The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	19592	68817	5018461	terminase,lysis,protease,tail,integrase	Enterobacteria_phage(37.04%)	57	36723:36737	51645:51659
WP_001260855.1|19592_20414_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|20513_20597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|20689_21025_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|21421_22675_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|22781_23675_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225275.1|23809_25030_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|25154_25850_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|25802_27095_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|27254_27869_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|27911_28766_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|28767_29385_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|29395_31819_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_077627936.1|31879_32989_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.9	1.1e-85
WP_001249849.1|33214_34570_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000113586.1|35092_35461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020819.1|35857_36949_+	hypothetical protein	NA	NA	NA	NA	NA
36723:36737	attL	ACGAAGAATACTTCG	NA	NA	NA	NA
WP_000095383.1|37276_37786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039025924.1|37872_38862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041533.1|39326_40805_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	5.2e-120
WP_001295396.1|41003_41309_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|41416_42127_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|42129_42690_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|42724_43066_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|43200_43527_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|43732_44947_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|44958_45978_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|46035_46146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876993.1|46165_47446_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|47480_47717_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048320.1|47804_50276_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|50369_50561_-	YebW family protein	NA	NA	NA	NA	NA
WP_000854559.1|50557_50746_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|51145_51310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171933.1|51313_51532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|51691_51847_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
51645:51659	attR	CGAAGTATTCTTCGT	NA	NA	NA	NA
WP_000448563.1|52013_52421_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|52504_52735_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|52718_53240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|53220_54186_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001151251.1|54226_54649_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000566848.1|54901_55801_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|56115_56769_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|56781_57477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967407.1|58162_58375_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	4.0e-26
WP_000980987.1|58591_58843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|58909_59188_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265276.1|59189_60239_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_001204811.1|60256_60634_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	4.5e-52
WP_000780579.1|60790_61315_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.8	1.7e-46
WP_000592549.1|61507_62467_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839586.1|63398_63614_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
WP_001348167.1|63613_64111_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|64327_64510_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|64600_64894_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_000421825.1|65574_66114_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_100069996.1|66122_67433_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	1.0e-252
WP_000885571.1|68235_68817_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
>prophage 2
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	256123	263819	5018461	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_000837924.1|256123_257257_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|257397_257832_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|258608_258722_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|258790_259024_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|259340_259931_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_080028384.1|260028_260604_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	2.0e-104
WP_080028385.1|260603_262670_-	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	57.0	5.1e-198
WP_087758690.1|262698_263819_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 3
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	270530	288829	5018461	integrase,tRNA	Escherichia_phage(66.67%)	22	271867:271880	286252:286265
WP_155119857.1|270530_272528_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
271867:271880	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|272868_273291_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_080028387.1|273331_274402_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000693853.1|274473_274899_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|274895_275150_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|275229_275649_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233809.1|275935_276070_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|276080_276236_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|276232_276721_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|277162_277384_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|277383_277554_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|277628_277904_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105127.1|278005_280606_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_060615110.1|280598_281381_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	73.0	5.5e-105
WP_001317028.1|281464_281659_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|281651_281861_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|281939_282155_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|282156_283392_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|283443_284379_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|284507_285881_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|286358_287342_-	zinc transporter ZntB	NA	NA	NA	NA	NA
286252:286265	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_069067245.1|287596_288829_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 4
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	365354	423837	5018461	protease,plate,head,tail,integrase	Salmonella_phage(39.29%)	78	383113:383129	424024:424040
