The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	54925	66051	4333246	integrase	Paenibacillus_phage(61.54%)	15	62773:62786	67733:67746
WP_079940192.1|54925_56299_-	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	4.8e-27
WP_155121023.1|57008_57275_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	88.5	2.7e-19
WP_077995599.1|57490_57880_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	50.7	1.3e-06
WP_024094459.1|58069_58273_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_077995601.1|58897_59542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995602.1|60156_60360_+	hypothetical protein	NA	A0A0K2CYF6	Paenibacillus_phage	60.0	5.8e-06
WP_024094463.1|60428_60650_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_077995603.1|60748_60940_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	100.0	4.4e-24
WP_155121024.1|60943_61096_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	81.2	2.3e-07
WP_079940195.1|61510_62002_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	90.9	1.7e-72
WP_079940196.1|62391_62892_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
62773:62786	attL	GTGGTTACTTTCAA	NA	NA	NA	NA
WP_077995606.1|63471_63654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995607.1|63949_64360_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	39.8	2.3e-09
WP_077995608.1|64391_64808_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_079940197.1|64929_66051_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.3	4.4e-87
67733:67746	attR	TTGAAAGTAACCAC	NA	NA	NA	NA
>prophage 2
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	382788	463463	4333246	head,portal,bacteriocin,tail,protease,integrase,tRNA,capsid,terminase,plate,transposase	Paenibacillus_phage(42.11%)	99	404731:404748	460009:460026
WP_077995752.1|382788_383136_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482975.1|383151_383463_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_023482973.1|384371_385247_-|protease	membrane metalloprotease-like protein	protease	NA	NA	NA	NA
WP_077995754.1|385239_386154_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_079940228.1|386282_387455_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_023482970.1|387467_388262_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_023482969.1|388359_388998_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_077995755.1|389067_389598_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_023482967.1|389597_390455_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_024094763.1|390497_391529_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_024094764.1|391595_392285_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_024094765.1|392770_393202_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995756.1|393282_393879_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077995757.1|393948_394191_-	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
WP_077997528.1|394441_395584_+	hypothetical protein	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.5	2.9e-22
WP_024094768.1|395684_396974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995759.1|397096_398485_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_023484266.1|398492_399866_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_079940786.1|399936_402603_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.4	4.1e-168
WP_077995760.1|403395_404547_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
404731:404748	attL	TCCCCCGTGATAGGGTGA	NA	NA	NA	NA
WP_079940229.1|404956_405196_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	66.7	1.3e-20
WP_079940230.1|405810_406149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932747.1|406287_408858_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	51.8	3.5e-233
WP_079940232.1|411100_412090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940233.1|412059_412932_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_079940235.1|413330_413813_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.2e-25
WP_079940237.1|415014_416733_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_079940238.1|416723_416951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940239.1|416937_417921_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_079940787.1|418352_418988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940240.1|419022_419739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940241.1|419874_420117_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	7.3e-32
WP_036655918.1|421080_421317_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996661.1|421630_421921_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_077996660.1|421932_422523_-	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_079940243.1|422526_422805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932808.1|422801_423365_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.4	5.7e-35
WP_079940245.1|423375_424452_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	53.3	1.2e-102
WP_079940246.1|424444_424855_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	50.0	1.2e-29
WP_079940247.1|424857_425100_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	47.6	3.1e-14
WP_079940248.1|425099_426083_-	hypothetical protein	NA	S5MA66	Brevibacillus_phage	55.9	2.6e-104
WP_079940249.1|426087_426726_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.5	2.2e-51
WP_079940250.1|426722_428840_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.3	1.2e-141
WP_023485206.1|429063_429489_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_079940251.1|429515_429980_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	62.7	7.2e-52
WP_079940252.1|429981_431313_-|tail	phage tail sheath protein	tail	A0A0K2CNL4	Brevibacillus_phage	50.1	2.9e-114
WP_155121029.1|431313_431484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940253.1|431476_431887_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	45.2	2.3e-25
WP_079940254.1|431883_432294_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	58.0	2.1e-39
WP_079940789.1|432293_432614_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	57.5	6.5e-28
WP_079940255.1|432654_433026_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	60.5	1.3e-32
WP_079940256.1|433052_433310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940257.1|433321_434365_-|capsid	phage capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.0	1.1e-172
WP_079940790.1|434380_434740_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.0	3.6e-43
WP_079940258.1|434752_435376_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	68.9	2.4e-71
WP_079940259.1|435419_436439_-|head	phage head morphogenesis protein	head	S5MTV5	Brevibacillus_phage	53.8	2.6e-102
WP_104932722.1|436435_437908_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	62.0	3.5e-169
WP_079940260.1|437922_439194_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	66.0	1.3e-164
WP_079940261.1|439186_439927_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	48.4	2.1e-45
WP_155121030.1|439985_440153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121031.1|440196_440496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940792.1|440586_440853_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_079940263.1|441413_441719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940264.1|441844_442279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940265.1|442296_442800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940266.1|442937_443150_-	DUF2829 domain-containing protein	NA	A0A1C8E971	Bacillus_phage	87.0	7.8e-30
WP_079940267.1|443210_443561_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	88.8	6.2e-56
WP_155121032.1|443580_443754_-	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	77.2	8.1e-17
WP_079940268.1|443972_444176_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	86.6	1.9e-25
WP_104932809.1|444309_444765_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	73.0	5.8e-54
WP_079940270.1|444915_445356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940271.1|445348_445573_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	60.3	4.7e-17
WP_155121033.1|445624_445789_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	85.0	3.6e-14
WP_079940793.1|445804_446500_-	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	39.5	2.8e-31
WP_079940272.1|446620_447721_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	79.5	6.5e-160
WP_079940273.1|447924_448299_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	65.0	8.4e-43
WP_079940274.1|448300_448510_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	83.8	5.5e-28
WP_079940275.1|448628_449450_-	AAA family ATPase	NA	A0A0K2CYM7	Paenibacillus_phage	98.2	1.9e-119
WP_079940276.1|449340_450231_-	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	86.1	6.1e-124
WP_079940277.1|450279_450612_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	91.8	6.1e-53
WP_079940278.1|450636_451038_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	73.5	3.0e-46
WP_079940279.1|451087_451891_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	40.0	1.2e-46
WP_079940280.1|451853_452744_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	57.8	6.8e-83
WP_155121034.1|452834_453002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940282.1|453313_453640_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	93.2	9.8e-48
WP_079940283.1|453654_454332_-	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	83.1	6.8e-59
WP_079940284.1|454328_454517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940285.1|454552_454861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940286.1|454857_455613_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
WP_155121035.1|455649_455814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940287.1|455960_456221_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	76.1	5.6e-22
WP_079940288.1|456217_456589_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	88.3	1.5e-55
WP_079940289.1|456581_456764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940290.1|456873_457164_-	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	85.3	4.3e-39
WP_104932748.1|457410_457626_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	44.3	6.5e-08
WP_023483881.1|457894_458620_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
WP_079940292.1|458687_459917_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	75.6	1.3e-180
WP_104932749.1|459989_460898_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
460009:460026	attR	TCCCCCGTGATAGGGTGA	NA	NA	NA	NA
WP_077997530.1|462506_463463_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.6	1.2e-32
>prophage 3
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	473825	525340	4333246	integrase,protease,tRNA,holin,transposase	Paenibacillus_phage(35.29%)	55	471786:471801	532191:532206
471786:471801	attL	TCCGACAAGAGCTCCC	NA	NA	NA	NA
WP_079940295.1|473825_475226_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_023484282.1|475397_475931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995767.1|476068_476470_-	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.5e-18
WP_023484284.1|476842_477430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995768.1|477820_478435_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_079940296.1|478453_480787_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.4	2.8e-168
WP_024094788.1|480936_482655_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
WP_104932751.1|482870_483578_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_077995769.1|483628_484750_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_077995770.1|484854_486117_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	5.9e-149
WP_024094790.1|486132_486723_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
WP_104932752.1|486887_488189_-	trigger factor	NA	NA	NA	NA	NA
WP_046655164.1|488368_489271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940297.1|489401_490622_-	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	34.2	1.3e-55
WP_024094793.1|490848_490962_-	DUF4023 domain-containing protein	NA	NA	NA	NA	NA
WP_079940298.1|491016_492528_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_077995775.1|492514_492991_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|493157_493511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094797.1|493799_495644_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
WP_079940299.1|495711_496344_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_024094798.1|496330_497086_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_079940300.1|497396_498428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656345.1|498664_499180_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
WP_077995776.1|499291_500101_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932621.1|500338_501208_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|501228_501912_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_036658013.1|502132_503182_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_079940301.1|503248_503986_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_104932661.1|504479_504644_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_079940303.1|504789_505680_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_104932800.1|505886_506318_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077997138.1|507072_507279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|507450_508671_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077584997.1|509497_509584_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_149867773.1|509829_510021_+	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	76.2	1.6e-21
WP_077997135.1|510042_510375_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	78.3	1.0e-44
WP_042119240.1|510340_510544_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	88.3	4.0e-23
WP_023483158.1|510773_511508_-	oxo-acid lyase	NA	NA	NA	NA	NA
WP_023483159.1|511511_512618_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_079940306.1|512659_513325_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_036658006.1|513327_514113_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_077997134.1|514133_514475_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_023483163.1|514475_514832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094960.1|514871_515234_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_077997133.1|515212_516355_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_079940307.1|516347_518354_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_077997130.1|518747_519275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077997129.1|519365_519578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121036.1|519561_519702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940308.1|519705_521055_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.1	3.1e-71
WP_077997127.1|521242_522022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997126.1|522014_522953_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	7.8e-21
WP_077997125.1|523009_524068_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997124.1|524064_524694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997123.1|524833_525340_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
532191:532206	attR	TCCGACAAGAGCTCCC	NA	NA	NA	NA
>prophage 4
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	695865	763076	4333246	portal,bacteriocin,tail,plate,coat,transposase	Paenibacillus_phage(30.77%)	77	NA	NA
WP_077997025.1|695865_696108_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
WP_155121039.1|696117_696297_-	hypothetical protein	NA	A0A2I7SCT0	Paenibacillus_phage	98.3	1.1e-29
WP_077997024.1|696457_697423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|697544_698414_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|698434_699118_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077997023.1|699213_700512_-	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_077585252.1|702835_703360_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.3	1.0e-06
