The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	419754	504536	5345997	integrase,protease,holin,head,tRNA,capsid,tail,terminase,portal,transposase	Enterobacteria_phage(16.0%)	90	442762:442785	481783:481806
WP_016947271.1|419754_421173_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|421224_421617_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|421620_421974_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|422595_424767_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|424815_426018_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|426364_427606_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|427663_428023_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004174934.1|428153_429146_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004159719.1|429326_430988_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004154521.1|430984_432220_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|432483_433449_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|433502_434240_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_032447335.1|434251_435949_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.7	3.0e-47
WP_002913372.1|436331_437546_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|437617_437689_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_014907146.1|438027_439224_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_009486224.1|439220_439679_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
WP_002913369.1|439811_440720_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_020801784.1|440729_441611_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|441978_442461_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
442762:442785	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032432293.1|442979_444149_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	9.5e-202
WP_072200997.1|444158_444641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077253737.1|444705_444891_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.1	2.0e-13
WP_032432295.1|444898_445564_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	66.7	5.1e-51
WP_026055975.1|445808_446732_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
WP_077254344.1|446877_447102_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
WP_048267937.1|447416_448277_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.4	2.8e-73
WP_048333912.1|448358_449171_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_048997713.1|449214_449574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048997714.1|449946_450204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048997715.1|450537_451248_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	5.2e-86
WP_004104275.1|451355_451550_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
WP_032420709.1|451627_452143_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	64.0	3.0e-59
WP_004104272.1|452621_452897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048997717.1|452889_454419_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	5.1e-203
WP_025711392.1|454415_455387_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.6e-109
WP_020317326.1|455356_456001_+	bacteriophage Lambda NinG protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_020317301.1|455997_456642_+	SAM-binding domain protein	NA	I6PDF5	Cronobacter_phage	68.2	2.0e-84
WP_029497192.1|456631_457036_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
WP_001294159.1|457245_457632_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|457618_457900_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_048997722.1|457899_458529_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	8.4e-88
WP_032448071.1|458531_458807_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
WP_004899656.1|458757_458949_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	2.9e-23
WP_004216876.1|459037_459283_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_044071291.1|459358_459760_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_077260929.1|459861_460212_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.7	1.2e-51
WP_001119413.1|460371_460869_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_023328632.1|460872_462624_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.6	9.7e-251
WP_023328631.1|462771_463998_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|463990_464590_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_048997605.1|464599_465838_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	2.3e-158
WP_048997606.1|465915_466233_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.1e-22
WP_048997607.1|466241_466580_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	2.5e-38
WP_048997608.1|466576_467026_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	2.3e-63
WP_023302599.1|467022_467370_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_048997609.1|467426_468131_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.2e-79
WP_021313622.1|468161_468566_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|468568_468874_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|468947_469181_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_031592502.1|469241_472628_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.6	2.8e-302
WP_031592499.1|472649_473123_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.9e-55
WP_004864228.1|473109_473586_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|473598_473979_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_080031128.1|473975_477053_+	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
WP_047670084.1|477923_479216_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.0	2.4e-68
WP_057775242.1|479216_479966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443530.1|481120_481360_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
WP_042937071.1|481316_481688_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	2.4e-26
WP_004149224.1|481894_482824_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
481783:481806	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|483113_483875_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|483936_485265_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913359.1|485632_485917_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_002913358.1|486076_487387_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004149220.1|487386_489531_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|489740_490226_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|490246_490798_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|490965_491898_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|491939_493025_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|493027_493852_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|493851_494661_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174962.1|494660_495209_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|495240_495522_+	YfcL family protein	NA	NA	NA	NA	NA