WP_000422045.1|365354_366404_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|366623_367382_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|367378_367969_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|368008_368881_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|368981_369602_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|369598_370480_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|370617_370662_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194591.1|370753_372316_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|372315_373911_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|373914_375273_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|375284_376478_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|376477_377284_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|377664_377844_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|377929_378430_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079504.1|378475_378982_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|379041_379680_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|380036_380780_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|380809_381349_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|381453_381852_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|381891_382611_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|382834_383131_+	YciI family protein	NA	NA	NA	NA	NA
383113:383129	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
WP_000639140.1|383249_383798_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
WP_080028388.1|384341_384752_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.5	1.9e-19
WP_001340317.1|384732_384966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080028390.1|385741_386422_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	2.2e-102
WP_080028391.1|386418_387618_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.5	1.6e-180
WP_001270645.1|387618_387972_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.4e-44
WP_080028392.1|387971_388712_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.8	9.0e-73
WP_080028393.1|388776_389892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080028394.1|389897_390959_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.2	9.4e-140
WP_032177179.1|390961_391267_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.6	4.3e-21
WP_080028395.1|391263_391890_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	65.8	2.5e-63
WP_080028396.1|391889_393905_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	73.1	2.7e-281
WP_000393957.1|394082_394508_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_000257257.1|394511_394952_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_080028397.1|394962_396123_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.6	5.4e-157
WP_078207151.1|396126_396690_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_080028398.1|396664_397054_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.1	1.5e-66
WP_032177174.1|397040_397628_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	75.9	2.9e-74
WP_001125674.1|397624_398032_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	5.1e-70
WP_001040703.1|397997_398387_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_000627486.1|398428_399370_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.8	6.1e-175
WP_000128056.1|399381_399885_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	7.2e-74
WP_080028399.1|399889_401122_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	95.4	2.0e-218
WP_113772720.1|401136_401874_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.5	2.3e-108
WP_080028400.1|401758_403228_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.3	3.3e-268
WP_080028401.1|403227_404850_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	3.6e-311
WP_136769304.1|404873_405134_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001619346.1|405159_405633_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.1	1.1e-50
WP_080028402.1|405663_406284_-	hypothetical protein	NA	I6S676	Salmonella_phage	73.2	5.8e-89
WP_032177168.1|406340_406526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139815330.1|406644_406902_-	peptidase	NA	Q8SBD8	Shigella_phage	78.0	4.4e-27
WP_115223376.1|406786_407179_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	62.3	1.0e-35
WP_080028404.1|407178_407700_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.3	1.3e-49
WP_080028405.1|407699_408005_-	hypothetical protein	NA	O64361	Escherichia_phage	82.2	3.2e-40
WP_088545702.1|408236_408926_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	8.7e-62
WP_080028406.1|408922_409285_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	91.7	1.2e-57
WP_080028407.1|409281_409572_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	2.8e-46
WP_053271632.1|409574_409781_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	63.2	6.4e-21
WP_080028408.1|409780_410380_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	94.5	4.7e-104
WP_001568777.1|410414_410663_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_000861984.1|410780_411014_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	100.0	2.3e-38
WP_001299077.1|411787_411988_-	hypothetical protein	NA	K7PHG5	Enterobacteria_phage	93.3	6.7e-07
WP_053275096.1|411989_412679_-	phage replication protein	NA	K7P7B6	Enterobacteria_phage	99.6	4.4e-130
WP_000072105.1|412675_413584_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	99.7	4.5e-159
WP_001472167.1|413668_414226_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
WP_001568772.1|414237_414456_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_016239508.1|414528_414942_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.8	5.1e-49
WP_016239507.1|414961_415354_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	96.9	5.6e-66
WP_024191667.1|415399_415498_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016063366.1|415658_415913_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	100.0	7.4e-43
WP_016063365.1|415905_416364_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	100.0	1.7e-82
WP_016063364.1|416363_416789_+	hypothetical protein	NA	A4KWV6	Enterobacteria_phage	100.0	2.4e-78
WP_001567552.1|417254_417461_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	97.1	7.3e-33
WP_016245899.1|417772_421003_+	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	70.7	0.0e+00
WP_000432226.1|421014_422127_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_001237029.1|422165_422408_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000627155.1|422643_423837_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
424024:424040	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 5
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	1407412	1468990	5018461	holin,tail,integrase	Shigella_phage(44.44%)	52	1436292:1436307	1467037:1467052
