The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	319477	365973	4825100	terminase,capsid,holin,tail	Cronobacter_phage(31.03%)	67	NA	NA
WP_032104711.1|319477_319783_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	39.6	3.0e-14
WP_032648602.1|319894_320257_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
WP_032673203.1|320253_321195_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	8.6e-161
WP_032104988.1|321191_322673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032104989.1|322702_324718_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	62.1	1.9e-40
WP_032673201.1|324776_327254_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.0	0.0e+00
WP_048248317.1|327240_327633_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.3	7.4e-66
WP_032104766.1|327642_328113_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	2.4e-79
WP_032104765.1|328112_328616_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	86.8	1.4e-85
WP_032104763.1|328615_330940_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	51.1	6.8e-151
WP_032104762.1|330997_331372_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.4	5.1e-24
WP_032104761.1|331444_332188_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.5	1.7e-63
WP_032104759.1|332238_332994_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.0	4.9e-58
WP_032104758.1|333054_333438_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	4.9e-38
WP_032104757.1|333434_333803_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.8	8.8e-45
WP_032104756.1|333805_334156_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	9.9e-38
WP_032104755.1|334155_334329_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	49.1	6.0e-12
WP_032104754.1|334328_334709_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	51.6	4.5e-28
WP_032104753.1|334711_334927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032104752.1|334937_336032_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	63.4	5.3e-122
WP_032104751.1|336043_336472_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	61.5	9.6e-43
WP_032104749.1|336475_337864_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.8	8.8e-154
WP_123906381.1|337934_338135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164722127.1|338127_339108_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	66.2	2.7e-109
WP_032673199.1|339064_340513_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	73.1	4.2e-191
WP_032104745.1|340524_341997_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.7	6.7e-253
WP_032104744.1|341996_342599_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	82.6	2.6e-78
WP_032104743.1|342602_342821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105120.1|342972_343404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105111.1|343835_344114_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	6.7e-13
WP_032673198.1|344110_344653_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.1e-74
WP_001514184.1|344655_344931_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|344927_345329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105041.1|345924_346401_-	endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.9	5.1e-37
WP_032105042.1|346400_347084_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	3.2e-56
WP_039671103.1|347193_347835_-	Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	94.4	1.2e-105
WP_039671104.1|347827_347998_-	NinE family protein	NA	G8C7V4	Escherichia_phage	85.7	1.2e-20
WP_032105130.1|347990_348446_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	1.9e-33
WP_063438729.1|348949_349663_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	45.8	2.8e-23
WP_048248323.1|349835_350291_-	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	36.7	3.4e-06
WP_017693170.1|350287_350584_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
WP_032104894.1|350825_351125_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	4.4e-18
WP_032104884.1|351129_352503_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.0	2.4e-167
WP_032104885.1|352499_353585_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.6e-84
WP_164722129.1|353577_353724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032104888.1|353807_354353_-	hypothetical protein	NA	G8C7U3	Escherichia_phage	82.3	3.6e-79
WP_001514164.1|354382_354634_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_032104889.1|354761_355454_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.4	1.2e-58
WP_048248330.1|355467_355842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032936032.1|356725_356989_+	hypothetical protein	NA	S4TNW9	Salmonella_phage	43.4	1.8e-07
WP_032105105.1|357149_357398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032105103.1|357394_357553_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	5.4e-20
WP_001752704.1|357549_357756_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_032105026.1|357834_358113_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	75.3	3.4e-33
WP_032105027.1|358122_359037_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	99.3	1.2e-170
WP_032105028.1|359033_359516_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	99.4	8.4e-80
WP_032105029.1|359524_359953_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.7	1.1e-70
WP_032105030.1|359949_360102_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_080024709.1|360098_361547_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	51.1	1.8e-93
WP_032103520.1|361758_362466_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	33.5	1.0e-25
WP_001856439.1|362462_362654_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	5.4e-14
WP_032103521.1|362745_362961_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.9	7.7e-17
WP_032103522.1|362960_363458_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	1.3e-70
WP_032103556.1|363435_363675_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_032103523.1|363684_364302_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	75.1	3.4e-89
WP_032103524.1|364411_364660_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	6.4e-15
WP_032103525.1|364692_365973_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	51.7	6.0e-125
>prophage 2
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	1182145	1285609	4825100	holin,tail,head,integrase,terminase,transposase	Salmonella_phage(31.17%)	126	1235540:1235586	1285623:1285669
WP_032103080.1|1182145_1184179_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.3	9.9e-21