WP_020801923.1|495583_497572_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|497730_498951_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_020801925.1|499160_500336_+	MFS transporter	NA	NA	NA	NA	NA
WP_004174966.1|500422_501400_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002913228.1|501510_502647_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|502710_503724_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913226.1|503723_504536_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	712402	719309	5345997	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|712402_713266_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|713276_714050_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|714292_715186_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|715431_716793_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|717111_717834_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|717830_719309_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	1122821	1173086	5345997	plate,transposase,protease	Staphylococcus_phage(40.0%)	42	NA	NA
WP_002910830.1|1122821_1123568_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_048997745.1|1123979_1124993_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|1124985_1125786_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|1125823_1125946_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_032447341.1|1126563_1127505_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_020801826.1|1127598_1128588_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|1128613_1129945_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_020801824.1|1129972_1131181_+	propionate kinase	NA	NA	NA	NA	NA
WP_020801813.1|1131209_1133504_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.0e-159
WP_009484368.1|1133933_1135049_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|1135158_1136073_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004148804.1|1136082_1137369_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004200318.1|1137365_1138241_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_004175491.1|1138237_1138957_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|1138962_1139856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048997753.1|1140139_1141783_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1141832_1142309_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|1142407_1143334_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001339197.1|1144467_1145676_-|transposase	IS4-like element ISVsa5 family transposase	transposase	NA	NA	NA	NA
WP_004175495.1|1146285_1147092_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020801945.1|1147066_1147966_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|1148075_1148558_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_020801940.1|1148748_1149447_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_077260885.1|1149472_1150057_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|1150126_1150456_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_015874926.1|1150542_1150788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801944.1|1151025_1152366_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_020801943.1|1152362_1153016_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_020801942.1|1153019_1154717_+	OmpA family protein	NA	NA	NA	NA	NA
WP_080031132.1|1155175_1157662_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080031133.1|1160350_1161706_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_020802729.1|1161706_1162216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802725.1|1162724_1163105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071600595.1|1163367_1163610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802707.1|1163606_1164116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|1164358_1164625_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_077260886.1|1164658_1165786_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_020802717.1|1165769_1169180_+	intracellular multiplication/macrophage-killing	NA	NA	NA	NA	NA
WP_004148784.1|1169313_1171077_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032447798.1|1171076_1172123_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004189400.1|1172097_1172640_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|1172642_1173086_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	1707089	1729710	5345997	integrase,transposase	Acidithiobacillus_phage(33.33%)	15	1698902:1698916	1726121:1726135
1698902:1698916	attL	GTGGTTTTCATTGTA	NA	NA	NA	NA
WP_032447479.1|1707089_1707965_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032447480.1|1707948_1709499_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_020802064.1|1709495_1711862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802067.1|1711861_1712296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802065.1|1712690_1712885_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_071596078.1|1712868_1713201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001189111.1|1715082_1716591_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032447921.1|1718023_1718365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032447919.1|1718586_1720116_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.7	1.8e-120
WP_020802959.1|1720126_1720870_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	45.4	1.0e-55
WP_032447922.1|1721086_1722298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955172.1|1724993_1726200_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
1726121:1726135	attR	TACAATGAAAACCAC	NA	NA	NA	NA
WP_155120821.1|1726617_1726908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019449.1|1726933_1727914_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_128933181.1|1728560_1729710_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.3	2.8e-49
>prophage 5
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	1837623	1848511	5345997		Escherichia_phage(87.5%)	9	NA	NA
WP_020802431.1|1837623_1840731_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|1840785_1842051_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1842081_1843170_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|1843256_1843517_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_023282555.1|1843814_1844675_+	class A extended-spectrum beta-lactamase SHV-27	NA	A0A077SL40	Escherichia_phage	99.3	2.9e-155
WP_002210513.1|1844695_1845457_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|1845718_1846621_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_048997799.1|1846632_1847898_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.7e-233
WP_002210516.1|1847890_1848511_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	2216107	2301991	5345997	integrase,holin,head,tRNA,capsid,transposase,terminase,portal,tail	Klebsiella_phage(56.1%)	94	2253461:2253476	2305678:2305693