WP_000131044.1|1407412_1409446_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|1409574_1410162_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|1410175_1411648_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1411661_1413332_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|1414406_1414970_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|1415299_1416094_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|1416247_1417009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|1418154_1419348_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|1419531_1420197_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|1420442_1421138_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|1421130_1422558_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|1422568_1423288_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|1423817_1424672_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046304.1|1424897_1426223_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474074.1|1426331_1426568_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1426579_1427173_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_024198277.1|1427332_1428202_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_000092619.1|1429428_1433682_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|1434776_1434878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|1435240_1435504_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1435503_1435644_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1435678_1435906_-	hypothetical protein	NA	NA	NA	NA	NA
1436292:1436307	attL	TCCCTTACCCTTAAAA	NA	NA	NA	NA
WP_001296902.1|1436728_1437271_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1437345_1437933_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1437990_1438659_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|1438684_1441210_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|1441199_1442843_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|1442811_1443522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|1443834_1444164_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1444411_1445026_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|1445443_1446133_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000667026.1|1447114_1449313_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|1449322_1450279_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1450257_1450668_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_042058399.1|1451289_1452222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614957.1|1453782_1454766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048228913.1|1455421_1456096_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.3	1.0e-78
WP_023568709.1|1456198_1456501_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_023568708.1|1456506_1457127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023568707.1|1457561_1458113_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.9e-86
WP_071549914.1|1458184_1458532_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.2	4.6e-11
WP_000090998.1|1458716_1459073_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_069067270.1|1459072_1460212_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	75.3	1.3e-190
WP_000497751.1|1460195_1460366_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001191674.1|1461959_1462220_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|1462317_1463010_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000206732.1|1463406_1463712_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077769569.1|1463627_1464062_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000051887.1|1463938_1465102_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_058685605.1|1465274_1466498_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060614976.1|1466528_1466807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614977.1|1467145_1468990_-	cell envelope integrity protein TolA	NA	A0A1Q1N989	Escherichia_phage	32.4	1.5e-63
1467037:1467052	attR	TTTTAAGGGTAAGGGA	NA	NA	NA	NA
>prophage 6
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	1863648	1879891	5018461	integrase,transposase	Salmonella_phage(28.57%)	17	1861110:1861169	1884643:1885410
1861110:1861169	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_032426534.1|1863648_1864653_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|1864731_1867698_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|1867700_1868261_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|1868386_1868737_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|1868939_1869953_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_045899678.1|1870642_1871116_+	trimethoprim-resistant dihydrofolate reductase Dfr7	NA	A0A1B2IBQ4	Erwinia_phage	35.4	9.0e-18
WP_045899677.1|1871262_1871694_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001007673.1|1871775_1872603_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|1872738_1873086_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1873079_1873919_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1874046_1874547_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|1874529_1874670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|1875053_1875818_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000480968.1|1876019_1876856_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1876855_1877659_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|1877765_1878895_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_085947932.1|1879131_1879891_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
1884643:1885410	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 7
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	2386394	2437374	5018461	holin,capsid,protease,plate,portal,transposase,head,tail,integrase	Salmonella_phage(79.49%)	63	2419877:2419893	2445575:2445591
WP_000208242.1|2386394_2386925_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|2386934_2388266_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2388332_2389259_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2389351_2389837_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2389921_2390167_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2390591_2391437_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2391459_2392968_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2393103_2394114_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|2394210_2394957_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2394961_2395390_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2395416_2395716_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155272.1|2395927_2396368_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|2396468_2397068_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2397175_2397943_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2397997_2398753_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|2398859_2399849_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2400168_2401131_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2401311_2402214_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_021567699.1|2402467_2402851_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	98.4	2.7e-65
WP_001251454.1|2402940_2403183_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_021567698.1|2403231_2404350_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.5	1.9e-191
WP_000224787.1|2404507_2405701_+|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	1.0e-214
WP_001207578.1|2405713_2406229_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_080028419.1|2406243_2406579_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	98.2	5.2e-52
WP_000763324.1|2406587_2406704_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_080028420.1|2406704_2409632_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	91.5	0.0e+00
WP_000979934.1|2409641_2410091_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.7	3.9e-79