WP_077585253.1|703925_704072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024093604.1|704118_704496_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_077997022.1|704558_705029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997020.1|706394_707456_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_077997019.1|707744_708383_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997017.1|708779_709835_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.5	1.7e-16
WP_077997016.1|710423_710861_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_077997015.1|711245_711548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997014.1|711820_712234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997013.1|712303_712828_-	VanZ family protein	NA	NA	NA	NA	NA
WP_144029556.1|712844_713147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997012.1|714072_714540_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	3.5e-22
WP_036655155.1|714873_715068_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940330.1|716504_716864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940331.1|716866_717355_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997010.1|717693_718809_-	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_036655157.1|718828_719374_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_036655159.1|719366_719639_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_024093587.1|719651_720335_-	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_077997009.1|720353_720992_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_077997008.1|721003_721831_-	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_036655161.1|721975_722263_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_077997007.1|722312_723776_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_077997006.1|723926_724667_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_023484516.1|724678_725332_-	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_077997005.1|725350_726301_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_077997004.1|726322_727687_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_077997003.1|727716_729147_-	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_077997002.1|729288_730713_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_036655167.1|730705_731278_-	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_023484510.1|731512_731944_-	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_077997001.1|731955_732309_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_023484509.1|732493_733633_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024093574.1|734458_734761_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_023484507.1|734779_734983_-|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_077997648.1|735167_735512_+	DUF2512 family protein	NA	NA	NA	NA	NA
WP_077997000.1|735562_735910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996999.1|736494_737862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995249.1|738074_739295_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996998.1|739424_739631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996997.1|739812_740835_-	lactate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	6.3e-16
WP_079940798.1|740871_741930_-	malate permease	NA	NA	NA	NA	NA
WP_155121040.1|742281_742449_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	78.1	6.2e-06
WP_104932656.1|742595_742826_-|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	100.0	3.9e-27
WP_077996996.1|743746_743986_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	6.3e-36
WP_155121041.1|744024_744183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996995.1|744175_744571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996994.1|744583_746356_-	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	45.2	3.2e-15
WP_155121042.1|746466_746637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997646.1|746633_747203_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	2.7e-32
WP_079940332.1|747207_748284_-|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.6	4.8e-99
WP_077996992.1|748261_748684_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	2.5e-27
WP_077996991.1|748686_748974_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	39.3	1.5e-15
WP_077996990.1|748973_749942_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.8	1.7e-111
WP_079940333.1|749946_750588_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.3	4.6e-49
WP_079940334.1|750587_752633_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	41.7	3.0e-134
WP_077996986.1|753004_753427_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	41.8	4.4e-24
WP_077996985.1|753446_753908_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.1e-48
WP_077996984.1|753909_755244_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	46.4	1.7e-109
WP_077996983.1|755244_755427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|755401_755830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121043.1|756301_756775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940799.1|757074_757515_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	78.0	1.1e-57
WP_077996980.1|757768_758224_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077997645.1|758324_758687_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_077996979.1|759004_759481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940336.1|759533_761015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|761029_762085_-	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_024095079.1|762194_762452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095080.1|762914_763076_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	851396	894762	4333246	holin,bacteriocin,protease,transposase	Paenibacillus_phage(20.0%)	38	NA	NA
WP_077996937.1|851396_851618_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_077996935.1|852718_853714_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_023483995.1|853897_854257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996934.1|854305_855532_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_077996933.1|855601_856975_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_079940347.1|856983_858183_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_077996931.1|858195_859566_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_077996930.1|859565_860684_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_077996929.1|860689_862126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940348.1|862148_863375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483987.1|863415_863787_-	EamA family transporter	NA	NA	NA	NA	NA
WP_024095155.1|863790_864180_-	DUF2304 family protein	NA	NA	NA	NA	NA
WP_023483334.1|864195_864891_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	28.0	1.4e-06
WP_079940349.1|865138_865948_+	inositol phosphorylceramide synthase	NA	NA	NA	NA	NA
WP_077997641.1|866069_866591_+|protease	protease	protease	NA	NA	NA	NA
WP_077996927.1|866631_868131_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.2	1.6e-07
WP_104932797.1|868340_870290_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077996925.1|870323_871529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996924.1|871577_872246_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_077997640.1|872433_873291_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484080.1|873294_874023_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_077996923.1|874019_875189_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_077996922.1|875427_875802_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077996921.1|875792_876311_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484075.1|876413_876812_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
WP_077996920.1|877128_878010_-	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	33.0	2.0e-10
WP_077997639.1|878561_879443_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077996919.1|879747_880638_-	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
WP_077996918.1|881223_881433_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996917.1|881651_882374_+	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	40.6	7.8e-45
WP_077996916.1|883337_883796_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077996914.1|884171_884612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932654.1|885929_887046_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	100.0	2.4e-154
WP_155121046.1|887437_887581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940801.1|888559_890566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483458.1|892098_892305_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|892405_892684_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_104932807.1|893717_894762_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
>prophage 6
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	921464	1060277	4333246	portal,head,bacteriocin,tail,integrase,protease,capsid,terminase,plate,coat,transposase	Paenibacillus_phage(42.86%)	170	915540:915559	1003840:1003859
915540:915559	attL	AAATTTTATCTATTACCTCT	NA	NA	NA	NA
WP_104932621.1|921464_922334_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|922354_923038_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932668.1|923290_924407_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077995777.1|924560_924875_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|924874_925216_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024094809.1|925283_925865_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940351.1|926220_926682_+	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	47.0	2.1e-35
WP_079940352.1|926721_926925_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	65.7	1.6e-16
WP_079940353.1|928338_928578_-|transposase	transposase	transposase	A0A2I7SDD6	Paenibacillus_phage	93.7	1.6e-31
WP_079940354.1|929511_929748_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0K2CZB4	Paenibacillus_phage	100.0	1.0e-30
WP_024094416.1|929783_929942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|929934_930330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940355.1|930342_931710_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	38.5	2.4e-10
WP_079940243.1|931713_931992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932808.1|931988_932552_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.4	5.7e-35
WP_079940357.1|932562_933639_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	53.5	1.6e-102
WP_079940358.1|933631_934042_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	1.4e-27
WP_079940359.1|934044_934287_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	35.9	1.1e-11
WP_079940360.1|934286_935270_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	55.3	7.7e-104
WP_079940361.1|935274_935913_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.5	9.9e-52
WP_079940362.1|935909_938018_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	43.0	3.3e-144
WP_077995249.1|938138_939359_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_079940363.1|939437_940079_-	hypothetical protein	NA	S5MUN3	Brevibacillus_phage	41.2	1.1e-34
WP_079940364.1|940317_940743_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_079940365.1|940766_941234_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	64.3	4.2e-52
WP_079940366.1|941235_942567_-|tail	phage tail sheath protein	tail	A0A0K2CNL4	Brevibacillus_phage	49.9	6.5e-114
WP_155121029.1|942567_942738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940367.1|942730_943141_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	47.6	8.3e-28
WP_079940368.1|943137_943545_-	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	60.3	2.6e-37
WP_079940803.1|943544_943865_-	ABC transporter ATP-binding protein	NA	S5M673	Brevibacillus_phage	56.6	2.5e-27
WP_079940369.1|943905_944274_-	DNA-packaging protein	NA	S5MP25	Brevibacillus_phage	51.7	1.5e-28
WP_079940370.1|944260_945271_-|coat	coat protein	coat	D2J006	Enterococcus_phage	65.6	2.2e-114
WP_079940371.1|945288_945930_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	71.8	1.5e-63
WP_079940372.1|945970_946990_-|head	phage head morphogenesis protein	head	S5M601	Brevibacillus_phage	55.5	2.9e-106
WP_104932812.1|946986_948426_-|portal	phage portal protein	portal	S5MNW1	Brevibacillus_phage	62.1	9.1e-170
WP_079940374.1|948433_949687_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0K2CP71	Brevibacillus_phage	79.7	2.8e-199
WP_079940375.1|949673_950111_-|terminase	terminase small subunit	terminase	S6B9Y6	Thermus_phage	63.9	1.3e-47
WP_155121047.1|950160_950328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121048.1|950361_950535_-	hypothetical protein	NA	A0A0C5AJR9	Paenibacillus_phage	78.0	3.3e-10
WP_104932753.1|950753_951383_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077995927.1|951342_951582_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_079940378.1|951699_952812_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	80.3	1.2e-161
WP_079940379.1|952995_953217_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	93.2	2.1e-33
WP_079940380.1|953221_953626_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	96.2	3.9e-70
WP_079940381.1|953606_954191_-	hypothetical protein	NA	K7Z7Q9	Megavirus	39.9	1.8e-28
WP_079940382.1|954586_954916_-	hypothetical protein	NA	A0A0C5JZC6	Enterococcus_phage	49.3	3.3e-11
WP_079940383.1|954921_957135_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	93.2	0.0e+00
WP_079940384.1|957484_957649_-	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	95.6	8.7e-21
WP_079940385.1|957658_959239_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	97.3	6.9e-296
WP_079940386.1|959248_959758_-	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	92.9	4.6e-84
WP_079940387.1|959779_960859_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	84.4	1.2e-174
WP_079940388.1|960858_962169_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	81.2	8.5e-175
WP_079940389.1|962234_962945_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	7.5e-125
WP_079940390.1|962981_963353_-	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	95.9	5.3e-58
WP_079940391.1|963420_963621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940392.1|963641_963863_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	69.9	5.7e-23
WP_079940393.1|963902_964178_-	hypothetical protein	NA	A0A0N9RRC2	Paenibacillus_phage	89.0	3.4e-25
WP_079940394.1|964453_964720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940395.1|964721_964955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940396.1|965093_965345_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	72.2	1.9e-22
WP_155121049.1|965345_965600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940398.1|965629_965923_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	86.6	1.4e-40
WP_079940399.1|965919_966657_-	phage antirepressor Ant	NA	A0A2I7SC24	Paenibacillus_phage	92.7	2.7e-130
WP_079940400.1|966674_967304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940401.1|967521_967713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940402.1|967838_968255_+	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	76.4	8.4e-44
WP_079940403.1|968226_969264_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	30.6	1.2e-06
WP_079940404.1|969362_970598_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	96.6	1.4e-232
WP_079940405.1|970855_971839_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077995778.1|971848_972583_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_079940804.1|973085_974030_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_077995780.1|974846_975305_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155121050.1|975431_975794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932754.1|975911_976106_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940407.1|976619_980216_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	25.6	2.8e-42
WP_077995782.1|980288_980858_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079940408.1|981366_982272_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.2	3.4e-90
WP_023483458.1|982681_982888_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|982988_983267_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023482516.1|983931_984570_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077995375.1|985881_987105_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077995783.1|987913_989476_-	recombinase family protein	NA	A0A0C5AJM7	Paenibacillus_phage	98.5	5.6e-290