WP_002901088.1|2216107_2216608_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|2216724_2217171_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032447883.1|2217154_2217946_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|2218047_2219232_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|2219263_2219956_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|2220101_2220611_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|2220597_2220954_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|2220943_2221183_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|2221484_2222498_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|2222555_2222657_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|2222656_2222731_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|2222848_2222974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|2223033_2223297_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|2223427_2224066_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001339197.1|2225119_2226328_+|transposase	IS4-like element ISVsa5 family transposase	transposase	NA	NA	NA	NA
WP_004150784.1|2227068_2228112_-	type II asparaginase	NA	NA	NA	NA	NA
WP_020802844.1|2228414_2229623_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_020802842.1|2229696_2231481_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|2231487_2232378_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|2232498_2234007_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|2234317_2235004_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153244925.1|2235453_2235642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802836.1|2235620_2236253_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|2236819_2237017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|2237132_2238143_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|2238139_2239546_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|2239601_2240489_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|2240505_2241012_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|2241038_2241533_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|2241623_2241809_-	general stress protein	NA	NA	NA	NA	NA
WP_020802850.1|2242431_2243625_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|2243737_2243965_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_014907803.1|2244403_2244727_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020802853.1|2244719_2245112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802852.1|2245108_2245822_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|2246094_2246247_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_057202256.1|2246401_2247898_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	64.2	3.4e-127
WP_080031143.1|2247959_2259176_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.2	0.0e+00
2253461:2253476	attL	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
WP_080031144.1|2259238_2259850_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	71.5	2.6e-70
WP_021462612.1|2259865_2260216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880253.1|2260247_2260958_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_057172004.1|2260959_2261715_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	8.8e-124
WP_032418052.1|2261711_2262050_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	90.2	2.2e-58
WP_057194021.1|2262049_2265406_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.7	0.0e+00
WP_014228914.1|2265638_2266004_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|2266061_2266523_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|2266554_2266956_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_032418049.1|2266952_2267342_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	7.3e-58
WP_014228910.1|2267322_2267661_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_032418048.1|2267657_2267975_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_014907814.1|2267955_2268216_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|2268274_2269561_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032418047.1|2269638_2270559_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.6e-148
WP_057172085.1|2270595_2271855_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	4.7e-223
WP_032418045.1|2271854_2272034_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_032418044.1|2272027_2273749_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	6.5e-191
WP_012542168.1|2273748_2274183_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|2274432_2274864_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_128972059.1|2274860_2275133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861442.1|2275129_2275492_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.8e-58
WP_004148005.1|2275848_2276916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861440.1|2276905_2277478_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	54.3	2.3e-55
WP_057171893.1|2277882_2278158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861436.1|2278154_2278502_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	76.5	3.7e-37
WP_032443843.1|2278498_2279038_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.1	2.0e-98
WP_025861434.1|2279034_2279334_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	82.8	4.5e-39
WP_004147999.1|2280264_2280414_+	small membrane protein	NA	NA	NA	NA	NA
WP_155120822.1|2281151_2281355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|2281598_2282201_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_057171894.1|2282217_2283249_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_032418037.1|2283448_2283841_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	1.0e-11
WP_077253879.1|2283881_2284172_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_032418036.1|2284183_2284417_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	69.7	6.4e-25
WP_057171830.1|2284942_2285638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071957312.1|2285649_2286303_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080031145.1|2286649_2287378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057171832.1|2287729_2288539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057171833.1|2288569_2289091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057171834.1|2289578_2290019_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021462583.1|2290032_2290497_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.7e-61
WP_023279535.1|2290489_2291473_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	1.2e-45
WP_057171835.1|2291524_2292079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342905.1|2292081_2292294_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	57.6	1.9e-15
WP_032428184.1|2292399_2292780_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	37.7	1.9e-10