WP_021567694.1|2410197_2410779_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	79.5	9.2e-81
WP_073511640.1|2410952_2411186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246760.1|2412434_2413049_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	98.4	5.9e-110
WP_080028422.1|2413041_2413953_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.0	1.8e-160
WP_000108899.1|2413949_2414312_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_045355545.1|2414308_2414938_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.2	1.3e-109
WP_016246757.1|2415095_2415740_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.2	5.7e-116
WP_000917105.1|2415700_2416195_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_016246755.1|2416194_2416725_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	65.3	5.3e-43
WP_016246754.1|2416826_2417306_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	70.1	4.6e-62
WP_021567690.1|2417370_2417700_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	97.2	2.3e-52
WP_001102549.1|2417710_2417911_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|2417910_2418399_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_023276968.1|2418501_2419350_-	hypothetical protein	NA	A0A0M4R523	Salmonella_phage	97.2	2.8e-134
WP_001246220.1|2419392_2420439_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	99.7	3.7e-197
2419877:2419893	attL	ACGGTGATATCTTTCAT	NA	NA	NA	NA
WP_016246750.1|2420479_2421325_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.9	1.6e-153
WP_016246749.1|2421478_2423191_+	hypothetical protein	NA	A0A0M4S6K7	Salmonella_phage	98.1	0.0e+00
WP_000014576.1|2423191_2424241_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_045355548.1|2424724_2425837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028423.1|2425887_2428257_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.6	0.0e+00
WP_021567686.1|2428253_2428433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057063179.1|2428432_2429404_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	1.1e-137
WP_021567684.1|2429405_2429618_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	94.3	4.1e-31
WP_080028424.1|2429660_2429843_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000482341.1|2429842_2430277_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_021567682.1|2430370_2430601_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	74.7	2.1e-28
WP_000290619.1|2430590_2430797_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_021567681.1|2430807_2431011_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	94.0	1.4e-28
WP_000130011.1|2431021_2431303_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	98.9	5.3e-50
WP_000343126.1|2431393_2431633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021567679.1|2431869_2432163_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	72.2	7.2e-34
WP_057502207.1|2432232_2433213_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.2	3.0e-185
WP_001223800.1|2433390_2433891_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|2434040_2434739_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2434735_2436109_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_000399648.1|2436393_2437374_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2445575:2445591	attR	ATGAAAGATATCACCGT	NA	NA	NA	NA
>prophage 8
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	3724325	3731465	5018461		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3724325_3724964_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3724960_3726223_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3726219_3727128_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3727323_3728091_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|3728141_3728798_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|3728903_3731465_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 9
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	4091634	4134494	5018461	holin,terminase,lysis,coat,portal,transposase,tail,integrase	Enterobacteria_phage(54.39%)	65	4084324:4084338	4119444:4119458
4084324:4084338	attL	CGATGAAAACGGTGA	NA	NA	NA	NA
WP_087758690.1|4091634_4092754_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_124038685.1|4092976_4093156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595306.1|4093279_4093645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218588.1|4093714_4094338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929405.1|4094441_4094774_-	YegP family protein	NA	NA	NA	NA	NA
WP_000908413.1|4095552_4096911_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001136879.1|4096913_4097570_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_001229151.1|4097984_4099247_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.3	4.0e-81
WP_001163428.1|4099511_4099712_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545733.1|4099769_4099937_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_025866366.1|4100025_4100307_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	1.8e-50
WP_080028434.1|4100509_4101133_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	63.2	3.1e-74
WP_080028435.1|4101129_4101561_-	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	80.0	4.9e-63
WP_001214446.1|4101557_4101722_-	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
WP_080028436.1|4101718_4102000_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	97.8	7.4e-44
WP_000753561.1|4102016_4102331_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	98.1	1.3e-49
WP_000041326.1|4102342_4102825_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_080028437.1|4102808_4103711_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.1	6.3e-145
WP_000604105.1|4103707_4104016_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	2.5e-53
WP_076838581.1|4104100_4104376_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_001278766.1|4104571_4105066_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_080028438.1|4105058_4105382_-	antitermination protein	NA	K7P718	Enterobacteria_phage	99.1	5.0e-52
WP_080028439.1|4105686_4106091_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	3.3e-69
WP_000028392.1|4106087_4106720_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|4106823_4107039_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000536663.1|4107155_4107437_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
WP_000166207.1|4107471_4107618_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065668.1|4107610_4108510_+	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_015980126.1|4108499_4109936_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	100.0	6.1e-275
WP_023241432.1|4110024_4110252_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	55.7	2.1e-12
WP_039022135.1|4110244_4110667_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	80.7	4.8e-63
WP_080028440.1|4110663_4111191_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	1.0e-99
WP_001254251.1|4111187_4111370_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000566863.1|4111366_4111537_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	5.5e-26
WP_001286917.1|4111529_4111742_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002243.1|4111734_4112025_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|4112021_4112384_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|4112380_4112569_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_080028441.1|4112565_4113084_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	7.7e-95