WP_017382531.1|1184307_1184895_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_032103079.1|1184908_1186381_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017694353.1|1186394_1188059_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	5.2e-60
WP_032103078.1|1188152_1188851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023303250.1|1189051_1190620_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032103077.1|1190718_1191732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032103076.1|1191731_1192565_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080024763.1|1192557_1193394_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.1e-13
WP_032103075.1|1193380_1194085_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	5.3e-22
WP_017382537.1|1194193_1194667_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003858846.1|1194804_1195575_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_023296074.1|1195595_1197275_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_026094386.1|1197288_1198068_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_015571195.1|1198173_1199055_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023296073.1|1199603_1200272_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_032103074.1|1200641_1200800_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003858859.1|1201356_1201848_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_006809708.1|1201858_1202215_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_032105018.1|1202211_1202646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032105017.1|1202696_1203587_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032105016.1|1203692_1204814_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_032673160.1|1204743_1207899_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_032673158.1|1207908_1208973_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015571204.1|1209079_1211788_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.6	4.2e-67
WP_032103885.1|1212276_1212525_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_032103887.1|1212510_1214079_-	DUF3327 domain-containing protein	NA	NA	NA	NA	NA
WP_032103889.1|1214202_1216347_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003858880.1|1216420_1216762_-	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_032103890.1|1216794_1217898_-	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003858882.1|1218089_1218680_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003858883.1|1218669_1219038_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003858884.1|1219158_1219812_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_015571209.1|1219848_1220136_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	38.1	9.0e-05
WP_017382553.1|1220116_1220446_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023296063.1|1220585_1221455_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023303238.1|1221562_1222999_+	MFS transporter	NA	NA	NA	NA	NA
WP_015571212.1|1223066_1224311_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_015571213.1|1224311_1225283_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.4	3.5e-24
WP_032103892.1|1225358_1226501_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032103893.1|1226493_1227519_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_032647590.1|1227534_1228770_-	MFS transporter	NA	NA	NA	NA	NA
WP_032103895.1|1229064_1230453_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_032103896.1|1230555_1232529_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_032103898.1|1232656_1234840_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017382562.1|1235040_1235316_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
1235540:1235586	attL	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_080024764.1|1235766_1236090_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.3	8.9e-25
WP_058658497.1|1236089_1236329_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	74.4	5.4e-27
WP_048248395.1|1236428_1236695_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	2.3e-39
WP_080473457.1|1236824_1237403_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	46.6	1.1e-30
WP_039268850.1|1238019_1238253_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
WP_006809145.1|1238360_1239032_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_017694302.1|1239032_1239347_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
WP_080024765.1|1239390_1243140_-	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	61.6	0.0e+00
WP_023296453.1|1243149_1243683_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.0	4.0e-54
WP_080024823.1|1243625_1244345_-	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	82.3	1.9e-120
WP_080024766.1|1244344_1245049_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
WP_058660773.1|1245218_1245566_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.0	4.5e-59
WP_063963902.1|1245565_1248688_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	70.7	0.0e+00
WP_063852030.1|1248750_1249488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063852032.1|1249582_1249858_-	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	71.2	3.1e-26
WP_022651118.1|1250024_1250537_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	75.4	2.7e-68
WP_088581786.1|1250607_1251755_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_063963903.1|1251952_1252606_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.6	2.7e-113
WP_058655821.1|1252644_1253379_-	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	86.8	5.0e-116
WP_023306061.1|1253396_1253783_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	96.9	6.6e-67
WP_023306060.1|1253779_1254217_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	97.9	2.5e-75
WP_022651014.1|1254224_1254587_-	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	93.3	1.9e-63
WP_020838521.1|1254579_1254759_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
WP_080024767.1|1254758_1255160_-	hypothetical protein	NA	I6S619	Salmonella_phage	79.7	2.2e-57
WP_080024768.1|1255222_1255507_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	72.2	1.6e-30
WP_045345391.1|1255517_1256621_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	74.1	6.7e-157
WP_042889540.1|1256634_1257093_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	77.9	2.3e-58
WP_080024769.1|1257105_1258368_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.3	2.3e-225
WP_058689308.1|1258371_1259301_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	81.5	2.7e-135
WP_063161850.1|1259254_1260607_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	76.9	4.0e-204