WP_040234937.1|2293121_2293436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160636.1|2293826_2294021_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|2294063_2294408_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_057171836.1|2294549_2296688_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	6.6e-100
WP_012542206.1|2296740_2296986_+	excisionase	NA	NA	NA	NA	NA
WP_023328117.1|2296966_2298094_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|2298211_2299462_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|2299702_2300353_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|2300369_2300828_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|2300884_2301991_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2305678:2305693	attR	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
>prophage 7
NZ_CP020061	Klebsiella pneumoniae strain AR_0117, complete genome	5345997	2561076	2570550	5345997	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|2561076_2562798_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2562842_2563544_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2563897_2564116_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2564246_2566526_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2566556_2566874_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2567199_2567421_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2567497_2569438_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_004191152.1|2569434_2570550_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP020062	Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence	152697	0	70849	152697	transposase,integrase	Escherichia_phage(35.71%)	53	4006:4034	49643:49671
WP_004152065.1|1704_2652_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|2678_2990_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|3054_3978_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
4006:4034	attL	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_004197688.1|4650_4908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|5527_6964_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|7946_9224_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|9286_11284_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|12323_13531_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|14959_15391_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|15641_17117_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|17109_17790_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|17979_19365_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|19393_19747_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|19860_21153_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|21163_24310_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|24396_24837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|24963_27411_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|27451_27649_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|27682_28420_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001067855.1|31253_31958_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001620097.1|32810_33899_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|33985_34246_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_011117369.1|34543_35404_+	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|35424_36186_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|36446_37349_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|37360_38626_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|38618_39239_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_001067855.1|39950_40655_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032418008.1|40730_41231_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|41358_42198_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|42191_42539_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000186237.1|42695_43328_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000381802.1|43410_43944_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000845039.1|44089_45103_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_048228299.1|45089_45695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019304.1|45705_46275_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|46274_46775_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_004118231.1|48860_49028_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|50130_50652_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
49643:49671	attR	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_004118237.1|50648_51602_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|51687_54012_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|54056_54959_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|54955_55954_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|55950_56907_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|56907_57675_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|57773_58067_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|58397_58640_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|58937_59942_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|60345_61356_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|61816_62899_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|63020_66095_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|66146_67400_+	lactose permease	NA	NA	NA	NA	NA
WP_001339197.1|69640_70849_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 2
NZ_CP020062	Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence	152697	79322	85874	152697		Wolbachia_phage(50.0%)	3	NA	NA
WP_020802283.1|79322_79871_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	30.8	6.6e-20
WP_020804816.1|80055_80646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080031172.1|80702_85874_-	conjugative relaxase	NA	A0A1P8DII4	Virus_Rctr197k	29.6	2.1e-06
>prophage 3
NZ_CP020062	Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence	152697	108904	115205	152697		Hokovirus(25.0%)	7	NA	NA
WP_020802753.1|108904_110623_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	24.5	5.8e-22
WP_020802754.1|110651_110912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113772542.1|111549_111936_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.6	1.9e-05
WP_032426056.1|111978_112296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071599372.1|112356_112665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804822.1|112724_113546_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	3.0e-45
WP_042922549.1|114371_115205_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.7	5.3e-21
>prophage 4
NZ_CP020062	Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence	152697	121092	125866	152697		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_020802171.1|121092_123102_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	2.7e-26