WP_077995784.1|989707_990166_-	transcriptional regulator	NA	A0A0C5AC66	Paenibacillus_phage	96.7	5.4e-76
WP_077995785.1|990216_990675_-	hypothetical protein	NA	A0A2I7SCC0	Paenibacillus_phage	98.0	2.7e-75
WP_077995786.1|990833_991421_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	94.3	7.3e-102
WP_077995787.1|991417_991630_-	hypothetical protein	NA	R9VYB7	Paenibacillus_phage	85.7	8.3e-32
WP_077995788.1|991737_991929_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	80.0	3.4e-16
WP_077995789.1|991978_992344_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	95.8	9.9e-57
WP_155116288.1|992390_992540_-	hypothetical protein	NA	R9W0Q6	Paenibacillus_phage	100.0	5.0e-23
WP_077995790.1|992554_992860_-	hypothetical protein	NA	A0A0C5AEC7	Paenibacillus_phage	91.1	4.9e-49
WP_077997534.1|992862_994185_-	AAA family ATPase	NA	A0A0K2CY23	Paenibacillus_phage	98.6	2.4e-246
WP_149867712.1|994150_994819_-	hypothetical protein	NA	A0A2I7SDJ4	Paenibacillus_phage	98.6	1.9e-122
WP_023483155.1|995000_995315_-	hypothetical protein	NA	A0A0C5AEL1	Paenibacillus_phage	100.0	2.0e-37
WP_077995791.1|995311_996070_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	94.8	1.5e-139
WP_077995792.1|996082_996997_-	recombinase RecT	NA	A0A0C5AEK7	Bacteriophage	85.9	8.9e-147
WP_077995793.1|996999_997197_-	hypothetical protein	NA	A0A0C5AN67	Paenibacillus_phage	93.8	8.0e-29
WP_077995794.1|997193_998714_-	AAA family ATPase	NA	A0A0C5AN14	Bacteriophage	83.9	8.5e-227
WP_077995795.1|998697_998991_-	hypothetical protein	NA	A0A0C5AJQ8	Paenibacillus_phage	95.9	3.8e-43
WP_077995796.1|998995_999256_-	hypothetical protein	NA	A0A0C5AN52	Paenibacillus_phage	64.4	5.5e-25
WP_077995797.1|999291_999702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995798.1|999863_1000097_-	hypothetical protein	NA	A0A0C5AN13	Bacteriophage	88.3	4.9e-33
WP_077995799.1|1000093_1000336_-	hypothetical protein	NA	A0A0C5AER7	Bacteriophage	78.9	2.0e-29
WP_155121051.1|1000432_1000609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995800.1|1000592_1000865_-	hypothetical protein	NA	A0A0C5AEJ1	Bacteriophage	95.5	3.6e-43
WP_077995801.1|1000891_1001632_-	phage antirepressor protein	NA	A0A2I7SDG8	Paenibacillus_phage	97.2	8.9e-129
WP_155121052.1|1001660_1001804_-	hypothetical protein	NA	A0A2I7SCU1	Paenibacillus_phage	95.7	2.7e-18
WP_077995803.1|1002001_1002220_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AMZ9	Paenibacillus_phage	95.7	5.6e-31
WP_077995804.1|1002436_1002883_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AN12	Bacteriophage	96.6	1.3e-71
WP_077995805.1|1003456_1003660_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	100.0	6.3e-29
WP_077995806.1|1003756_1003987_-	helix-turn-helix transcriptional regulator	NA	A0A0C5ABM0	Bacteriophage	96.0	3.0e-35
1003840:1003859	attR	AAATTTTATCTATTACCTCT	NA	NA	NA	NA
WP_077995807.1|1004462_1004654_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	96.6	1.1e-25
WP_079940409.1|1004650_1004917_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	84.3	8.0e-32
WP_079940410.1|1004920_1005127_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	89.7	4.2e-28
WP_077995809.1|1005218_1005461_-|transposase	transposase	transposase	A0A0C5AEQ4	Bacteriophage	96.2	7.6e-29
WP_077997536.1|1005713_1006385_-	hypothetical protein	NA	A0A2I7SC18	Paenibacillus_phage	93.3	6.8e-128
WP_077995810.1|1006384_1006624_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	96.2	3.1e-35
WP_024094416.1|1006659_1006818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995811.1|1006810_1007206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995812.1|1007218_1009003_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	90.6	2.3e-69
WP_079940411.1|1009003_1009567_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	91.4	1.9e-91
WP_079940805.1|1009563_1010673_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	99.7	1.6e-203
WP_077995813.1|1010684_1011011_-	hypothetical protein	NA	A0A0C5ABJ8	Bacteriophage	98.1	7.3e-51
WP_077995814.1|1011000_1011402_-|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	95.5	1.0e-70
WP_079940412.1|1011398_1011776_-	hypothetical protein	NA	A0A0C5AEP6	Bacteriophage	90.4	1.6e-57
WP_077995816.1|1011778_1012807_-	late control protein	NA	A0A0C5AJ59	Bacteriophage	91.8	1.3e-186
WP_077995817.1|1012803_1013013_-|tail	phage tail protein	tail	A0A0C5AEF4	Bacteriophage	76.1	4.8e-24
WP_079940413.1|1013009_1015505_-	tape measure protein	NA	A0A0C5ABJ2	Bacteriophage	84.4	0.0e+00
WP_077995821.1|1015664_1016000_-|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	85.0	6.8e-44
WP_077995822.1|1016027_1016546_-|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	94.8	9.4e-85
WP_077995823.1|1016558_1018001_-|tail	phage tail protein	tail	A0A0C5AEE8	Bacteriophage	92.1	3.5e-262
WP_077995824.1|1018004_1018277_-	hypothetical protein	NA	A0A0C5ABI6	Bacteriophage	95.6	1.4e-42
WP_077995825.1|1018273_1018741_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	97.4	2.3e-82
WP_077995826.1|1018737_1019289_-	hypothetical protein	NA	A0A0C5AEN6	Bacteriophage	98.9	3.1e-94
WP_077995827.1|1019285_1019597_-	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	100.0	4.8e-52
WP_155121053.1|1019593_1019743_-	hypothetical protein	NA	A0A0C5AEE3	Bacteriophage	100.0	3.0e-20
WP_077995828.1|1019756_1020785_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	99.4	1.7e-194
WP_077995829.1|1020800_1021157_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	97.5	6.3e-56
WP_079940414.1|1021153_1022275_-|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	98.4	6.7e-205
WP_077995832.1|1022234_1023794_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	96.3	9.2e-293
WP_077995833.1|1023790_1024012_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	89.0	1.8e-29
WP_077995834.1|1024028_1025891_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	98.7	0.0e+00
WP_077995835.1|1025874_1026387_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	84.0	3.4e-71
WP_036654551.1|1027534_1027738_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AC70	Paenibacillus_phage	100.0	1.5e-33
WP_077995836.1|1027768_1028179_+	pilus assembly protein HicB	NA	A0A0C5AEN7	Bacteriophage	98.5	7.2e-72
WP_077995837.1|1028207_1028411_-	hypothetical protein	NA	A0A0C5ABQ7	Bacteriophage	98.5	5.2e-31
WP_024094814.1|1028881_1030192_-	permease	NA	NA	NA	NA	NA
WP_036654839.1|1030330_1031263_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_077995841.1|1031243_1031945_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_077997537.1|1032360_1032888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995842.1|1032971_1033808_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_104932757.1|1033794_1034811_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077997539.1|1034815_1035592_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_079940415.1|1035760_1036681_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.9	1.6e-31
WP_077995844.1|1036762_1037482_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	2.1e-10
WP_023482889.1|1037489_1038395_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_024094822.1|1038391_1039222_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_077995846.1|1039218_1040205_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
WP_023482886.1|1040194_1041289_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_077995847.1|1041285_1042746_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077995848.1|1043019_1043391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995849.1|1043390_1044527_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995850.1|1044501_1045692_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077995851.1|1045688_1046411_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	1.8e-46
WP_079940416.1|1048146_1054344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654846.1|1054471_1054810_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_079940417.1|1054952_1056119_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023482876.1|1056458_1057241_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_077995858.1|1057797_1058400_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995859.1|1058703_1059387_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.6	1.8e-123
WP_104932657.1|1059407_1060277_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
>prophage 7
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	1133758	1193196	4333246	tail,integrase,tRNA,terminase,portal,holin,coat,transposase	Paenibacillus_phage(60.78%)	78	1152782:1152798	1193204:1193220
WP_104932657.1|1133758_1134628_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_024094875.1|1134776_1135457_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023483267.1|1135453_1135825_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|1135947_1136841_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995894.1|1137197_1137773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995895.1|1137883_1139032_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_077995896.1|1139059_1139299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|1139321_1139474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|1139592_1140735_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995897.1|1140934_1141285_+	DNA primase	NA	NA	NA	NA	NA
WP_077995898.1|1141286_1141928_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|1142018_1142945_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|1143189_1145202_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_023483257.1|1145809_1146289_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_077995899.1|1146327_1146606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|1146693_1147677_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|1147813_1148038_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_042119744.1|1148164_1148350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654887.1|1148542_1149529_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077995900.1|1149907_1151371_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|1151538_1152177_-	ribonuclease H	NA	NA	NA	NA	NA
1152782:1152798	attL	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
WP_077995901.1|1152917_1153304_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_077584997.1|1153515_1153602_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_077995902.1|1153697_1154156_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	92.7	4.4e-70
WP_077995903.1|1154394_1154580_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	82.0	3.6e-23
WP_077995904.1|1154665_1154929_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	97.7	1.4e-41
WP_104932621.1|1155057_1155927_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|1155947_1156631_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932814.1|1156783_1157419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995908.1|1157453_1158170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995909.1|1158305_1158548_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	96.2	1.1e-32
WP_077997545.1|1158557_1159226_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2I7SD00	Paenibacillus_phage	96.4	2.5e-130
WP_024094328.1|1159225_1159465_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077995910.1|1159644_1159977_-	hypothetical protein	NA	A0A2I7SBZ3	Paenibacillus_phage	87.2	8.2e-50
WP_077995911.1|1159986_1160739_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	98.0	4.8e-82
WP_077995912.1|1160741_1162214_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	53.9	1.2e-124
WP_077995913.1|1162213_1162915_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	42.1	2.9e-44
WP_155121055.1|1162917_1164261_-	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	65.1	1.3e-16
WP_077995249.1|1164409_1165630_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995915.1|1165688_1167485_-	tape measure protein	NA	M1IEW1	Bacillus_virus	39.8	1.3e-53
WP_104932815.1|1167505_1167805_-	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	47.4	3.7e-17
WP_077997546.1|1167918_1168221_-	segregation and condensation protein B	NA	NA	NA	NA	NA
WP_077995917.1|1168223_1168742_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	71.6	1.0e-51
WP_077995918.1|1168755_1169166_-	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.1	1.7e-33
WP_036658585.1|1169170_1169506_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_077995919.1|1169511_1169817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995920.1|1169813_1170134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995921.1|1170136_1170685_-	hypothetical protein	NA	A7J297	Streptococcus_phage	49.2	7.2e-35
WP_077995249.1|1170763_1171984_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077995922.1|1172025_1172391_-	hypothetical protein	NA	A7J297	Streptococcus_phage	55.3	1.2e-25
WP_077995923.1|1172403_1172994_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_077995924.1|1173080_1173974_-	hypothetical protein	NA	S5MTV5	Brevibacillus_phage	33.9	8.7e-38
WP_077995925.1|1173882_1175295_-|portal	phage portal protein	portal	A0A1P8BLJ1	Lactococcus_phage	49.3	7.4e-116
WP_077997547.1|1175295_1176714_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	69.4	2.9e-189
WP_077997548.1|1176709_1177207_-|transposase	transposase	transposase	A0A0E3U2Q7	Fusobacterium_phage	65.2	6.7e-40
WP_077995926.1|1177422_1178046_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_077995927.1|1178011_1178251_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	75.4	9.8e-21
WP_077995928.1|1178368_1179487_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SC33	Paenibacillus_phage	89.4	7.2e-183
WP_077995929.1|1179488_1179710_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	94.5	5.5e-34
WP_077995930.1|1179713_1180109_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	97.7	6.9e-72
WP_079940424.1|1180098_1180377_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	98.9	1.4e-47
WP_077995932.1|1180663_1182916_-	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	99.9	0.0e+00
WP_077995933.1|1182920_1183250_-	hypothetical protein	NA	A0A2I7SC50	Paenibacillus_phage	99.1	1.9e-62
WP_077995934.1|1183246_1184836_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	98.9	1.4e-301
WP_023485397.1|1184845_1185346_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	100.0	3.1e-93
WP_051427849.1|1185370_1186069_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	100.0	5.2e-139
WP_077995935.1|1186100_1187204_-	ATP-binding protein	NA	A0A2I7SC30	Paenibacillus_phage	99.2	7.6e-209
WP_077995936.1|1187203_1188514_-	AAA family ATPase	NA	A0A2I7SC23	Paenibacillus_phage	76.4	2.5e-174
WP_077995937.1|1188574_1189285_-	hypothetical protein	NA	A0A2I7SC22	Paenibacillus_phage	98.3	5.7e-125
WP_023484471.1|1189334_1189706_-	hypothetical protein	NA	A0A2I7SC29	Paenibacillus_phage	100.0	3.4e-60
WP_051427850.1|1189735_1190020_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	100.0	3.8e-48
WP_079940425.1|1190023_1190257_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	84.1	4.3e-21
WP_077995939.1|1190272_1190527_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	43.4	2.8e-10
WP_077995940.1|1190498_1190720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995941.1|1190804_1191047_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	69.3	2.4e-22
WP_077995942.1|1191171_1191504_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	55.8	2.7e-16
WP_077995943.1|1191513_1191975_+	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	64.1	8.7e-50
WP_077995944.1|1192056_1193196_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.6	4.2e-61
1193204:1193220	attR	TGTGGGCAAAATGTGGG	NA	NA	NA	NA
>prophage 8
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	1272228	1396731	4333246	holin,integrase,protease,transposase	Paenibacillus_phage(25.0%)	108	1274094:1274108	1403960:1403974
WP_077995988.1|1272228_1272774_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
WP_079940438.1|1273207_1273912_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
1274094:1274108	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_077995989.1|1274467_1277695_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	24.4	1.1e-77
1274094:1274108	attL	GATTATATTTCATTT	NA	NA	NA	NA