WP_080024770.1|1260621_1261869_-|terminase	terminase	terminase	I6RSK1	Salmonella_phage	98.6	3.5e-218
WP_032104706.1|1261865_1262321_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	84.0	2.9e-66
WP_032104708.1|1262353_1262992_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.9	8.2e-115
WP_017383055.1|1263005_1263155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017383056.1|1263158_1263377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032105097.1|1263530_1264055_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	77.6	4.6e-71
WP_044489031.1|1264379_1264574_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.2	2.8e-18
WP_032105113.1|1264524_1264803_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.2	7.1e-15
WP_048248649.1|1264799_1265342_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	1.4e-75
WP_001514184.1|1265344_1265620_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|1265616_1266018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080024771.1|1266574_1267384_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	98.5	1.9e-153
WP_080024772.1|1267496_1267859_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	84.9	1.1e-52
WP_080024773.1|1267855_1268146_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	3.1e-45
WP_080024774.1|1268138_1268309_-	NinE family protein	NA	G8C7V4	Escherichia_phage	85.5	1.0e-19
WP_080024775.1|1268301_1268751_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	8.5e-34
WP_045359144.1|1269743_1270085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080024776.1|1270087_1270612_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	47.0	2.3e-30
WP_017693170.1|1270608_1270905_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
WP_164908975.1|1271146_1271446_-	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	5.7e-18
WP_080024778.1|1271450_1272824_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.2	4.2e-164
WP_063927532.1|1272820_1273906_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.0e-84
WP_015571544.1|1273898_1274045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048248446.1|1274128_1274674_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	97.2	6.2e-95
WP_000102594.1|1274691_1274925_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_048248543.1|1274966_1275719_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.0	9.2e-73
WP_157846148.1|1276274_1276409_+	hypothetical protein	NA	Q716D9	Shigella_phage	65.1	1.2e-12
WP_032936032.1|1276703_1276967_+	hypothetical protein	NA	S4TNW9	Salmonella_phage	43.4	1.8e-07
WP_032105105.1|1277127_1277376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032105103.1|1277372_1277531_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	5.4e-20
WP_001752704.1|1277527_1277734_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_032105026.1|1277812_1278091_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	75.3	3.4e-33
WP_032105027.1|1278100_1279015_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	99.3	1.2e-170
WP_032105028.1|1279011_1279494_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	99.4	8.4e-80
WP_032105029.1|1279502_1279931_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.7	1.1e-70
WP_017383247.1|1279927_1280080_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	48.1	1.6e-05
WP_080024779.1|1280076_1280742_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	89.9	7.5e-111
WP_080024780.1|1280741_1280966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080024781.1|1280962_1281829_+	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	40.4	1.3e-57
WP_080024782.1|1281825_1282017_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	9.2e-14
WP_063162394.1|1282105_1282405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296399.1|1282407_1282626_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.3	5.4e-18
WP_053069215.1|1282625_1282823_+	hypothetical protein	NA	G8C7S5	Escherichia_phage	88.7	5.2e-28
WP_048248465.1|1282822_1283185_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	97.4	1.5e-60
WP_048248468.1|1283147_1283387_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	44.2	4.6e-10
WP_048248470.1|1283396_1283582_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.0	3.6e-07
WP_032104950.1|1283666_1283864_+	hypothetical protein	NA	S4TWN3	Salmonella_phage	50.0	1.1e-12
WP_032668696.1|1284024_1284225_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	98.5	7.1e-33
WP_071888795.1|1284233_1284569_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032668694.1|1284445_1285609_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	98.2	5.0e-227
1285623:1285669	attR	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	3179740	3228396	4825100	capsid,portal,tail,head,terminase,integrase,protease,transposase	uncultured_Caudovirales_phage(69.57%)	53	3191678:3191712	3231880:3231914
WP_032673059.1|3179740_3180898_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032104941.1|3180973_3182995_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_032104938.1|3183173_3184769_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_015571933.1|3184801_3185773_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_032655185.1|3185988_3187476_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	28.6	1.1e-08
WP_032103365.1|3187472_3188504_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_032103364.1|3188504_3189482_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_017382416.1|3189483_3190485_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_032103360.1|3190496_3191384_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_023295476.1|3191380_3191674_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
3191678:3191712	attL	CTTTGCCCGGTGGCGCTGCGCTTACCGGGCCTACA	NA	NA	NA	NA
WP_032103359.1|3191759_3192449_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_017692633.1|3192491_3193094_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017692634.1|3193128_3193845_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_017692635.1|3193837_3194359_-	fimbrial protein	NA	NA	NA	NA	NA
WP_015571924.1|3194368_3194914_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023295472.1|3194923_3195931_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023295471.1|3195931_3198556_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_023295470.1|3198616_3199327_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_017382406.1|3199373_3199907_-	fimbrial protein	NA	NA	NA	NA	NA
WP_017382405.1|3199978_3200521_-	fimbrial protein BcfA	NA	NA	NA	NA	NA