WP_004152655.1|123170_123413_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020802172.1|123460_123973_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_032425974.1|124902_125115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922559.1|125302_125866_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	9.7e-19
>prophage 5
NZ_CP020062	Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence	152697	129691	151801	152697	transposase	Macacine_betaherpesvirus(18.18%)	17	NA	NA
WP_026055975.1|129691_130615_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
WP_004152643.1|132808_133057_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152644.1|133105_133648_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152645.1|134423_134987_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_001339197.1|135311_136520_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004198570.1|137779_138010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|138101_138329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118473.1|139110_139428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152754.1|139462_139717_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|139953_140379_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004152753.1|140899_141130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|141363_142848_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|143253_143679_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|143678_144950_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152062.1|147901_148873_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|148872_150039_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|150790_151801_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
>prophage 1
NZ_CP020063	Klebsiella pneumoniae strain AR_0117 plasmid unitig_2, complete sequence	109019	0	22233	109019		Salmonella_phage(91.67%)	24	NA	NA
WP_014342074.1|102_315_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_021313779.1|766_1864_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	49.7	2.1e-73
WP_023279495.1|2185_2830_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	2.2e-99
WP_021313777.1|2905_3400_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_080031176.1|3588_4674_+	exonuclease	NA	J9Q7S9	Salmonella_phage	84.5	1.4e-183
WP_049594367.1|4903_6820_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	9.5e-300
WP_080031177.1|6809_7556_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.3	3.8e-79
WP_021313773.1|7565_8135_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_080031178.1|8210_10514_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342181.1|10644_11787_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342179.1|12932_14036_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_019704560.1|14037_14451_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
WP_032734165.1|14447_14924_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	6.4e-72
WP_080031179.1|14923_15568_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	3.1e-93
WP_046882083.1|15631_16051_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	3.8e-52
WP_014342174.1|16060_16618_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_032440505.1|16743_17577_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.7	1.3e-64
WP_023279507.1|17762_18356_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_032423059.1|18553_18781_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.6e-31
WP_032440503.1|19360_19954_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	1.0e-90
WP_032734169.1|20106_20646_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.5	1.7e-28
WP_019704567.1|20946_21372_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|21371_21527_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_064184673.1|21654_22233_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.5	1.7e-55
>prophage 2
NZ_CP020063	Klebsiella pneumoniae strain AR_0117 plasmid unitig_2, complete sequence	109019	25801	87258	109019	tail,terminase,transposase	Salmonella_phage(89.29%)	61	NA	NA
WP_009310015.1|25801_27334_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_080031182.1|27516_27834_+	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	4.6e-42
WP_080031183.1|27916_28753_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032734115.1|28825_29341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048333204.1|30926_31145_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	80.6	1.1e-26
WP_080031185.1|31157_31370_+	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	1.2e-25
WP_080031186.1|31506_31818_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	2.0e-29
WP_004109918.1|31937_32345_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.8e-23
WP_080031187.1|32471_32753_+	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	6.9e-42
WP_064165120.1|32957_33440_+	hypothetical protein	NA	J9Q805	Salmonella_phage	78.1	9.4e-71
WP_004109904.1|34019_34223_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|34273_34924_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_123827665.1|35248_35548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342147.1|35557_36088_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_004109889.1|36243_36681_+	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_004109887.1|36731_37007_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_080031188.1|37009_38569_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	91.9	2.4e-277
WP_032734124.1|38652_39333_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.7	2.1e-108
WP_023279438.1|39332_40001_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_032423019.1|39997_40639_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.7	6.8e-109
WP_064184678.1|40628_41180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109872.1|41176_42067_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109869.1|42076_42343_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|42518_43160_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|43162_44419_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_026005939.1|44436_46026_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	2.3e-275
WP_023279435.1|46048_46948_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_004109857.1|46974_47853_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279434.1|47931_48360_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
WP_023279433.1|48407_48842_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_023279432.1|48841_49675_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_004109848.1|49772_50117_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313126.1|50107_50581_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_047066294.1|50582_50975_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
WP_023279430.1|51042_51789_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_004109835.1|51850_52168_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109830.1|52284_52518_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_080031189.1|52525_57061_+	tape measure protein	NA	J9Q712	Salmonella_phage	70.2	0.0e+00