WP_000783734.1|4113545_4113869_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229399.1|4113852_4114329_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_080028442.1|4114325_4114763_+|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	98.6	1.4e-70
WP_000877024.1|4114966_4115497_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_080028443.1|4115684_4116065_+	hypothetical protein	NA	Q716B1	Shigella_phage	96.8	7.9e-65
WP_000807788.1|4116168_4116411_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_080028444.1|4116413_4116851_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	94.5	2.0e-64
WP_001543879.1|4116850_4118311_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.2	8.2e-219
WP_080028445.1|4118310_4120479_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.5	0.0e+00
4119444:4119458	attR	CGATGAAAACGGTGA	NA	NA	NA	NA
WP_080028446.1|4120492_4121404_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	8.3e-161
WP_029403254.1|4121404_4121920_-	HNH endonuclease	NA	A0A291AXK2	Shigella_phage	39.5	4.1e-24
WP_080028447.1|4121993_4123289_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	6.8e-241
WP_155119859.1|4123341_4123932_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.8	2.9e-58
WP_001054834.1|4123909_4124410_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_080028449.1|4124409_4125828_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	91.7	1.1e-255
WP_000947776.1|4125849_4126383_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	48.3	1.1e-35
WP_080028450.1|4126375_4127077_+|tail	phage tail protein	tail	A0A2H4FWI9	Salmonella_phage	97.0	2.3e-78
WP_000627630.1|4127076_4127532_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	5.2e-87
WP_000964864.1|4127534_4128227_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	100.0	3.0e-118
WP_063122161.1|4128237_4129602_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	98.2	7.4e-238
WP_080028451.1|4129601_4131467_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	0.0e+00
WP_080028452.1|4131829_4132816_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	2.7e-72
WP_042100707.1|4132831_4133083_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	7.6e-08
WP_047668238.1|4133197_4133350_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_047668240.1|4133346_4133529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080028453.1|4133591_4134494_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	99.3	6.1e-172
>prophage 10
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	4379744	4389186	5018461		Enterobacteria_phage(85.71%)	10	NA	NA
WP_080028461.1|4379744_4380671_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.1e-22
WP_000783120.1|4380675_4381407_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4381387_4381495_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4381554_4382286_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4382507_4384193_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4384189_4384909_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4384955_4385426_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4385466_4385928_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|4386052_4388053_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|4388049_4389186_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 11
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	4619105	4652467	5018461	holin,tail,terminase,integrase	Escherichia_phage(30.77%)	38	4607625:4607639	4629007:4629021
4607625:4607639	attL	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_001593427.1|4619105_4620368_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.5	7.4e-75
WP_001302302.1|4620705_4621503_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021546102.1|4621738_4622764_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|4622763_4622967_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069067231.1|4623025_4625467_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	7.8e-113
WP_021579309.1|4625560_4625752_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|4625748_4625937_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4626336_4626501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4626504_4626723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4626882_4627038_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_069067232.1|4627310_4628027_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	1.7e-52
WP_060615121.1|4628076_4628292_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693850.1|4628288_4628714_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475341.1|4628785_4629856_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
4629007:4629021	attR	GCAGACGATGCAGGG	NA	NA	NA	NA
WP_021546098.1|4629896_4630322_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|4630496_4631162_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_029488705.1|4631342_4631555_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_000737636.1|4631698_4632091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|4632387_4632666_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|4632667_4633717_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001217424.1|4633729_4634089_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_080028474.1|4634085_4634775_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	2.0e-58
WP_000839572.1|4635571_4635787_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|4635791_4636106_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|4636161_4636695_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|4636911_4637097_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|4637337_4637823_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016240599.1|4638067_4638268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|4638275_4638626_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001333563.1|4638773_4639256_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|4639255_4641013_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_087758697.1|4641030_4641633_+	C40 family peptidase	NA	C6ZCZ3	Enterobacteria_phage	92.1	4.1e-92
WP_012311734.1|4641530_4642178_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_071549948.1|4642238_4645718_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_041498143.1|4645787_4646387_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.2e-105
WP_072042815.1|4646451_4649865_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
WP_041498150.1|4649864_4650446_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.7e-101
WP_001079062.1|4651936_4652467_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 12
NZ_CP020048	Escherichia coli strain AR_0118, complete genome	5018461	4883760	4902570	5018461	tail,tRNA	Enterobacteria_phage(69.23%)	20	NA	NA