WP_077995990.1|1277678_1279043_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_077995991.1|1279331_1280648_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_077995992.1|1280936_1281920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940439.1|1282267_1284286_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_036658223.1|1284325_1284604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995995.1|1285399_1286197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094946.1|1286414_1287872_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_149867718.1|1288065_1289094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995997.1|1289258_1289786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997553.1|1289761_1290514_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077995998.1|1290610_1291804_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|1291829_1293389_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|1294154_1294403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|1294409_1294673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|1294856_1295798_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023484418.1|1295979_1296594_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_077997554.1|1296816_1298007_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|1298042_1298732_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149867719.1|1298931_1299246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996002.1|1299697_1300969_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	1.4e-09
WP_077996004.1|1301206_1301701_-	DUF4261 domain-containing protein	NA	NA	NA	NA	NA
WP_077996005.1|1302063_1302594_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_149867720.1|1302588_1303353_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_104932770.1|1303623_1304364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996008.1|1304545_1304770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996009.1|1304868_1305483_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077996010.1|1305514_1307431_-	AAA family ATPase	NA	Q331U3	Clostridium_botulinum_C_phage	35.2	3.2e-05
WP_077996011.1|1307690_1308977_+	MFS transporter	NA	NA	NA	NA	NA
WP_077996012.1|1309204_1309537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|1309855_1310125_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077997555.1|1310157_1310451_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_023483432.1|1310702_1310993_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996013.1|1310989_1313500_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_036658187.1|1313604_1313901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1315003_1316227_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_079940440.1|1316382_1317831_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_023483464.1|1317965_1318352_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_077996015.1|1318373_1318832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121056.1|1319523_1319673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867721.1|1319662_1320871_-	DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	36.5	1.7e-68
WP_077996017.1|1321118_1321280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155121057.1|1321744_1321897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996018.1|1321886_1322495_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.5	1.1e-31
WP_077996019.1|1322537_1323242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996021.1|1324187_1324628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996022.1|1324760_1325132_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	42.0	1.8e-13
WP_077996023.1|1325399_1325699_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_104932771.1|1325732_1325966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121058.1|1325952_1326303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996025.1|1326603_1328133_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_042118705.1|1328144_1328708_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658506.1|1328851_1329016_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_077996026.1|1329032_1331021_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_036658128.1|1331017_1331245_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_077996027.1|1332824_1333982_+	MFS transporter	NA	NA	NA	NA	NA
1332901:1332915	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_036658123.1|1334240_1334753_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1332901:1332915	attR	AAATGAAATATAATC	NA	NA	NA	NA
WP_083039549.1|1334749_1335043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997556.1|1335186_1336110_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.4e-30
WP_077996029.1|1336624_1336987_-	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	80.0	9.9e-49
WP_104932772.1|1337001_1337451_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	80.8	5.0e-58
WP_077996030.1|1338031_1339006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996031.1|1338957_1339773_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	37.4	1.1e-36
WP_079940442.1|1340017_1341283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|1341315_1342539_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997558.1|1342653_1342842_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	58.9	6.5e-12
WP_051428085.1|1342825_1343017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996034.1|1343069_1343816_-	hypothetical protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.9	1.7e-31
WP_079940443.1|1344082_1346530_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_077996035.1|1346541_1347588_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_077996036.1|1347590_1350383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996037.1|1350379_1350868_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_024093465.1|1350874_1351162_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_023484175.1|1351284_1352031_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_077996038.1|1352023_1352974_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_036655264.1|1352970_1353390_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024093462.1|1353395_1354550_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996039.1|1354725_1355673_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_042118638.1|1356065_1357118_+	Fic family protein	NA	NA	NA	NA	NA
WP_024093460.1|1357553_1359437_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_077996041.1|1360155_1360968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996042.1|1360957_1361836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996043.1|1364604_1365504_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_077996044.1|1365653_1368872_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_104932817.1|1368878_1369505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996045.1|1369632_1371093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940444.1|1371077_1372382_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_155121059.1|1372607_1372745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867723.1|1376393_1376930_-	hypothetical protein	NA	A0A2I7SCM7	Paenibacillus_phage	96.4	7.3e-24
WP_077995375.1|1376885_1378109_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_079940445.1|1378101_1378992_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077996051.1|1378992_1380450_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	28.6	4.2e-21
WP_077584997.1|1381000_1381087_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_149867724.1|1381260_1381770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996053.1|1382466_1385640_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_149867725.1|1385741_1385972_-	mersacidin/lichenicidin family type 2 lantibiotic	NA	NA	NA	NA	NA
WP_077996055.1|1386063_1387218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996056.1|1387223_1387922_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_077996057.1|1387937_1388948_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.9	1.2e-22
WP_051428052.1|1388944_1389193_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077997560.1|1392038_1393976_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	1.0e-11
WP_104932773.1|1394145_1394337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996059.1|1394292_1394601_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077996060.1|1394590_1395262_-|transposase	IS3 family transposase	transposase	O48391	Streptococcus_phage	68.8	9.8e-18
WP_149867726.1|1396048_1396420_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077996061.1|1396545_1396731_-|transposase	transposase	transposase	NA	NA	NA	NA
1403960:1403974	attR	GTCGGTAAAGTACAG	NA	NA	NA	NA
>prophage 9
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	1413264	1423921	4333246		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_079940447.1|1413264_1414812_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
WP_077996072.1|1415022_1415646_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	1.8e-26
WP_077996073.1|1415642_1416689_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	1.5e-68
WP_077996074.1|1416782_1418357_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.6	8.7e-49
WP_079940448.1|1418341_1420585_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.5	4.5e-168
WP_023485275.1|1420562_1421258_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_023485276.1|1421330_1421573_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	4.3e-08
WP_077996075.1|1421667_1422552_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.6	9.5e-37
WP_036655290.1|1422625_1423921_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
>prophage 10
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	1486855	1530414	4333246	holin,transposase,tRNA	Paenibacillus_phage(40.0%)	49	NA	NA
WP_077996096.1|1486855_1488025_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_077996097.1|1488053_1488641_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_024093346.1|1488921_1489350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093345.1|1489630_1490260_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996098.1|1490303_1491197_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023485156.1|1491213_1491870_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036657132.1|1491866_1493015_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.6	8.9e-27
WP_077996099.1|1493438_1494740_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_077996100.1|1495764_1496772_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093340.1|1497436_1498051_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
WP_077996101.1|1498168_1500787_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996102.1|1500847_1501834_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093337.1|1501830_1502607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996103.1|1502622_1503570_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
WP_079940453.1|1503729_1503939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585258.1|1504287_1504443_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.0	9.8e-06
WP_036655317.1|1504754_1505057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657135.1|1505165_1506326_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_077996105.1|1506484_1506826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485170.1|1507050_1507443_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_036655319.1|1507537_1508443_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996106.1|1508435_1509362_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
WP_023485173.1|1509566_1510373_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
WP_077585259.1|1510819_1511248_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_023485175.1|1511392_1511746_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_077996107.1|1511749_1512616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996108.1|1512733_1513456_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_023485178.1|1513458_1513977_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_077996109.1|1513983_1514649_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_077996110.1|1514703_1514994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485180.1|1515252_1515939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996111.1|1516078_1517101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940454.1|1517134_1517635_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_155121060.1|1517930_1518101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932657.1|1518264_1519134_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	99.6	1.1e-135
WP_036654509.1|1519154_1519838_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077996114.1|1519904_1520165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996115.1|1520254_1520740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996116.1|1520896_1522165_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.4e-28
WP_042118522.1|1522263_1522626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996117.1|1522704_1523037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867728.1|1523021_1523486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996119.1|1524486_1525080_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_077996120.1|1525186_1525429_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.7e-26
WP_077995375.1|1525487_1526711_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996121.1|1526753_1527335_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.4	5.2e-100
WP_077996122.1|1527472_1528156_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_024093255.1|1528343_1529045_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_077996123.1|1529034_1530414_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.9	1.7e-19
>prophage 11
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	1545445	1587799	4333246	holin,bacteriocin,transposase	Paenibacillus_phage(37.5%)	40	NA	NA
WP_077996132.1|1545445_1545850_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
WP_077996133.1|1546068_1546317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093234.1|1546471_1546723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940455.1|1546788_1547478_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_077996135.1|1548022_1549231_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_077996136.1|1549220_1549448_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_077995249.1|1549797_1551018_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996137.1|1551059_1551329_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093230.1|1551331_1551502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483551.1|1551508_1551934_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996138.1|1553255_1554494_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023483554.1|1554621_1555455_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077996139.1|1555902_1556709_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077996140.1|1556891_1558070_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_077996141.1|1558118_1560479_-	AAA family ATPase	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.5	2.9e-08
WP_036657148.1|1560722_1561178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996142.1|1561234_1562173_+	MFS transporter	NA	NA	NA	NA	NA
WP_079940456.1|1562321_1563959_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_077996143.1|1564293_1565562_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077996144.1|1565554_1566460_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
WP_077995375.1|1566762_1567986_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077996145.1|1569412_1570279_-	cytochrome C oxidase assembly protein	NA	NA	NA	NA	NA
WP_024093219.1|1570405_1570720_-	cytochrome c oxidase subunit IV	NA	NA	NA	NA	NA
WP_077996146.1|1570724_1571342_-	cytochrome (ubi)quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_079940807.1|1571338_1573147_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_077996147.1|1573336_1574344_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483567.1|1574882_1575467_+	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	28.3	2.9e-10
WP_036655364.1|1575744_1576881_+	virulence factor	NA	NA	NA	NA	NA