WP_004109823.1|57104_57440_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_004109820.1|57526_58225_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|58217_59015_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|59002_59614_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_080031190.1|59630_71768_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	57.5	2.4e-29
WP_080031191.1|71820_73266_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	8.0e-41
WP_004109805.1|73356_73680_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_021313119.1|73693_74386_+	structural protein P5	NA	J9Q7Y7	Salmonella_phage	89.6	4.1e-120
WP_021313118.1|74388_74640_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	5.8e-24
WP_032734133.1|75056_75449_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
WP_060598465.1|75433_76183_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	2.7e-16
WP_021313115.1|76367_77033_+	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_004110193.1|77032_77395_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_135710443.1|77436_79155_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	27.2	7.1e-12
WP_023279420.1|79328_80054_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_014342110.1|80118_81459_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
WP_080031193.1|81612_82731_+	DNA primase	NA	J9Q720	Salmonella_phage	90.8	1.6e-201
WP_080031194.1|82770_83937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080031195.1|84225_85014_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	1.4e-71
WP_023279474.1|85093_85561_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
WP_064406281.1|85560_86883_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.5	1.9e-227
WP_040170975.1|86882_87059_+	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	2.0e-15
WP_049594359.1|87042_87258_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	6.5e-24
>prophage 3
NZ_CP020063	Klebsiella pneumoniae strain AR_0117 plasmid unitig_2, complete sequence	109019	90266	108078	109019	integrase	Salmonella_phage(64.29%)	18	88547:88564	99742:99759
88547:88564	attL	AATGATTCCATACATCCA	NA	NA	NA	NA
WP_071925344.1|90266_91079_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	4.7e-91
WP_040170138.1|91088_91475_+	phage family protein	NA	Q716B1	Shigella_phage	72.0	4.9e-46
WP_032440523.1|91471_91717_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_080031196.1|91811_92429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060853801.1|92438_92849_+	toxin YafO	NA	NA	NA	NA	NA
WP_052455483.1|92912_93272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032414134.1|93626_94727_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_014342091.1|94721_95102_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080031197.1|95704_97984_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.1	4.5e-248
WP_060611509.1|98080_99313_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.6e-212
WP_080031198.1|99493_103012_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
99742:99759	attR	TGGATGTATGGAATCATT	NA	NA	NA	NA
WP_032414135.1|103008_103452_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	2.2e-58
WP_023279488.1|103604_103820_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_023279489.1|104169_104601_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	3.1e-65
WP_040213770.1|104720_105728_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
WP_023279491.1|105788_106733_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	93.0	3.1e-171
WP_019704549.1|106732_106999_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_040205269.1|107001_108078_+	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
>prophage 1
NZ_CP020064	Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence	83376	71127	82707	83376	transposase	Aeromonas_phage(25.0%)	13	NA	NA
WP_020314651.1|71127_71829_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
WP_020314631.1|72263_72494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314635.1|72697_72943_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_046960466.1|72939_73389_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314652.1|73400_74675_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_020314634.1|74849_75077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644718.1|75121_75748_-	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314642.1|76345_76966_+	resolvase	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644719.1|76985_77252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314639.1|77372_78326_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_020314646.1|78322_78934_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314648.1|79251_79530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124025.1|79719_82707_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
>prophage 1
NZ_CP020065	Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence	74540	1701	61253	74540	bacteriocin,transposase,integrase	Escherichia_phage(20.0%)	54	757:771	30971:30985
757:771	attL	GATCCTGCGCCAGCA	NA	NA	NA	NA
WP_020801687.1|1701_2487_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
WP_020804422.1|2504_2870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568031.1|3408_4164_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_017901447.1|5156_5789_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
WP_017901448.1|5788_6163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801689.1|6402_7377_+	StbA protein	NA	A0A222YXF2	Escherichia_phage	44.2	1.5e-70
WP_020801683.1|7380_7773_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_146642489.1|8130_8358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026055975.1|8403_9327_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
WP_004152641.1|10786_11218_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|11214_11943_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152639.1|11939_12266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152638.1|12321_12696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004220208.1|12873_13953_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_004118124.1|14024_14186_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004152759.1|14885_15158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152758.1|15154_15505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802743.1|16140_16497_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	5.7e-25
WP_019706020.1|16557_16770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|16780_17005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|17085_17406_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_020801586.1|17395_17674_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	1.9e-07