WP_001144192.1|4883760_4885689_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|4885692_4886235_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|4886331_4886529_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4886581_4886938_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4887060_4887105_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018596.1|4887388_4888372_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|4888386_4890774_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4890778_4891078_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|4891381_4891522_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|4891712_4891973_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024188892.1|4892122_4892626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132830.1|4893758_4894868_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|4895025_4896210_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|4896209_4896722_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|4896776_4897142_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|4897177_4897306_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_033544764.1|4897292_4900100_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000979945.1|4900112_4900601_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001100987.1|4900697_4901876_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_060615039.1|4901970_4902570_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
>prophage 1
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	0	2553	141885		Pseudomonas_phage(100.0%)	3	NA	NA
WP_000434070.1|97_1030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062185.1|1591_2089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|2091_2553_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
>prophage 2
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	6183	12805	141885		Sodalis_phage(25.0%)	10	NA	NA
WP_001043046.1|6183_6456_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.6e-19
WP_004201083.1|6513_7041_-	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	32.4	2.0e-05
WP_001270409.1|7043_7235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167036.1|7260_8118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972665.1|8104_8335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210757.1|8334_8853_-	nitrite reductase	NA	NA	NA	NA	NA
WP_000919343.1|8849_9296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422769.1|9295_9655_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000591076.1|9712_10141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348528.1|11827_12805_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	30.5	1.6e-16
>prophage 3
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	16445	17561	141885		unidentified_phage(100.0%)	1	NA	NA
WP_000946104.1|16445_17561_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	8.3e-46
>prophage 4
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	21464	25211	141885		Bacillus_phage(50.0%)	7	NA	NA
WP_000077457.1|21464_22448_+	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000919078.1|22464_22758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|22759_23179_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001020646.1|23238_23790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891157.1|23786_24395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790610.1|24405_24939_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000356489.1|24938_25211_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 5
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	32539	85431	141885	integrase,transposase	Bacillus_phage(21.43%)	44	25781:25801	89627:89647
25781:25801	attL	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
WP_000811656.1|32539_34051_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_000101568.1|34337_35378_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001097010.1|35530_36406_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_021740570.1|37051_40069_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004201172.1|41526_41817_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|42010_42340_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|42344_43376_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|43386_44025_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|44029_44395_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|44398_45211_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_021740570.1|45639_48657_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004201184.1|49040_49910_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|49914_50925_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|50927_51464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|51762_52083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|52313_52916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|52931_53384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|53554_53995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069067410.1|53966_58220_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_000988731.1|58352_59078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326390.1|59191_59593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|60208_61213_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|61291_61726_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|63191_63896_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072199448.1|64386_64806_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000080860.1|66891_68028_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|68078_68324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|68329_68521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855769.1|69161_70007_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_004201046.1|70104_70758_-	endonuclease III	NA	NA	NA	NA	NA
WP_001183923.1|72268_72568_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|72651_72894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|73020_73860_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|73853_74201_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_015058213.1|74369_74948_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000845048.1|75154_76168_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|76473_77031_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|77033_80006_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427620.1|80084_81089_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000714163.1|81270_81492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268337.1|81564_81843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|81829_83557_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077336.1|83734_84121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|84579_85431_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
89627:89647	attR	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
>prophage 6
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	94913	97601	141885		Mycobacterium_phage(33.33%)	3	NA	NA
WP_000706865.1|94913_95924_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001282585.1|95986_96976_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|97070_97601_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
>prophage 7
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	107197	110556	141885	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_001221666.1|107197_107731_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_015058212.1|107824_108970_-	class C beta-lactamase CMY-6	NA	NA	NA	NA	NA
WP_000608644.1|109293_110556_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 8