WP_023483569.1|1577056_1578046_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077996149.1|1578370_1578676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932777.1|1578768_1579476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104935376.1|1579391_1580354_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.6	3.1e-57
WP_077996153.1|1580605_1582579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996154.1|1582874_1583231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996155.1|1583227_1583923_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.9	1.2e-18
WP_077996156.1|1584203_1584452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093206.1|1584780_1585158_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_155121061.1|1585522_1585690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655372.1|1587162_1587345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996157.1|1587499_1587799_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 12
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	2505474	2575977	4333246	bacteriocin,transposase,tRNA	Paenibacillus_phage(50.0%)	60	NA	NA
WP_077997612.1|2505474_2506737_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	2.2e-87
WP_077996631.1|2506768_2507470_+	replication protein	NA	NA	NA	NA	NA
WP_042119415.1|2509929_2511792_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_023483977.1|2511901_2512717_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_079940500.1|2512808_2514194_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_077996632.1|2514480_2514777_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_077997613.1|2515086_2515737_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_077996633.1|2515965_2516781_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	52.9	1.7e-40
WP_077996634.1|2518345_2518903_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.4	5.4e-38
WP_077996635.1|2518899_2519859_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.7	6.6e-76
WP_036655890.1|2519855_2520710_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_077996636.1|2520953_2521535_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_149867746.1|2521825_2522461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996638.1|2522636_2522891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940501.1|2523374_2524739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121069.1|2524725_2524902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996641.1|2525066_2525573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996642.1|2525591_2525918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996644.1|2526833_2527715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996645.1|2527737_2528670_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_077996646.1|2528669_2530343_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_079940503.1|2530342_2531467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997614.1|2531480_2532377_+	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_042118428.1|2532360_2532765_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_149867747.1|2532838_2533597_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_077996650.1|2535497_2536169_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
WP_077996651.1|2538299_2538788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996653.1|2540239_2541496_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_077996654.1|2541663_2542851_+	alanine racemase	NA	NA	NA	NA	NA
WP_079940504.1|2543085_2543367_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_104932789.1|2543891_2546096_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_077997616.1|2546297_2546864_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023485404.1|2547261_2547720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093128.1|2547804_2548032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940505.1|2548287_2549487_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	38.8	3.4e-45
WP_096761197.1|2549795_2549903_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_077996657.1|2550064_2550421_-	hydrolase/acyltransferase	NA	NA	NA	NA	NA
WP_077996658.1|2550519_2550990_+	SprT family protein	NA	NA	NA	NA	NA
WP_077996659.1|2552701_2553466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996660.1|2553765_2554356_+	hypothetical protein	NA	S5MNY5	Brevibacillus_phage	24.9	1.1e-12
WP_077996661.1|2554367_2554658_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	50.5	1.5e-18
WP_036655918.1|2554971_2555208_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
WP_077996662.1|2555885_2556131_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	93.8	2.2e-31
WP_149867748.1|2556491_2556893_+	hypothetical protein	NA	D2XR29	Bacillus_phage	45.1	3.3e-21
WP_036655919.1|2557616_2558063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996503.1|2558250_2559003_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	8.4e-135
WP_077996665.1|2559140_2559824_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	6.9e-120
WP_079940506.1|2560752_2561397_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_104932629.1|2561373_2562491_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_079940507.1|2562515_2563913_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_036654509.1|2564274_2564958_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|2564978_2565848_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996666.1|2566433_2567708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940508.1|2567778_2570391_+	peptidase	NA	A0A1V0E026	Clostridioides_phage	33.4	2.6e-98
WP_079940509.1|2570916_2571522_+	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	9.7e-33
WP_077996667.1|2571876_2572848_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	78.9	2.9e-143
WP_077996668.1|2572907_2573927_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	61.5	1.9e-60
WP_077996669.1|2573943_2574351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932629.1|2574707_2575824_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	2.1e-153
WP_104932635.1|2575878_2575977_+	dihydroorotate dehydrogenase	NA	A0A2I7SCT3	Paenibacillus_phage	96.9	2.3e-08
>prophage 13
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	2659918	2713805	4333246	holin,bacteriocin,tRNA,transposase	Paenibacillus_phage(16.67%)	55	NA	NA
WP_077996720.1|2659918_2660254_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940518.1|2661211_2662300_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_024095277.1|2662524_2663070_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_077997624.1|2663217_2663610_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_079940519.1|2663647_2665618_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_024095275.1|2665664_2665865_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_024095273.1|2666052_2666478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|2666778_2667462_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2667482_2668352_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023484880.1|2668458_2669439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996722.1|2669636_2670455_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_077996723.1|2670447_2671560_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_079940520.1|2671772_2673167_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_052337463.1|2673307_2673847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940521.1|2674207_2675674_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	1.8e-80
WP_077996726.1|2675670_2677026_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	5.3e-55
WP_077996727.1|2677066_2678173_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|2678789_2679179_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|2679400_2679835_+	universal stress protein	NA	NA	NA	NA	NA
WP_077585182.1|2680134_2680419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996728.1|2680448_2681405_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.3e-121
WP_023484892.1|2681459_2681945_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_077996729.1|2682013_2682322_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484894.1|2682342_2682543_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_079940522.1|2682637_2685064_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
WP_077997625.1|2685120_2685744_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|2685833_2686511_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|2686507_2687314_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_036655989.1|2687603_2687846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996732.1|2688569_2688854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996733.1|2689026_2690712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996734.1|2691021_2691378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996735.1|2691604_2692267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996736.1|2692580_2692775_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	37.3	8.0e-05
WP_024095256.1|2693174_2693876_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_077996738.1|2694233_2695466_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_077996739.1|2695490_2696729_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095255.1|2696866_2697031_+	rubredoxin	NA	NA	NA	NA	NA
WP_077996740.1|2697102_2697810_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077996741.1|2698085_2698739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996742.1|2698855_2700037_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_155121072.1|2700222_2700387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996743.1|2700844_2700967_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077996744.1|2700933_2701353_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	5.0e-12
WP_077996746.1|2701368_2701686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104932641.1|2701753_2702713_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.5	2.2e-47
WP_024095236.1|2702989_2703913_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023483724.1|2704079_2704595_+	signal peptidase I	NA	NA	NA	NA	NA
WP_104932642.1|2705016_2705214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996747.1|2705696_2706725_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
WP_079940523.1|2706748_2709199_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_077996748.1|2709305_2712206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483729.1|2712211_2712751_+	CvpA family protein	NA	NA	NA	NA	NA
WP_036656016.1|2712832_2713195_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483731.1|2713436_2713805_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 14
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	2792326	2847435	4333246	transposase,integrase,tRNA	Paenibacillus_phage(27.78%)	51	2831755:2831814	2845793:2847514
WP_077996785.1|2792326_2792791_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_023483795.1|2792996_2793254_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	48.0	3.6e-13
WP_023483796.1|2793627_2794572_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996786.1|2794818_2795646_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077996787.1|2795642_2796308_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_077997630.1|2796413_2797331_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077997631.1|2797385_2798126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095175.1|2798332_2800228_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.1	1.3e-102
WP_077996790.1|2800345_2802916_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_024095174.1|2803322_2803520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095173.1|2803855_2805772_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.6	1.3e-126
WP_077996791.1|2806367_2806568_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	3.7e-05
WP_077996792.1|2806707_2807874_-	MFS transporter	NA	NA	NA	NA	NA
WP_077996793.1|2807900_2809466_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.0	8.3e-52
WP_077996794.1|2812607_2814707_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	35.9	2.0e-32
WP_155121077.1|2814974_2815238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940529.1|2815386_2816940_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024095162.1|2817161_2817416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484406.1|2817708_2818248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761292.1|2818548_2818734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996795.1|2819348_2820782_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_077996796.1|2820778_2821930_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.7	5.6e-21
WP_077996797.1|2822497_2823157_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	6.5e-06
WP_155121078.1|2823153_2823330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996798.1|2823322_2824726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996799.1|2824835_2825030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867759.1|2825551_2825785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996801.1|2825966_2826449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995397.1|2826571_2827795_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_023485364.1|2829569_2829941_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_155121079.1|2830017_2830194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940530.1|2830217_2831528_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_079940531.1|2831551_2831776_+	hypothetical protein	NA	NA	NA	NA	NA
2831755:2831814	attL	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAG	NA	NA	NA	NA
WP_036654509.1|2831823_2832507_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2832527_2833397_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996804.1|2833596_2834013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996805.1|2834277_2834589_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_077996806.1|2834575_2834941_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077996807.1|2834987_2835629_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_077996808.1|2835764_2836871_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_077996809.1|2836890_2838120_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|2838338_2838788_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_077996810.1|2838959_2839532_+	DUF1802 family protein	NA	NA	NA	NA	NA
WP_077996811.1|2839712_2840546_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
WP_077996812.1|2841904_2843131_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.5	2.5e-112
WP_023485352.1|2843117_2843555_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_023485351.1|2843579_2844977_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_079940813.1|2844998_2845265_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	54.9	6.6e-18
WP_024093285.1|2845298_2845490_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_036654509.1|2845861_2846545_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2846565_2847435_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
2845793:2847514	attR	TGATATGCTCCCCTTGCGGTAGACAGTTGAAATAATAAAACTGTTTACTGTAAGGAGGAGCATTTTTTCATGTCCCATAAAGCAAAAGTATCAGGATCAGAAAAGATTGCAGCTGTTGAAAAGTATTTACGTGGAGAAGATTCGCTTAATCATTTAGCAGCACTTCTTGATGTACGCCATTCATCCGTTAGGCAATGGCTTCAGACTTACCAGTCGCTAGGCCCAAACGGATTGCTTCAAACATCACAGAATGCATCTTACTCCGCAGAGTTAAAAAGAATAGCTGTCGAGGACTATTTGGCTGGCGGCGGTTCTCACATGGATATTTGTAAAAGATATGGCATTAAGTCAACTTGCCAATTGCGGGATTGGATTCTGAAGTATAATAGTCATGAGAAGTTGAACACTTCCGGAACGGGAGGAGTGCCGATCATGACAAAAGGACGAACAACTACTTACGATGAGAGAGTTGAAATCGTCAGATTCTGCATTGAACATCAACACAATTATGCCCAGACAGCTGATAAATTCCAGGTATCCTATCAGCAAGTTTATTCATGGACAAATAAATACTTAACATCTGGTGTGGATGCACTTCAGGACAGACGCGGGAAAAGAAAATCTGAGGATGAGATGTCCGAAGTGGAGAAACTAAGGGCTCAGAATAAGCTGTTACAGGCTGAGAACAGAAGGAAGCAGATGGAGATCGATTTGCTAAAAAAGTTGGACGAGATCGAAAGGAGGCGGTTCTAAGCCAGGTAAGGTATGAAACGATATACCTTGCAATACGCGGGCTCCGTGAAACGAAGTCATATCCCATATGTCAATTATGTGATCTTATTGGGATCCAACGTTCATCGTATTATAAATGGATCAACCGGAAAGAAAGTATTAATGAGATCTTTAATAAAGCGTTGCTTCCCATGATTAAAGATGCCTACGAGGAAAAGGATGGCATCCTTGGATATCGCCAGATGACCATTAAACTAAACCGGGAACGCCATGTAACTGTCAATCATAAGCGAATATACAGACTTATGGGCATCCTAGGCCTTAAATCGGTATGCCGCAGGAAGCGAAAAAACTACATCCATTCCACACCTGAAATTACGGCGGAAAATATCCTGAACAGAGACTTTGAATCCTCTGAGTTTGGTACGAAATGGCTCACAGATGTGACTGAAATGAAGTATGGCAACCAAAACAAGGCTTATCTTAGTGCAATCCTTGATTTGTCGGATAAAAGCATTGTTTCTTTTGTGGTAGGGCATTCCAACAACAATGAACTTGTATTTAAAACTTTTGATATCGCCCATATGACTTATCCTGACGCTACACCCCTCTTTCACAGTGACCGGGGTTTCCAATATACATGTAAAATCTTCAAGAAAAAACTAGACGATGCAGGTATGATCCAAAGCATGTCCAGGGTATCCAGATGTATAGATAATGGCCCAATGGAATCATTCTGGGGAATGATGAAATCCGAAATGTATTATCTTCGTAAGTTCTATACATATGAGGAACTGGAAGCAGCCGTGATAGAATACATCGATTACTACAATACTCGTCGATACCAGAAAAGACTTAATTGTATGACGCCGTTGGAATATAGGCAATACCTTCTAAGTTCAGCAGCATAGAAAATGGCACCAACCATGTATGGTTAGTGCCACAACTTTTTTTGTTTTTTACACTGTCTACTTGACAGGGGTCAGTTCA	NA	NA	NA	NA
