_1879105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|1879347_1880043_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|1880035_1881463_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102100.1|1881473_1882193_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004014310.1|1882720_1883575_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046293.1|1883800_1885126_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|1885234_1885471_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|1885482_1886076_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_004014298.1|1886665_1887517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|1893027_1893129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1893492_1893756_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1893755_1893896_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|1893930_1894158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|1894980_1895523_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1895597_1896185_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1896242_1896911_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131091.1|1896936_1899462_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001543518.1|1899451_1901095_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|1901063_1901774_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|1902086_1902416_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1902663_1903278_-	YagU family protein	NA	NA	NA	NA	NA
WP_001543517.1|1903695_1904385_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_080025596.1|1904381_1905305_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_080025597.1|1905228_1907376_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	8.5e-39
WP_000121349.1|1907385_1908342_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_004014280.1|1908320_1908731_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000915848.1|1909104_1909467_+	GtrA family protein	NA	U5P0S6	Shigella_phage	100.0	3.6e-59
WP_000703657.1|1909463_1910381_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	100.0	3.4e-170
WP_080025598.1|1910377_1911619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|1912507_1913476_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_021575904.1|1913640_1914453_+	hypothetical protein	NA	S5FNR8	Shigella_phage	98.5	1.0e-146
WP_001223322.1|1915225_1915660_-|tail	tail protein	tail	S5FXM8	Shigella_phage	100.0	1.9e-78
WP_000554679.1|1915631_1916282_-	hypothetical protein	NA	S5FKM2	Shigella_phage	99.5	3.4e-116
WP_022296596.1|1916285_1916870_-	YmfQ family protein	NA	M1FPN6	Enterobacteria_phage	99.5	4.9e-114
WP_063096396.1|1916860_1917919_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.3	1.1e-199
WP_151564717.1|1917905_1918331_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_001259067.1|1918330_1918879_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	100.0	1.7e-97
WP_080025600.1|1918878_1919958_-|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	99.4	5.9e-206
WP_053287268.1|1919954_1921331_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.9	7.4e-254
WP_001524109.1|1921355_1923263_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.2	0.0e+00
WP_001524108.1|1923347_1923671_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	98.1	9.4e-51
WP_000090998.1|1923667_1924024_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_080025601.1|1924023_1925520_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	4.2e-271
WP_000497751.1|1925503_1925674_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001569335.1|1925682_1926243_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_080025602.1|1926239_1926746_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
WP_001524103.1|1926720_1927131_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	8.8e-70
WP_000927711.1|1927127_1927451_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_080025603.1|1927453_1927654_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_001524102.1|1927703_1928909_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	7.7e-223
WP_001193631.1|1928923_1929574_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_001524100.1|1929551_1930793_-|portal	phage portal protein	portal	U5P411	Shigella_phage	100.0	6.9e-243
WP_000605606.1|1930792_1930975_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_065312442.1|1930986_1932483_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929184.1|1932716_1933211_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_001135221.1|1933336_1933687_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	2.0e-62
WP_080025604.1|1934105_1934666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032296919.1|1935034_1935427_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.7	5.0e-54
WP_080025605.1|1935410_1935887_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	95.6	6.6e-85
WP_000544528.1|1935873_1936179_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_080025606.1|1936500_1937190_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.2	6.5e-57
WP_040234538.1|1937186_1937327_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	5.0e-09
WP_040234537.1|1937323_1937686_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_080025607.1|1937682_1937973_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224907.1|1937965_1938136_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_040234535.1|1938135_1938591_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	2.3e-58
WP_074149993.1|1938587_1938689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040234534.1|1938782_1939328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001598055.1|1939467_1939794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224618.1|1940165_1940660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074149992.1|1940806_1940980_-	MarR family transcriptional regulator	NA	M1FPD5	Enterobacteria_phage	89.1	2.7e-20
WP_040234533.1|1940976_1941678_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	2.4e-128
WP_162780202.1|1941674_1942604_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	1.5e-112
WP_022296358.1|1942690_1943230_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|1943299_1943530_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259987.1|1943568_1944324_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_080025609.1|1944390_1945254_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	61.8	4.1e-93
WP_000233576.1|1945729_1945936_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_080025610.1|1946012_1946309_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	91.8	1.6e-44
WP_000100847.1|1946314_1947100_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_039002962.1|1947096_1947777_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	6.0e-132
WP_077249045.1|1947773_1947932_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	2.4e-23
WP_032255841.1|1947928_1948486_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_001386642.1|1948496_1948778_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763373.1|1948876_1949095_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488407.1|1949142_1949421_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446900.1|1949392_1949743_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	96.6	8.6e-58
WP_162780197.1|1949619_1950783_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	2.6e-228
WP_000893278.1|1950987_1952241_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1951091:1951105	attR	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001285288.1|1952252_1953356_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|1953643_1954699_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 5