WP_017382404.1|3201122_3202529_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.8e-33
WP_023295469.1|3202924_3204445_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	36.7	3.2e-32
WP_023295468.1|3204684_3206244_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	1.6e-07
WP_017692641.1|3206240_3206735_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032103356.1|3206880_3207645_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_080024803.1|3207645_3208815_-	DNA repair protein	NA	NA	NA	NA	NA
WP_032673327.1|3209257_3210679_+|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	26.9	5.1e-08
WP_032673326.1|3211041_3211410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071993127.1|3211544_3211754_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032673057.1|3211762_3212533_+	ROK family transcriptional regulator	NA	G0ZND1	Cronobacter_phage	67.9	1.1e-44
WP_123906388.1|3212577_3212814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032629539.1|3212797_3212977_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	100.0	1.1e-24
WP_080024826.1|3213155_3213374_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	98.6	1.5e-36
WP_032673055.1|3213366_3213552_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	98.4	2.8e-23
WP_001547834.1|3213544_3213772_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	100.0	1.6e-33
WP_023332885.1|3213768_3214137_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	100.0	4.6e-62
WP_023304525.1|3214133_3215498_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	5.8e-259
WP_032673054.1|3215712_3215973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673052.1|3216005_3216512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032673050.1|3216797_3217964_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	7.5e-215
WP_032673049.1|3218015_3218576_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	99.5	5.9e-101
WP_032673048.1|3218577_3219813_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	98.3	6.0e-239
WP_032673047.1|3219809_3220148_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	98.2	2.4e-57
WP_032673046.1|3220144_3220438_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	86.6	9.1e-45
WP_032673045.1|3220437_3220881_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	95.9	2.9e-82
WP_162184623.1|3220873_3221026_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	92.0	1.3e-18
WP_032673043.1|3221154_3221511_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.9	1.8e-58
WP_032673040.1|3221494_3223156_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.1	0.0e+00
WP_023309411.1|3223167_3223782_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.8	6.2e-51
WP_032673037.1|3223790_3223979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673034.1|3224177_3225629_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_017384024.1|3225942_3226449_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015571912.1|3226551_3228396_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
3231880:3231914	attR	CTTTGCCCGGTGGCGCTGCGCTTACCGGGCCTACA	NA	NA	NA	NA
>prophage 4
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	3683817	3765010	4825100	capsid,integrase,tail,tRNA,head,portal,terminase,lysis,plate	Escherichia_phage(26.53%)	88	3707104:3707120	3738539:3738555
WP_157843884.1|3683817_3684729_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	93.4	8.9e-163
WP_080024809.1|3684709_3685075_+	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	66.1	4.5e-17
WP_023295273.1|3685150_3686623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023295272.1|3686623_3687538_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	1.6e-159
WP_023295271.1|3687534_3687897_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	70.0	3.4e-41
WP_023295270.1|3687960_3688200_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.4	2.2e-33
WP_003863115.1|3688923_3689406_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_023295269.1|3689523_3690000_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863119.1|3689989_3690277_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003863121.1|3690339_3690678_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_071524123.1|3690659_3690842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032104293.1|3690816_3692478_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_017383004.1|3692563_3693442_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003863126.1|3693564_3694158_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032104292.1|3694209_3695496_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_013098352.1|3695515_3696382_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_003863132.1|3696473_3697835_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863133.1|3697951_3698200_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_015571575.1|3698215_3698755_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_014832949.1|3698786_3699554_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|3699597_3699945_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017692856.1|3700077_3700482_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_023295267.1|3700520_3701891_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_017382956.1|3701893_3702379_-	OmpA family protein	NA	NA	NA	NA	NA
WP_017692859.1|3702391_3703612_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_015571570.1|3703604_3704141_-	YfiR family protein	NA	NA	NA	NA	NA
WP_017383979.1|3704294_3704669_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_006811632.1|3704881_3705952_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_023295266.1|3705962_3707084_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
3707104:3707120	attL	AAAGCCAGCAATGCTGG	NA	NA	NA	NA
WP_023323611.1|3707272_3708253_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.1	7.6e-152
WP_023323610.1|3708322_3708616_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	81.4	2.0e-39
WP_023295263.1|3708774_3709047_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032627926.1|3709049_3709229_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	66.7	6.2e-12
WP_023323608.1|3709219_3709720_+	hypothetical protein	NA	M1SV55	Escherichia_phage	89.2	8.5e-83
WP_023323607.1|3709784_3710000_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_023323606.1|3710016_3710292_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	59.3	2.2e-24
WP_047726085.1|3710281_3712567_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.8	0.0e+00