>prophage 15
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	2852463	2904702	4333246	holin,coat,transposase	Paenibacillus_phage(83.33%)	51	NA	NA
WP_077996865.1|2852463_2852709_+|transposase	transposase	transposase	A0A2I7SC00	Paenibacillus_phage	88.9	2.8e-31
WP_077996866.1|2852895_2854293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104935363.1|2855325_2857929_+	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.8	4.6e-265
WP_077996868.1|2858704_2860267_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_036654509.1|2860636_2861320_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2861340_2862210_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077996871.1|2862674_2862839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867762.1|2864098_2864752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940532.1|2864885_2866175_+	MFS transporter	NA	D0R099	Streptococcus_phage	22.5	1.2e-08
WP_077996875.1|2867862_2868495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932796.1|2868588_2868735_+|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	100.0	2.8e-18
WP_077997637.1|2871363_2872401_+	amidinotransferase	NA	NA	NA	NA	NA
WP_077996877.1|2872827_2873028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996878.1|2873590_2873800_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	54.5	1.7e-13
WP_155121082.1|2873892_2874066_+	hypothetical protein	NA	A0A0C5AMZ7	Paenibacillus_phage	90.7	7.1e-13
WP_155121083.1|2874109_2874283_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	98.2	8.3e-22
WP_077996880.1|2874510_2874918_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	94.0	3.4e-66
WP_077995249.1|2875262_2876483_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077996881.1|2877560_2877749_-	hypothetical protein	NA	A0A2I7SC09	Paenibacillus_phage	78.7	9.1e-22
WP_077996882.1|2878566_2878971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996883.1|2878952_2879249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121084.1|2879785_2879950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996884.1|2880184_2881120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996885.1|2881143_2881533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121085.1|2881529_2881667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093300.1|2882386_2882713_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093303.1|2883458_2884502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996887.1|2884521_2884827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144029661.1|2884854_2884956_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_023484376.1|2885189_2885585_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077996888.1|2885780_2886827_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_036656196.1|2886905_2887238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077996889.1|2887373_2888399_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_079940534.1|2888583_2889999_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023484381.1|2890143_2890995_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_077585292.1|2891382_2892486_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_077996890.1|2892538_2893909_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_104932652.1|2894071_2894935_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	2.8e-134
WP_077996122.1|2894957_2895641_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077585196.1|2895821_2896034_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|2896306_2896573_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|2896614_2897184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996892.1|2897576_2897873_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|2898102_2899008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867763.1|2899076_2899265_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|2900211_2900409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077996893.1|2901104_2901710_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.5	6.1e-51
WP_077996894.1|2901842_2902337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|2902574_2902964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|2903128_2903812_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|2903832_2904702_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
>prophage 16
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3022457	3029212	4333246		Staphylococcus_phage(57.14%)	7	NA	NA
WP_023482600.1|3022457_3022895_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|3023839_3024952_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|3024955_3025621_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_077997196.1|3025655_3026888_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.6e-112
WP_024093718.1|3026919_3027390_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_077997197.1|3027819_3028602_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	1.3e-08
WP_036658393.1|3028570_3029212_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
>prophage 17
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3188429	3228780	4333246	protease,transposase	Paenibacillus_phage(80.0%)	38	NA	NA
WP_077995397.1|3188429_3189653_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_077997273.1|3189711_3190683_+	hypothetical protein	NA	S5W9C6	Leptospira_phage	41.5	1.1e-09
WP_079940561.1|3190753_3191380_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_077997276.1|3191429_3191738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997277.1|3191715_3192042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997661.1|3192331_3192595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997279.1|3192607_3192913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3193153_3194377_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_155121087.1|3194332_3195193_+	hypothetical protein	NA	A0A2I7SCM7	Paenibacillus_phage	100.0	1.8e-24
WP_079940562.1|3195211_3195904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940563.1|3195931_3196987_+	RHS repeat-associated core domain-containing protein	NA	S5W9C6	Leptospira_phage	37.2	4.8e-11
WP_149867785.1|3200181_3200481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3200837_3202061_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_077997286.1|3202661_3203066_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997287.1|3203076_3203808_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_079940564.1|3203811_3204678_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997288.1|3204881_3205898_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_036654509.1|3205964_3206648_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3206668_3207538_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077997289.1|3207654_3208509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997290.1|3208505_3209654_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_079940565.1|3209660_3210770_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_077997291.1|3210800_3212246_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024093827.1|3212720_3212951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121088.1|3213132_3213606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997293.1|3213665_3213923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997294.1|3213941_3214517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997662.1|3216368_3217895_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_079940566.1|3218233_3219457_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_077997296.1|3219792_3221034_+	arginine deiminase	NA	NA	NA	NA	NA
WP_077997663.1|3221051_3222050_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_024093832.1|3222145_3223561_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_024093834.1|3224568_3225255_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482955.1|3225310_3225808_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_077997297.1|3226243_3226564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|3226668_3227352_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932634.1|3227372_3228242_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_023482953.1|3228354_3228780_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 18
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3233121	3300832	4333246	bacteriocin,protease,tRNA,coat,transposase	Staphylococcus_phage(20.0%)	50	NA	NA
WP_077997664.1|3233121_3233361_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_079940567.1|3233467_3235231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997303.1|3235227_3235767_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_077997305.1|3236338_3237007_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.3e-14
WP_077997665.1|3237366_3238890_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997306.1|3238986_3239964_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077997307.1|3239971_3240982_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_079940568.1|3240974_3242003_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_077997308.1|3242349_3243531_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.9	7.7e-26
WP_104932668.1|3243686_3244804_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	99.3	4.6e-153
WP_077997309.1|3244916_3245753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079940569.1|3246837_3248055_-	cytochrome P450	NA	NA	NA	NA	NA
WP_079940570.1|3248517_3250398_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042119509.1|3250484_3250754_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_079940571.1|3251173_3251974_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_077997313.1|3252096_3253203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940572.1|3253544_3256520_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155121089.1|3256553_3256736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940574.1|3256797_3256977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940575.1|3258092_3258767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997318.1|3259299_3260022_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997319.1|3261388_3261688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121090.1|3261996_3262146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940576.1|3263585_3265667_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_079940577.1|3266505_3267546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997666.1|3268073_3268826_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_079940578.1|3268888_3269581_-	LrgB family protein	NA	NA	NA	NA	NA
WP_077997322.1|3269570_3269936_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_155121120.1|3270263_3271466_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_077997323.1|3271674_3272997_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155121091.1|3273282_3273444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940580.1|3273503_3274796_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_079940821.1|3274837_3276424_+	malate synthase A	NA	NA	NA	NA	NA
WP_079940581.1|3276559_3278977_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155121092.1|3279063_3279684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940583.1|3280461_3282711_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_077997330.1|3282876_3283155_-	DUF2653 family protein	NA	NA	NA	NA	NA
WP_023482849.1|3283154_3283586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119140.1|3283713_3284268_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_077997331.1|3284264_3284855_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042119138.1|3284877_3285213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940584.1|3285319_3286840_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_079940822.1|3287429_3288389_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_023482840.1|3291012_3291975_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482839.1|3292072_3292642_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_079940585.1|3292743_3294174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940586.1|3294221_3296903_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.1	3.8e-28
WP_079940587.1|3296933_3298982_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	3.5e-66
WP_036656949.1|3299102_3299882_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077997333.1|3299869_3300832_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3320262	3353161	4333246	integrase,transposase	Paenibacillus_phage(50.0%)	29	3321211:3321226	3348177:3348192
WP_077995249.1|3320262_3321483_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
3321211:3321226	attL	AACTGGGCAGAATTGG	NA	NA	NA	NA
WP_077997345.1|3321616_3321913_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997346.1|3321767_3322064_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_149867796.1|3322101_3322530_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997348.1|3322466_3322793_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997349.1|3322861_3323281_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	61.4	4.8e-39
WP_046655237.1|3323360_3323711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997350.1|3326353_3327478_+	LCP family protein	NA	NA	NA	NA	NA
WP_077997668.1|3327578_3327809_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	49.3	4.4e-10
WP_024094581.1|3328305_3328572_+	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_077997351.1|3328717_3329335_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.6	5.3e-18
WP_036656935.1|3329613_3329859_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036654904.1|3330040_3330226_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_077997352.1|3330252_3331047_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023484144.1|3331152_3331695_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_079940589.1|3331971_3335412_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_023484146.1|3335586_3336543_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_077997353.1|3338103_3338856_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.3	3.2e-134
WP_077996122.1|3338993_3339677_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077997354.1|3339767_3340733_-	aerolysin family beta-barrel pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	58.2	9.6e-83
WP_149867798.1|3342378_3342588_+	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	73.8	3.4e-17
WP_077997356.1|3342943_3345229_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_079940590.1|3345225_3346611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997358.1|3346770_3347574_+	Fpg/Nei family DNA glycosylase	NA	W5S5H6	Pithovirus	23.7	3.0e-05
WP_077997359.1|3347573_3348443_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	28.9	1.2e-23
3348177:3348192	attR	AACTGGGCAGAATTGG	NA	NA	NA	NA
WP_077997360.1|3348478_3348811_+	cell division protein FtsJ	NA	NA	NA	NA	NA
WP_077997361.1|3348916_3349621_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.5	2.1e-10
WP_077997364.1|3351032_3351509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995375.1|3351937_3353161_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
>prophage 20
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3455125	3509519	4333246	transposase,tRNA	Paenibacillus_phage(16.67%)	60	NA	NA
WP_077997416.1|3455125_3457552_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.1	0.0e+00
WP_077997417.1|3457669_3458137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997418.1|3458212_3460144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997419.1|3460145_3460367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940602.1|3460726_3461611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997422.1|3461622_3462234_+	hypothetical protein	NA	A0A2K9L5M2	Tupanvirus	36.4	5.4e-23