NZ_CP020058	Escherichia coli strain AR_0061 chromosome, complete genome	4595238	4013870	4027053	4595238		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|4013870_4014632_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4014625_4015252_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_080025719.1|4015391_4016531_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4016593_4017586_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|4017679_4019044_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|4019132_4019909_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4019913_4020552_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|4020548_4021811_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|4021807_4022716_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|4022881_4023679_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|4023729_4024386_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|4024491_4027053_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 1
NZ_CP020059	Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence	87982	9134	49273	87982	integrase,transposase	Salmonella_phage(25.0%)	37	6803:6862	52323:52468
6803:6862	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_000427619.1|9134_10139_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|10320_10497_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|10826_11642_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|11702_12506_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|12505_13342_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|13313_13853_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|14062_14923_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|15622_16447_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|16506_17295_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_014454105.1|17364_17919_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001217881.1|18152_18710_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004098837.1|18873_21882_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.0	0.0e+00
WP_004098840.1|21929_22547_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_004098841.1|22694_23288_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004098843.1|23307_23655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098845.1|23859_24162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098847.1|24311_24956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098855.1|25041_25692_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004098858.1|25688_25997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032722152.1|26097_26649_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.8	1.8e-17
WP_004098862.1|26781_27036_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_020323529.1|27274_27352_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000509966.1|28100_28706_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|28800_31698_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_004143398.1|32137_32533_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077253535.1|32581_33928_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|34152_34785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|34813_36217_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_032454252.1|36418_36658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343466.1|38172_38295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361404.1|38366_39389_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004152391.1|39673_41389_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|41498_44528_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|44634_45660_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|45656_46436_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|46822_47704_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|47953_49273_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
52323:52468	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTCCAGCGGATATCAGCGCTGAAAGATGATGGCTGAGCGTGGAGGCAGGAATCTCAAGGTGCTTCTGCAGTTCGCCAACCGGCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP020059	Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence	87982	66870	75408	87982	integrase,transposase	Burkholderia_phage(42.86%)	8	66137:66154	73321:73338
66137:66154	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_001288432.1|66870_68304_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|68337_69552_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|69812_70577_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|70719_70986_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|71206_71680_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|71835_72849_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|73241_73811_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
73321:73338	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001749982.1|74688_75408_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
>prophage 1
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	0	820	50999	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|115_820_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	9503	10472	50999	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_080025759.1|9503_10472_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
>prophage 3
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	14447	15152	50999	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|14447_15152_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	19336	20041	50999	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|19336_20041_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	25395	27083	50999		Clostridioides_phage(50.0%)	2	NA	NA
WP_000203396.1|25395_26040_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_000516402.1|26420_27083_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 6
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	31750	43537	50999	integrase,transposase	Enterobacteria_phage(30.0%)	15	NA	NA
WP_000220560.1|31750_32032_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_080025760.1|32797_33403_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.5	4.1e-116
WP_020219413.1|33414_33555_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	93.8	1.3e-09
WP_001235713.1|33718_34276_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|34458_35319_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000034420.1|35576_36368_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|36836_37082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|37119_37983_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|38128_38368_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|38431_39136_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|39182_40487_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|40525_41194_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|41229_41466_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|41462_41825_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|41842_43537_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 7
NZ_CP020060	Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence	50999	46856	49897	50999		Pandoravirus(50.0%)	5	NA	NA
WP_000259031.1|46856_47696_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|47689_48037_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|48200_48992_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|48997_49288_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|49399_49897_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