NZ_CP020049	Escherichia coli strain AR_0118 plasmid unitig_1, complete sequence	141885	117653	135985	141885	transposase	Escherichia_phage(20.0%)	26	NA	NA
WP_000366823.1|117653_119846_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_155119860.1|119860_120037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531258.1|120082_120865_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|120861_121884_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001326171.1|122400_122700_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|122911_123529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|123584_124241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|124240_125668_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|125671_126172_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000348669.1|126180_126513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|126497_126929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|126996_127671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044823.1|127645_127927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|127919_128297_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|128623_128767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|128858_129494_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|129546_129819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|129867_131049_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151305.1|131052_131838_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-10
WP_000380893.1|132011_132323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053910.1|132304_132754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348523.1|132767_134015_-	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.2e-05
WP_001258026.1|134004_134367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096360.1|134369_134612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532167.1|134849_135047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268394.1|135046_135985_-	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.2e-69
>prophage 1
NZ_CP020050	Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence	113431	14143	71035	113431	transposase	Stx2-converting_phage(30.0%)	48	NA	NA
WP_015632445.1|14143_14551_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_032495749.1|14547_14886_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.8	7.6e-27
WP_015632444.1|14926_16516_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_015632443.1|16538_16844_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	35.4	4.3e-05
WP_015632442.1|16889_19082_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_015632441.1|19083_20238_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_015632439.1|21705_22329_-	plasmid IncI1-type surface exclusion protein ExcA	NA	NA	NA	NA	NA
WP_015632438.1|22394_24539_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_015632437.1|24580_25162_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_015632436.1|25158_26355_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_015632435.1|26365_29413_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_032495746.1|29422_29986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632433.1|30029_30431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632432.1|30484_31018_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
WP_015632431.1|31027_31747_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_015632430.1|31752_33093_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_015632429.1|33096_34200_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_015632428.1|34210_34915_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_015632427.1|34950_35304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495745.1|35337_38661_-	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	29.5	5.0e-14
WP_032441926.1|38678_38945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495744.1|38941_40129_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_015632425.1|40106_40925_-	type IV secretion system DotC family protein	NA	NA	NA	NA	NA
WP_086581447.1|40921_41350_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_015632423.1|41411_41891_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_015632422.1|41903_42509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632421.1|42588_42900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495743.1|42933_43137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632420.1|43154_43688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632419.1|43955_44534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441927.1|44515_44986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632417.1|44985_45372_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_032441928.1|45989_46457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632416.1|48043_48952_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_015632415.1|48966_50697_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021740570.1|53006_56024_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_000677445.1|56181_56817_+	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_025714822.1|56851_57568_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|58686_59010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023307208.1|59442_62340_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|62434_63040_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|63699_64881_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|65307_65622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|65876_66233_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|66222_66624_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|66620_66911_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015065644.1|66985_69952_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|70030_71035_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP020051	Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence	91291	0	91267	91291	transposase,tail,plate,tRNA,lysis,head,holin,integrase,protease,capsid	Escherichia_phage(90.43%)	98	55611:55629	81596:81614
WP_000245715.1|682_907_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_080028492.1|1320_2283_-	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.4	8.2e-175
WP_080028493.1|2483_3482_-|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.8	7.9e-181
WP_052154682.1|3495_4728_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	99.8	2.8e-236
WP_080028494.1|5242_6628_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	9.1e-236
WP_080028495.1|6734_7943_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
WP_060877123.1|8059_8434_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
WP_080028496.1|8433_10371_-|head	head protein	head	A0A222YWA3	Escherichia_phage	97.7	0.0e+00
WP_080028497.1|10363_10984_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	96.1	1.6e-75
WP_080028498.1|10973_11420_-|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	99.3	2.7e-80
WP_000457140.1|11419_11746_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_001340317.1|12611_12845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001436272.1|15834_15984_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	95.9	5.1e-20
WP_080028500.1|16372_17218_-|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	95.0	5.3e-154
WP_080028501.1|17228_18659_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	93.1	1.2e-254