WP_104932677.1|3462948_3463305_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.4	4.4e-09
WP_077997423.1|3463534_3463891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077997424.1|3463906_3465106_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932678.1|3465480_3465816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_149867805.1|3466027_3466750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079940603.1|3466947_3469215_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.1	1.1e-44
WP_077997425.1|3469189_3469870_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	41.8	4.7e-44
WP_144029670.1|3470000_3470963_-	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_077997426.1|3471067_3471430_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_077997427.1|3471472_3472441_+	ROK family protein	NA	NA	NA	NA	NA
WP_077584979.1|3472535_3472766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940604.1|3472949_3474026_+	DUF3900 domain-containing protein	NA	NA	NA	NA	NA
WP_077997428.1|3474072_3475188_-	aminopeptidase	NA	NA	NA	NA	NA
WP_079940605.1|3475688_3476945_+	MFS transporter	NA	NA	NA	NA	NA
WP_104932621.1|3477040_3477910_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3477930_3478614_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077997429.1|3478752_3479379_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.4	8.0e-38
WP_077997430.1|3479557_3479875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940826.1|3480430_3481282_+	patatin family protein	NA	NA	NA	NA	NA
WP_024093907.1|3482627_3482918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093908.1|3482914_3483682_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036656739.1|3483699_3484476_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-16
WP_077997432.1|3484480_3485266_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_079940606.1|3485294_3485873_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_079940607.1|3485927_3486227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121095.1|3486366_3486528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482556.1|3486665_3487493_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079940608.1|3487561_3488221_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093913.1|3488224_3489229_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.0e-31
WP_077997433.1|3489618_3490329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940609.1|3490335_3491310_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_096761303.1|3491290_3491956_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023482563.1|3492619_3494305_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_149867806.1|3494496_3494748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654434.1|3495021_3495258_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_079940610.1|3495380_3496334_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.1	1.6e-69
WP_077997436.1|3496636_3497506_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_149867820.1|3497556_3497811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997438.1|3497684_3498416_-	magnesium transporter	NA	NA	NA	NA	NA
WP_077584976.1|3498396_3498612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121096.1|3498566_3498710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482568.1|3498706_3499696_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024093924.1|3499932_3500745_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_077997676.1|3500962_3501106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940611.1|3501029_3501284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121097.1|3501379_3501796_+	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_036654361.1|3501808_3502009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940613.1|3502247_3502769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093927.1|3502968_3503112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940614.1|3503410_3504310_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485097.1|3504353_3505970_+	MFS transporter	NA	NA	NA	NA	NA
WP_024093930.1|3506152_3506698_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079940615.1|3506850_3508212_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_077995249.1|3508298_3509519_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
>prophage 21
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3572327	3580810	4333246	transposase	Paenibacillus_phage(77.78%)	10	NA	NA
WP_077997474.1|3572327_3572852_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZC9	Paenibacillus_phage	80.0	1.1e-45
WP_077584965.1|3572991_3573165_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	91.3	2.9e-14
WP_079940630.1|3573365_3575441_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_036654509.1|3575764_3576448_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3576468_3577338_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_079940631.1|3577589_3577772_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	89.7	9.7e-21
WP_079940632.1|3577765_3578137_+	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	87.0	1.2e-49
WP_077995249.1|3578234_3579455_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	53.5	8.8e-57
WP_077997680.1|3580146_3580350_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.6	2.7e-27
WP_077997477.1|3580366_3580810_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	56.6	1.7e-42
>prophage 22
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3607056	3664872	4333246	tail,integrase,capsid,terminase,portal,holin	Paenibacillus_phage(91.18%)	84	3599382:3599413	3659996:3660027
3599382:3599413	attL	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_079940638.1|3607056_3608280_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	86.0	9.3e-200
WP_079940639.1|3608305_3609004_-	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	46.0	2.1e-47
WP_079940640.1|3609140_3609341_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J3K6	uncultured_Caudovirales_phage	44.1	1.6e-08
WP_079940641.1|3609406_3609634_+	excisionase family DNA-binding protein	NA	A0A0C5AN65	Paenibacillus_phage	77.1	9.0e-24
WP_155121099.1|3609659_3610073_+	hypothetical protein	NA	A0A0N9SSV8	Paenibacillus_phage	60.0	2.5e-24
WP_079940643.1|3610052_3610361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940644.1|3610480_3611119_+	hypothetical protein	NA	A0A0N9RZD8	Paenibacillus_phage	99.1	6.5e-128
WP_079940645.1|3611141_3611936_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N9SJU0	Paenibacillus_phage	87.3	2.0e-126
WP_155121100.1|3611932_3612109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121101.1|3612105_3612279_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	91.2	1.6e-20
WP_077995167.1|3612275_3612578_+	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	96.0	3.5e-47
WP_077995168.1|3612593_3612920_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	94.4	6.6e-52
WP_149867651.1|3613055_3613547_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	44.4	1.3e-19
WP_079940646.1|3613604_3613976_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	92.7	3.4e-60
WP_040932746.1|3613959_3614337_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	84.8	1.9e-55
WP_040932748.1|3614355_3614622_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	84.1	3.7e-37
WP_077995171.1|3614629_3615400_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	94.9	2.5e-142
WP_077995172.1|3615396_3616773_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	84.5	2.3e-223
WP_079940647.1|3616785_3617736_+	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	82.9	1.5e-152
WP_077995175.1|3617795_3618374_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	55.2	7.6e-51
WP_077995176.1|3618439_3618967_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	93.7	8.4e-81
WP_077995177.1|3619051_3619774_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	90.2	9.3e-123
WP_077995178.1|3619949_3620291_+	hypothetical protein	NA	A0A7H5	Microcystis_virus	43.5	4.7e-08
WP_077995179.1|3620435_3620849_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	5.0e-73
WP_079940648.1|3621060_3621657_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	67.8	1.3e-61
WP_079940828.1|3621822_3623454_+	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	94.3	2.9e-305
WP_149867652.1|3623422_3623773_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	60.7	1.8e-31
WP_077995183.1|3623766_3624894_+	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	79.4	4.6e-177
WP_077995184.1|3624894_3625092_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	95.4	4.7e-29
WP_077995185.1|3625088_3625703_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	96.1	2.8e-104
WP_077995186.1|3625687_3626707_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	81.1	4.6e-136
WP_077995187.1|3626681_3627215_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	85.5	6.8e-30
WP_077995188.1|3627211_3627394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995189.1|3627359_3629678_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.4	1.3e-279
WP_077995190.1|3629691_3630723_+	ribonucleotide-diphosphate reductase subunit beta	NA	U5Q1G6	Bacillus_phage	61.2	1.9e-121
WP_079940649.1|3630734_3631262_+	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	54.3	1.9e-40
WP_077995192.1|3631254_3631551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995193.1|3631547_3631886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040930425.1|3631886_3632213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995194.1|3632354_3632555_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	95.2	1.1e-28
WP_077995195.1|3632551_3632782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995196.1|3632783_3633101_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	87.6	1.6e-50
WP_077995197.1|3633094_3633565_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	86.8	3.2e-76
WP_077995198.1|3633561_3633930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995199.1|3633973_3635053_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	51.7	3.6e-62
WP_079940650.1|3635036_3635597_+	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	85.8	1.6e-85
WP_155121102.1|3635553_3635808_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	76.2	9.7e-35
WP_079940652.1|3636015_3636423_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	88.1	2.0e-58
WP_077995202.1|3636412_3636865_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	77.3	4.5e-59
WP_079940653.1|3637786_3638032_+	hypothetical protein	NA	A0A0N9SIR9	Paenibacillus_phage	97.8	4.5e-13
WP_079940829.1|3638024_3638855_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	97.8	2.6e-153
WP_077995205.1|3639197_3639392_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	86.2	1.4e-06
WP_077995206.1|3639413_3639833_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	92.8	4.8e-71
WP_024094642.1|3639822_3640221_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
WP_155121103.1|3641142_3641307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121104.1|3641410_3641587_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	94.8	2.2e-17
WP_079940654.1|3641852_3642152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997491.1|3642364_3644050_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	97.6	5.8e-301
WP_077995210.1|3644073_3645558_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	92.1	5.7e-244
WP_077995211.1|3645554_3646415_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	93.4	1.6e-145
WP_079940655.1|3646506_3647142_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	74.4	3.0e-61
WP_077995214.1|3647197_3648133_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	94.9	2.7e-167
WP_079940656.1|3648147_3648531_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
WP_077995215.1|3648531_3648864_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	96.4	1.7e-55
WP_077995218.1|3649668_3650217_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	95.1	2.9e-92
WP_079940657.1|3650267_3650645_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.0	5.1e-56
WP_155121105.1|3650824_3650995_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	74.5	2.8e-14
WP_079940658.1|3651022_3653917_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	56.2	5.2e-249
WP_077995224.1|3653916_3655374_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	94.8	1.3e-277
WP_079940659.1|3655364_3657698_+	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.4	0.0e+00
WP_077995227.1|3657682_3658132_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	89.7	4.5e-67
WP_077995228.1|3658119_3658536_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	97.1	2.9e-68
WP_077995229.1|3658528_3659398_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	95.2	1.6e-161
WP_077995230.1|3659685_3659979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995231.1|3660117_3660330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3659996:3660027	attR	TTTTAATTTTCCGTTCCCCTCGTGTTGTTATC	NA	NA	NA	NA
WP_077995232.1|3660332_3660716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995233.1|3660721_3660958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995234.1|3661403_3661766_-	hypothetical protein	NA	A0A142F168	Bacillus_phage	46.7	7.6e-17
WP_077995235.1|3662239_3662419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155121106.1|3662430_3662799_-	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	83.2	2.6e-52
WP_077995236.1|3662801_3663152_-	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	87.1	4.6e-51
WP_040931863.1|3663196_3663622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995237.1|3663786_3664413_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	62.4	2.5e-39
WP_079940660.1|3664485_3664872_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	94.5	3.4e-63
>prophage 23
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3842693	3912915	4333246	protease,transposase	Paenibacillus_phage(54.17%)	58	NA	NA
WP_079940692.1|3842693_3843242_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	35.2	2.3e-12
WP_155121112.1|3843201_3843363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940833.1|3843487_3844660_+	MFS transporter	NA	NA	NA	NA	NA
WP_077995360.1|3844682_3845441_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940834.1|3845619_3846351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940693.1|3846379_3847846_+	antitoxin	NA	NA	NA	NA	NA
WP_079940835.1|3847930_3848494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|3848618_3849515_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|3850498_3850867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995363.1|3851057_3851792_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|3851847_3852633_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_079940695.1|3852746_3854264_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_104932805.1|3854343_3855360_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_023484539.1|3855936_3856209_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_104932703.1|3856229_3856649_-	ribonuclease	NA	NA	NA	NA	NA
WP_077995368.1|3857171_3858602_-	MBL fold metallo-hydrolase	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
WP_077995369.1|3858676_3859876_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077995370.1|3860358_3860589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995371.1|3860843_3861911_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_024094116.1|3862025_3863042_+	NTP transferase domain-containing protein	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
WP_104932488.1|3863985_3864213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484729.1|3864301_3865075_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_077995376.1|3865415_3865946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932704.1|3866325_3868752_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_036656619.1|3869245_3870037_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079940699.1|3870072_3870753_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_077995379.1|3870757_3872290_-	PTS glucose transporter subunit IIB	NA	NA	NA	NA	NA
WP_079940700.1|3872663_3873782_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_023484737.1|3873958_3874786_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_079940701.1|3875232_3876795_-	gluconokinase	NA	NA	NA	NA	NA