WP_032673302.1|3712628_3714101_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032618971.1|3714462_3715488_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	4.6e-168
WP_023323600.1|3715489_3717259_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.4	2.1e-301
WP_032673301.1|3717424_3718279_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	3.2e-114
WP_017382976.1|3718334_3719402_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_023323597.1|3719405_3720161_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.9	7.5e-75
WP_032609900.1|3720260_3720767_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_032673300.1|3720766_3720970_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	80.6	1.1e-25
WP_017382980.1|3720960_3721182_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_032673299.1|3721165_3721678_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.8	2.3e-83
WP_032673298.1|3721674_3722106_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	6.2e-58
WP_032673297.1|3722105_3722522_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.6	2.4e-43
WP_032673296.1|3722617_3723085_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
WP_032673294.1|3723077_3723530_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_032673293.1|3723580_3724150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032673292.1|3724956_3725532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032673290.1|3725711_3726347_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.3	1.8e-98
WP_032673289.1|3726343_3726694_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	1.4e-39
WP_032618987.1|3726699_3727608_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_026080583.1|3727600_3728131_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.1	2.8e-92
WP_032673288.1|3728142_3730491_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	47.1	1.0e-114
WP_032673287.1|3730492_3730924_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	4.1e-17
WP_032673286.1|3731298_3732492_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	1.4e-184
WP_032673285.1|3732504_3733023_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032673284.1|3733080_3733404_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	65.2	1.2e-24
WP_017382998.1|3733436_3733559_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032673282.1|3733548_3735999_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	75.4	2.0e-302
WP_032673281.1|3736009_3736474_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	3.6e-59
WP_032673280.1|3736470_3737640_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.5	2.6e-175
WP_023323577.1|3737716_3737938_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_032673345.1|3737983_3738397_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	45.0	1.2e-26
WP_017383978.1|3738575_3739448_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
3738539:3738555	attR	CCAGCATTGCTGGCTTT	NA	NA	NA	NA
WP_015571567.1|3739444_3740605_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100229775.1|3740712_3740760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003863162.1|3740864_3741206_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003863164.1|3741473_3742211_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017383977.1|3742342_3743323_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023295227.1|3743319_3744051_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017692862.1|3744180_3746754_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_017692863.1|3752411_3752864_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	1.3e-34
WP_017383558.1|3753015_3754323_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.5e-43
WP_015572130.1|3754319_3754643_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_026094276.1|3754688_3756044_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015572131.1|3756153_3758817_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_015572132.1|3758852_3759551_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_032104721.1|3759621_3760041_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.2	1.3e-12
WP_017383555.1|3760245_3761331_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_023295224.1|3761370_3762060_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|3762375_3762759_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_017383554.1|3762811_3764140_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_017383553.1|3764272_3765010_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	4244864	4254110	4825100		Enterobacteria_phage(25.0%)	9	NA	NA
WP_032103484.1|4244864_4245929_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_032103483.1|4245944_4246811_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.2e-110
WP_032103481.1|4246823_4247714_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	2.8e-28
WP_023295000.1|4247724_4248273_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_017693097.1|4248408_4249815_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.8e-37
WP_003859477.1|4250067_4251234_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_032103480.1|4251282_4252287_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	2.5e-33
WP_032103478.1|4252478_4253459_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032103476.1|4253498_4254110_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 6
NZ_CP020053	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 chromosome, complete genome	4825100	4393998	4497735	4825100	capsid,portal,holin,tail,tRNA,head,coat,integrase,terminase,protease	Enterobacteria_phage(23.73%)	108	4391314:4391330	4424106:4424122
4391314:4391330	attL	GCGCGGTGTGATTGTGC	NA	NA	NA	NA
WP_032103963.1|4393998_4394547_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032673252.1|4395300_4397685_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017384412.1|4397681_4398644_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_080024819.1|4398729_4400397_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.1	3.8e-10
WP_017384410.1|4400441_4402043_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_017384409.1|4402062_4402929_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_014884341.1|4402925_4403975_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_000763862.1|4403992_4404382_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_003859718.1|4404392_4405037_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017693236.1|4405187_4406336_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859723.1|4406328_4408407_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_017693237.1|4408406_4408799_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_032103965.1|4409059_4410643_+	MFS transporter	NA	NA	NA	NA	NA