WP_020801587.1|17674_18076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064180866.1|18904_19726_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	8.8e-45
WP_001568108.1|20120_20606_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_015065623.1|21034_21433_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015065624.1|21639_22335_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_004208838.1|22418_22790_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_004178060.1|22843_23212_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004178059.1|23225_23531_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001339197.1|23935_25144_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004153030.1|25574_26102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152629.1|26291_27023_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_004152630.1|27382_29692_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004153029.1|29691_34953_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
30971:30985	attR	TGCTGGCGCAGGATC	NA	NA	NA	NA
WP_004152303.1|35032_35758_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|35915_36512_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|36531_36879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178052.1|37093_37639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|37995_40317_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|40318_40597_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004152294.1|40865_41417_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004199332.1|41737_42016_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|42232_42310_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|42302_43160_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001339197.1|43554_44763_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_011977766.1|45541_45877_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|46049_46331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|46384_46996_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_077274559.1|47309_48461_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.0	4.1e-173
WP_000443938.1|48485_49937_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009309939.1|49929_51972_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009309938.1|52158_57894_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_020802676.1|58355_61253_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
>prophage 1
NZ_CP020066	Klebsiella pneumoniae strain AR_0117 plasmid unitig_5, complete sequence	72663	1896	56677	72663	protease,transposase,integrase	Escherichia_phage(23.53%)	55	4629:4688	65146:65965
WP_080031202.1|1896_4671_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
4629:4688	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|4680_5385_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|5957_6323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|6322_9559_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
WP_000342688.1|9558_11088_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001749975.1|11089_11506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020319858.1|12278_12416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|12424_13141_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|13142_13511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|13803_14037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|14147_14468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|14522_14702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|15428_15938_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_012561126.1|17290_17623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001750002.1|17831_18116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|18184_18544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|18540_18837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932975.1|19722_19962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|19971_20376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|20433_20859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861760.1|21273_21714_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|21701_22967_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|23117_23909_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|23923_24265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|24824_25544_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|27500_28070_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|28462_29476_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|29631_30105_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|30325_30592_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|30734_31499_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|31759_32974_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|33007_34441_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|34822_35029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|35033_35522_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|35730_36042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|36077_36392_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|36388_36733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|36748_37099_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|37162_37897_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|37905_38187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|38196_38490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|38539_38857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|38856_41457_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|41474_42188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|42195_42423_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|42438_43479_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000646594.1|43697_44396_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|44469_45291_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_000101710.1|45290_46451_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000128596.1|46492_47488_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000792636.1|47487_48021_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_004152397.1|52038_53358_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|53607_54489_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|54875_55655_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|55651_56677_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
65146:65965	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCTTATATATCCGCAGGCTATCTTATCATCAGTTTCTGACCGTGTTCAGTGACCGAACAACCCGAACCAGACCCCCGTTTCTTTTCCTGTCCCGGAGGGGGCTTTCTGGTATCTCATATAATGATTTCAGTAAAACATACTGAGGCCGGAGAACGGCGCCGTTTGTGCTGGTTTTTGTTGCATCTGGAGGGGATTGCGCATGGTGTGAGTGGCTGTTTTTTTGATCATTTTCACAAAAACGCAAATTTACAGACTTGACATGAAAAACAAGGCAGCGTAATTTTTATACTGTATATAAAACCAGTGGTTATATGTACAGTATTTTATTTTAGTTTATTGTTTTAAAAGTCAAAGAGGAAAAGTATATGAGTGGCGGAGACGGACGAGGTCCGGGTAATTCAGGTCTGGGACACAATGGTGGTCAGGCCAGTGGGAATGTGAA	NA	NA	NA	NA