WP_032220997.1|18655_19030_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	96.8	2.5e-63
WP_047647212.1|23295_24117_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	2.9e-157
WP_001077897.1|24505_25261_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|25642_26350_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187854.1|26365_26917_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
WP_080028502.1|26971_27463_-|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	98.8	3.0e-88
WP_080028503.1|27471_27990_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	77.3	3.8e-70
WP_080028504.1|28116_28851_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.6	1.7e-124
WP_080028505.1|28894_30553_-|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	97.1	8.8e-302
WP_047647205.1|30620_30899_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	95.7	1.1e-39
WP_080028506.1|31046_32744_-|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	99.1	0.0e+00
WP_080028507.1|32902_33307_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	98.5	2.6e-66
WP_080028508.1|33342_34341_-	ORF6N domain-containing protein	NA	A0A222YWG0	Escherichia_phage	91.9	1.4e-116
WP_023908691.1|34340_34556_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	78.3	3.2e-23
WP_080028509.1|35083_35542_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.7	2.7e-67
WP_080028510.1|35612_36419_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	99.3	8.5e-117
WP_001272821.1|36418_36703_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_080028511.1|36969_37926_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.2e-180
WP_000076909.1|37938_38277_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_000585022.1|38564_39206_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
WP_000595051.1|39198_39486_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_001287146.1|39754_41416_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.6	0.0e+00
WP_080028512.1|41464_42370_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	99.7	2.2e-174
WP_000812238.1|42362_43043_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_080028513.1|43026_43932_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	2.3e-163
WP_000828872.1|43991_44645_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	98.2	1.1e-101
WP_000046500.1|44641_45622_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000203293.1|45625_46393_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000532307.1|46389_47181_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	98.9	7.5e-150
WP_000162415.1|47343_47646_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|47716_48055_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_080028514.1|48111_48312_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	6.2e-29
WP_080028515.1|48333_49062_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	57.1	3.7e-71
WP_001112629.1|49095_50289_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	99.5	5.7e-202
WP_000542383.1|50281_50611_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_023908597.1|50939_51593_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	98.6	1.9e-114
WP_080028516.1|51861_52773_+	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	96.6	1.6e-164
WP_000201621.1|52812_53163_-	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_022630902.1|53309_53594_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	100.0	1.4e-45
WP_080028517.1|53653_54595_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	89.8	1.2e-157
55611:55629	attL	ATGTTAGAAAACTAATTTA	NA	NA	NA	NA
WP_052936000.1|55621_56200_-	recombinase	NA	A0A222YXV2	Escherichia_phage	97.9	4.4e-75
WP_080028526.1|56487_57084_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	97.0	5.5e-105
WP_052936027.1|57113_57398_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	1.8e-42
WP_080028518.1|57387_58089_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	94.1	1.2e-111
WP_080028519.1|58088_58409_+	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	86.8	2.2e-44
WP_080028520.1|58500_58788_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	94.4	5.1e-40
WP_000139733.1|58784_59009_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	100.0	9.1e-37
WP_073714439.1|59005_59317_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	96.1	1.7e-57
WP_073714440.1|59313_60006_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	95.2	2.0e-130
WP_080028521.1|60103_61099_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	98.8	1.3e-196
WP_069067277.1|61115_61805_+	hypothetical protein	NA	Q71T76	Escherichia_phage	70.0	4.1e-88
WP_080028522.1|61791_62478_+	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	61.5	2.8e-44
WP_069067276.1|62474_63188_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	57.9	1.3e-57
WP_000797282.1|63360_63549_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000951710.1|63550_63760_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_074446721.1|63756_64458_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	90.3	1.5e-56
WP_001142396.1|64441_64726_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_001344848.1|64710_64920_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_032220968.1|65093_65345_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	96.4	2.3e-36
WP_069067275.1|65443_65833_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	96.1	2.7e-68
WP_001190712.1|65905_66127_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_069067274.1|66126_66507_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	90.3	1.3e-56
WP_000432092.1|66590_67391_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	96.5	8.1e-136
WP_069067273.1|67397_68060_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	80.1	5.5e-98
WP_000640903.1|68074_68569_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
WP_000861173.1|68565_69042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000349257.1|69038_69347_-	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_080028523.1|69456_70485_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	1.1e-57
WP_000888609.1|71677_71917_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_000897063.1|71944_73453_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
WP_031325887.1|73452_74433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|74813_75206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|75314_75500_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|75706_75898_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_032220960.1|76965_77793_-|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	98.2	6.9e-130
WP_000077919.1|80366_81575_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
WP_001238268.1|81984_82185_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
81596:81614	attR	TAAATTAGTTTTCTAACAT	NA	NA	NA	NA
WP_086252943.1|82199_82496_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_069067271.1|82830_83091_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	6.8e-44
WP_000209223.1|83093_83528_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_080028524.1|83564_90401_-	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	99.2	0.0e+00
WP_001273800.1|90551_91037_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_047648389.1|91069_91267_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	93.8	5.0e-31