WP_032103975.1|4410647_4411787_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_023294934.1|4411821_4413555_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.0e-86
WP_015570274.1|4413793_4414354_+	VOC family protein	NA	NA	NA	NA	NA
WP_032103968.1|4414432_4415176_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_032103969.1|4415437_4416409_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003859735.1|4416405_4417149_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_003859737.1|4417189_4417585_-	membrane protein	NA	NA	NA	NA	NA
WP_048248605.1|4417636_4418410_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
WP_023294931.1|4418388_4419702_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	86.2	4.9e-223
WP_023294930.1|4419757_4419994_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	85.9	4.8e-36
WP_108454207.1|4420001_4420148_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	8.0e-18
WP_023294928.1|4420369_4420783_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.2	6.2e-47
WP_162200892.1|4420779_4420905_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	80.0	2.1e-11
WP_032103972.1|4420972_4421227_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	85.7	9.7e-35
WP_032673344.1|4421219_4421588_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	86.7	3.7e-51
WP_016240231.1|4421568_4421772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384395.1|4422386_4422587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384394.1|4423001_4423709_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	73.4	2.6e-93
WP_032645228.1|4423823_4424042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019788.1|4424043_4424241_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
4424106:4424122	attR	GCGCGGTGTGATTGTGC	NA	NA	NA	NA
WP_000064516.1|4424237_4425170_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.0	2.9e-36
WP_032673249.1|4425277_4427149_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.6	4.1e-223
WP_032673248.1|4427152_4427935_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.1e-112
WP_015570940.1|4428229_4428715_+	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_015570939.1|4428899_4429325_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|4429321_4429477_+	DUF3927 family protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_017384387.1|4430205_4430595_+	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_017384386.1|4430584_4430863_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_032673247.1|4430862_4431492_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	3.9e-101
WP_017384384.1|4431499_4431775_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.3	8.3e-32
WP_032104386.1|4432801_4434259_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	2.7e-270
WP_071524150.1|4434427_4434691_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_032104415.1|4434854_4435445_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	80.1	2.5e-94
WP_032104388.1|4435757_4436108_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	2.3e-50
WP_032673246.1|4436265_4436739_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	6.6e-85
WP_016063095.1|4436738_4438475_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
WP_032673245.1|4438474_4439779_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.1	4.0e-233
WP_032104391.1|4439792_4440641_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	1.2e-137
WP_032104393.1|4440650_4441862_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	5.2e-195
WP_032104394.1|4441906_4442233_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	83.3	5.2e-49
WP_032104396.1|4442229_4442574_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	54.5	2.2e-26
WP_032104397.1|4442554_4442944_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	62.0	3.2e-45
WP_032104398.1|4442940_4443345_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	70.5	3.1e-43
WP_032104401.1|4443377_4443830_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
WP_032104403.1|4443893_4444256_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	53.4	9.0e-26
WP_071882647.1|4444276_4444495_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	66.7	1.5e-23
WP_032104404.1|4444494_4447821_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	69.1	0.0e+00
WP_032104406.1|4447820_4448159_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	73.2	1.9e-46
WP_032104408.1|4448155_4448914_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	94.0	7.9e-141
WP_032104409.1|4448915_4449626_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.5	8.5e-145
WP_032104410.1|4449654_4450002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032104411.1|4450024_4450618_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	80.7	1.2e-83
WP_032104412.1|4450671_4454253_+|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	91.2	0.0e+00
WP_032104413.1|4454254_4455220_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	7.4e-59
WP_048248600.1|4455279_4456548_+	hypothetical protein	NA	G8C7K5	Escherichia_phage	65.2	4.1e-150
WP_026080690.1|4457432_4458008_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.3	5.5e-78
WP_123906383.1|4458338_4458764_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_017384354.1|4458850_4459090_-	DinI family protein	NA	K7P797	Enterobacteria_phage	88.6	8.5e-33
WP_015570278.1|4459454_4460021_-	hydrolase	NA	NA	NA	NA	NA
WP_017384352.1|4460283_4462056_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023296808.1|4462057_4462501_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003859747.1|4462528_4463269_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859749.1|4463303_4463825_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859751.1|4463905_4464520_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859753.1|4464528_4465539_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_006811034.1|4465598_4466384_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_017384350.1|4466380_4467136_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.0e-15