WP_042118974.1|3876829_3878191_-	GntP family permease	NA	NA	NA	NA	NA
WP_024094123.1|3878301_3878979_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484741.1|3880154_3880472_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	3.4e-13
WP_077995381.1|3881060_3881372_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.9	1.4e-11
WP_104932806.1|3881821_3882867_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_077995382.1|3883342_3883534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077995383.1|3884186_3884576_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_077995384.1|3885064_3887620_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	56.1	1.9e-258
WP_077997499.1|3887873_3888293_+	DUF4064 domain-containing protein	NA	A0A0K2CZQ0	Paenibacillus_phage	100.0	5.7e-24
WP_079940702.1|3888585_3891219_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	47.7	3.1e-232
WP_077995388.1|3892768_3893710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997500.1|3894517_3894736_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	50.0	4.0e-13
WP_079940703.1|3895194_3895386_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	94.7	3.4e-24
WP_036654824.1|3895382_3895655_+	hypothetical protein	NA	A0A0C5AEQ9	Bacteriophage	100.0	3.9e-42
WP_077995391.1|3895658_3895871_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	97.0	1.3e-29
WP_077995392.1|3896222_3896771_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	85.8	9.9e-77
WP_104932621.1|3897027_3897897_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3897917_3898601_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_079940836.1|3898858_3899041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654509.1|3899271_3899955_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_104932621.1|3899975_3900845_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_077995393.1|3902688_3903489_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SCE7	Paenibacillus_phage	55.3	3.1e-18
WP_077995394.1|3904352_3906560_-	hypothetical protein	NA	A0A142IG93	Bacillus_phage	39.9	2.6e-19
WP_077995395.1|3906899_3907217_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	46.2	1.1e-11
WP_077995375.1|3907367_3908591_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
WP_079940705.1|3908736_3909546_-	hypothetical protein	NA	Q38196	Clostridium_botulinum_phage	30.3	1.2e-06
WP_079940706.1|3910272_3911355_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_077995397.1|3911691_3912915_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
>prophage 24
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	3916367	3984144	4333246	bacteriocin,transposase	Paenibacillus_phage(33.33%)	52	NA	NA
WP_077995401.1|3916367_3916640_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	93.3	4.5e-30
WP_077995402.1|3916843_3918298_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.9	2.2e-123
WP_077997501.1|3920056_3921898_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_077995404.1|3924085_3924352_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_083041350.1|3924728_3924929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940707.1|3925034_3925811_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077995405.1|3926167_3928117_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079940708.1|3928103_3928874_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_079940709.1|3929255_3929819_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_077995407.1|3930182_3930509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094129.1|3930646_3930853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940710.1|3931414_3931963_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079940711.1|3932178_3933294_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_077995408.1|3933432_3933861_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_023484627.1|3934027_3934417_-	DoxX family protein	NA	NA	NA	NA	NA
WP_077995409.1|3935404_3935899_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_051427815.1|3936240_3936495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077995411.1|3936527_3937049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654152.1|3938178_3939588_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_023484621.1|3939680_3940568_-	anion permease	NA	NA	NA	NA	NA
WP_077584921.1|3941112_3941364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654150.1|3941711_3942542_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_077995413.1|3943329_3944697_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_077995414.1|3944892_3945942_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.2e-30
WP_077995415.1|3945935_3946253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932705.1|3946191_3947073_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042118984.1|3947660_3948119_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.6	6.5e-13
WP_036656608.1|3948338_3949673_-	magnesium transporter	NA	NA	NA	NA	NA
WP_077995417.1|3949780_3952429_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.8	5.2e-38
WP_149867673.1|3952717_3952993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940712.1|3953371_3953716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940713.1|3953705_3954134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932634.1|3955772_3956642_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|3956662_3957346_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_077995421.1|3957446_3959747_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_077995422.1|3960332_3961415_+	tyrosine recombinase XerS	NA	A0A2R2ZGM9	Clostridioides_phage	24.9	6.7e-08
WP_079940714.1|3961476_3963222_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	1.7e-61
WP_024094153.1|3963401_3964205_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_079940715.1|3964211_3964841_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079940837.1|3964933_3967627_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.6	2.1e-95
WP_024094155.1|3967626_3967791_-	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_077995423.1|3968080_3969316_-	MFS transporter	NA	NA	NA	NA	NA
WP_077995424.1|3969545_3971075_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_023484599.1|3972214_3973420_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077995425.1|3973416_3974652_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077997503.1|3974815_3975298_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_077995427.1|3976920_3978564_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_079940716.1|3978652_3979711_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_077995428.1|3979968_3981246_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_155121113.1|3981339_3981561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149867676.1|3981593_3981752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077995375.1|3982920_3984144_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.2e-226
>prophage 25
NZ_CP020327	Paenibacillus larvae subsp. pulvifaciens strain CCM 38, complete genome	4333246	4182060	4236382	4333246	integrase,transposase,protease,tRNA	Paenibacillus_phage(37.5%)	60	4220966:4220981	4236863:4236878
WP_042119028.1|4182060_4183455_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
WP_036653992.1|4183624_4184167_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_077997509.1|4184345_4185674_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023484649.1|4185686_4187777_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_077995507.1|4187924_4189034_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.4	3.7e-38
WP_077995508.1|4189137_4190073_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_077995509.1|4190129_4191290_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|4191678_4191939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|4191970_4192366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094301.1|4194200_4194605_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|4194614_4194947_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_079940764.1|4194943_4195687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995511.1|4195929_4196535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995512.1|4196573_4196753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484361.1|4196807_4197491_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
WP_077995513.1|4197783_4198665_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_077995514.1|4198773_4199358_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|4199469_4199811_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024094305.1|4199953_4200706_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_077995515.1|4200702_4201224_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_023484355.1|4201449_4201680_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_023484354.1|4201702_4201975_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023484353.1|4202016_4203384_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_024094307.1|4203413_4203776_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_077995516.1|4203909_4204917_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_023484350.1|4205001_4208580_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_077997511.1|4208748_4209450_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	29.6	2.1e-26
WP_024094309.1|4209629_4210865_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024094310.1|4210954_4211188_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
WP_024094311.1|4211306_4212047_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
WP_023484345.1|4212146_4213082_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_077995517.1|4213113_4214100_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094313.1|4214110_4215097_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_077584878.1|4215098_4215689_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_023484341.1|4215864_4216038_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_077995518.1|4216156_4216669_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_036658730.1|4216756_4217830_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_023484339.1|4218014_4219364_+	spore cortex formation factor-like protein	NA	NA	NA	NA	NA
WP_023484338.1|4219374_4219884_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
WP_023484337.1|4219901_4220459_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
4220966:4220981	attL	TTATTTTGCACAAAAA	NA	NA	NA	NA
WP_024094320.1|4221008_4221206_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
WP_024094321.1|4221270_4221684_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
WP_104932621.1|4221812_4222682_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	100.0	3.0e-136
WP_036654509.1|4222702_4223386_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	100.0	4.6e-124
WP_024094322.1|4223556_4223946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077995520.1|4224727_4224865_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079940765.1|4225045_4226377_-	chitin-binding protein	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
WP_104932807.1|4226823_4227868_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
WP_077995522.1|4227933_4228176_-|transposase	transposase	transposase	A0A2I7SCT4	Paenibacillus_phage	98.8	8.6e-33
WP_077585229.1|4228185_4228854_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.9	4.0e-128
WP_024094328.1|4228853_4229093_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_104932714.1|4229505_4230721_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	28.7	6.6e-12
WP_077995527.1|4232064_4232415_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.9	5.8e-30
WP_077995528.1|4232671_4233034_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	79.8	8.1e-35
WP_077995529.1|4233101_4233617_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|4233699_4233903_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_079940767.1|4234498_4234777_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077995531.1|4234869_4235580_+	helix-turn-helix domain-containing protein	NA	R9VW28	Paenibacillus_phage	39.8	1.0e-41
WP_077995532.1|4235518_4236157_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	40.4	3.4e-28
WP_077995533.1|4236157_4236382_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	72.1	5.4e-21
4236863:4236878	attR	TTATTTTGCACAAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP020328	Paenibacillus larvae subsp. pulvifaciens strain CCM 38 plasmid pPLP1, complete sequence	60855	11486	47142	60855	integrase,transposase	Paenibacillus_phage(35.29%)	42	6466:6480	35751:35765
6466:6480	attL	AACATTGATAATTAC	NA	NA	NA	NA
WP_077997733.1|11486_11882_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	63.6	1.3e-41
WP_077997734.1|11886_12942_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
WP_077997735.1|13380_13827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997736.1|14381_15839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997737.1|15876_16551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997738.1|16711_16963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121122.1|16970_17117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997741.1|17596_17836_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0N9S804	Paenibacillus_phage	50.0	3.3e-08
WP_077997739.1|17832_18162_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
WP_077997682.1|18406_19045_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_077997683.1|19812_20091_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	51.7	1.4e-15
WP_077997684.1|20200_20407_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.6e-19
WP_077996502.1|20763_21447_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.4e-117
WP_077997685.1|21584_22013_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	92.8	7.3e-59
WP_077997686.1|22009_22336_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.1	2.3e-57
WP_077997687.1|22450_23368_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	2.6e-93
WP_077997688.1|23514_23766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997689.1|23731_23992_+	plasmid stabilization protein	NA	A0A125RQ76	Bacillus_phage	54.7	2.4e-20
WP_077997690.1|24194_24923_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_077997691.1|25022_25643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077997692.1|25974_26622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997693.1|26579_27554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997694.1|27975_28935_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077997695.1|29123_30011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121123.1|30191_30641_+	hypothetical protein	NA	A2I2Z6	Vibrio_virus	48.2	7.5e-06
WP_149867822.1|32150_32471_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077997698.1|32593_32977_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077997740.1|32816_33089_-|transposase	transposase	transposase	A0A0N9SSU6	Paenibacillus_phage	86.3	1.2e-19
WP_077997699.1|33064_33925_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_077997700.1|34198_34687_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_077997701.1|34766_36818_+	catalase	NA	A0A2K9L572	Tupanvirus	40.8	1.8e-115
35751:35765	attR	AACATTGATAATTAC	NA	NA	NA	NA
WP_077995397.1|37548_38772_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	4.0e-227
WP_079940845.1|39672_39870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079940846.1|39909_40197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079940847.1|40238_41474_-	DNA polymerase IV	NA	M1Q231	Streptococcus_phage	30.1	2.1e-45
WP_077997703.1|42208_42610_+	hypothetical protein	NA	A0A2H4PB09	Aphanizomenon_phage	43.0	1.6e-12
WP_077997704.1|42670_42841_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_077997705.1|43032_43371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997706.1|43425_43833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997707.1|43899_44403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077997708.1|44522_45518_+	DUF3895 domain-containing protein	NA	NA	NA	NA	NA
WP_077997709.1|46086_47142_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	29.5	7.9e-14