WP_032103662.1|4467213_4468158_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003859762.1|4468173_4469493_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_015570283.1|4469610_4470582_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003859767.1|4470625_4472068_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003859769.1|4472182_4473052_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859771.1|4473408_4474884_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_032103659.1|4475117_4476929_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003859774.1|4476968_4477610_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_015570285.1|4477684_4478863_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_015570286.1|4479034_4479685_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023296804.1|4479760_4481836_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_015570288.1|4481817_4482480_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_003859783.1|4482503_4483154_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003859784.1|4483265_4483496_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_023296802.1|4483633_4484005_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_017693249.1|4484006_4484876_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003859787.1|4484892_4485231_+	YebY family protein	NA	NA	NA	NA	NA
WP_017693250.1|4485357_4485555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296801.1|4485600_4486581_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_015570293.1|4486748_4487393_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.9e-55
WP_003859885.1|4487427_4487667_-	YebV family protein	NA	NA	NA	NA	NA
WP_023296800.1|4487773_4489237_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_017693254.1|4489293_4491927_-	PqiB family protein	NA	NA	NA	NA	NA
WP_020480541.1|4491895_4493179_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_006811006.1|4493311_4493809_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003859895.1|4493905_4494592_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_015570296.1|4494611_4496660_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859899.1|4496853_4497735_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 1
NZ_CP020054	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 plasmid unitig_1, complete sequence	69729	0	46495	69729	transposase,integrase	Escherichia_phage(21.43%)	49	5657:5672	42208:42223
WP_003100853.1|334_706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|702_1203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|1199_1526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|1780_2137_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|2126_2528_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|2524_2815_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032673378.1|2970_5937_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.7	0.0e+00
5657:5672	attL	GCCTGGGTGAAATCCG	NA	NA	NA	NA
WP_000427623.1|6015_7020_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000509966.1|7498_8104_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|8198_11096_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_032656053.1|11377_12148_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_032656049.1|13004_13499_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.8	1.9e-18
WP_032656046.1|13558_13918_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	83.1	1.8e-50
WP_029403837.1|13923_14226_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.9	1.7e-17
WP_032656042.1|14832_15084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155404430.1|15885_16059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045325874.1|16607_17498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032656029.1|17651_19655_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032656026.1|19665_20151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032656023.1|21526_21712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032656019.1|21761_23036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032673389.1|23315_23816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673387.1|23828_24608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673386.1|24815_26408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673385.1|26441_27569_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_032673383.1|27565_27856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020219159.1|27845_28049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663671.1|28663_28966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673381.1|29018_29327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032663674.1|29354_29684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162197109.1|29731_30130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032663677.1|30234_31017_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	6.0e-51
WP_080024830.1|31964_33146_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_088581786.1|33248_34395_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_032663680.1|34686_35313_+	ParA family protein	NA	A0A219YAQ5	Aeromonas_phage	35.9	1.3e-24
WP_032663682.1|35357_35585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029403849.1|36452_37175_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	3.7e-23
WP_032663684.1|37665_38937_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.1e-154
WP_032663686.1|38936_39368_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
WP_080472841.1|39599_40571_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	8.2e-74
WP_032663689.1|40573_41236_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_032663691.1|41239_41503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032663693.1|41531_41735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032663749.1|42107_42575_+	hypothetical protein	NA	NA	NA	NA	NA
42208:42223	attR	GCCTGGGTGAAATCCG	NA	NA	NA	NA
WP_032663695.1|43111_43804_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.5	1.7e-28
WP_013087144.1|43800_44022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032663699.1|44077_44500_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_032663701.1|44702_45338_-	peptidase	NA	NA	NA	NA	NA
WP_032663702.1|45523_46495_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020054	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0065 plasmid unitig_1, complete sequence	69729	62592	66629	69729		uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_008460270.1|62592_63972_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_004196322.1|64002_64692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|64705_65443_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_009651956.1|65486_65852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196370.1|66102_66342_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_000323025.1|66341_66629_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
