The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020039	Streptomyces sp. 3211 isolate 3 chromosome, complete genome	8232231	2098979	2106000	8232231		Streptomyces_phage(28.57%)	8	NA	NA
WP_079404526.1|2098979_2099660_+	nucleotidyltransferase	NA	A0A1J0GW18	Streptomyces_phage	38.3	2.1e-15
WP_079404528.1|2099648_2100407_-	nucleotidyltransferase	NA	K4K696	Caulobacter_phage	39.2	1.2e-06
WP_079404529.1|2100410_2101421_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	27.7	1.3e-05
WP_030389211.1|2101417_2102146_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	45.7	6.0e-21
WP_079404530.1|2102142_2103222_-	AAA family ATPase	NA	A0A2K8HHU5	Bacteriophage	30.9	6.6e-32
WP_053702667.1|2103218_2103836_-	nicotinamide mononucleotide transporter	NA	A0A0F6YPU8	Sinorhizobium_phage	32.1	1.3e-13
WP_079404532.1|2103982_2105368_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_030389215.1|2105367_2106000_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.9	1.4e-10
>prophage 2
NZ_CP020039	Streptomyces sp. 3211 isolate 3 chromosome, complete genome	8232231	4066169	4099168	8232231	head,terminase,portal,capsid	Streptomyces_phage(96.97%)	41	NA	NA
WP_079405444.1|4066169_4067795_-	recombinase family protein	NA	A0A1J0MCY2	Streptomyces_phage	46.7	2.5e-123
WP_159395611.1|4068188_4068626_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_159395612.1|4068967_4069180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405447.1|4069176_4069380_+	hypothetical protein	NA	A0A1J0MCC6	Streptomyces_phage	76.1	2.5e-09
WP_079405448.1|4069479_4069851_+	hypothetical protein	NA	A0A1V0E638	Streptomyces_phage	57.0	3.0e-24
WP_079405449.1|4069850_4071050_+	hypothetical protein	NA	A0A1V0E653	Streptomyces_phage	65.7	1.6e-116
WP_079407945.1|4071199_4071736_+	hypothetical protein	NA	A0A1J0MCK1	Streptomyces_phage	68.2	3.7e-60
WP_079405450.1|4071732_4072245_+	hypothetical protein	NA	K4HYF6	Streptomyces_phage	44.4	1.1e-08
WP_107470005.1|4072831_4073212_+	hypothetical protein	NA	A0A1V0E664	Streptomyces_phage	56.9	6.1e-25
WP_079405452.1|4073208_4073913_+	cell surface glycoprotein	NA	A0A1J0MCX6	Streptomyces_phage	69.2	2.0e-90
WP_159395613.1|4073909_4074068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405453.1|4074170_4074644_+	single-stranded DNA-binding protein	NA	A0A2H4JEL4	uncultured_Caudovirales_phage	59.2	3.3e-44
WP_079405454.1|4074731_4075193_+	hypothetical protein	NA	A0A1J0MCK9	Streptomyces_phage	63.8	3.0e-10
WP_079405455.1|4075189_4075426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405456.1|4075422_4076217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405457.1|4076213_4076450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405458.1|4076463_4077306_+	hypothetical protein	NA	A0A1J0MCS6	Streptomyces_phage	66.8	5.8e-92
WP_079405459.1|4078415_4079219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405460.1|4079301_4079562_+	hypothetical protein	NA	A0A1J0MC82	Streptomyces_phage	44.2	3.8e-10
WP_079405461.1|4079791_4080313_+	helix-turn-helix domain-containing protein	NA	A0A1J0MCL8	Streptomyces_phage	78.3	1.4e-59
WP_079405462.1|4080317_4081595_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E630	Streptomyces_phage	81.2	3.8e-204
WP_079405463.1|4081591_4081834_+	hypothetical protein	NA	K4I025	Streptomyces_phage	69.4	4.2e-19
WP_079405464.1|4081820_4083299_+|portal	phage portal protein	portal	A0A1J0MCN7	Streptomyces_phage	71.2	1.1e-205
WP_079405465.1|4083335_4085540_+|capsid	phage capsid protein	capsid	A0A1J0MCS2	Streptomyces_phage	64.9	2.2e-260
WP_079405466.1|4085824_4086490_+	hypothetical protein	NA	A0A1J0MD42	Streptomyces_phage	34.8	1.5e-05
WP_079405467.1|4086555_4087413_+|head	phage head protein	head	A0A1J0MCF0	Streptomyces_phage	75.8	1.5e-119
WP_079405468.1|4087580_4087976_+	hypothetical protein	NA	A0A1J0MCI1	Streptomyces_phage	71.0	3.4e-42
WP_079405469.1|4087972_4088266_+	hypothetical protein	NA	A0A1J0MCW8	Streptomyces_phage	57.1	3.4e-23
WP_079405470.1|4088237_4088591_+	hypothetical protein	NA	A0A1V0E617	Streptomyces_phage	78.6	1.6e-43
WP_079405471.1|4088583_4088997_+	hypothetical protein	NA	K4I035	Streptomyces_phage	70.6	5.1e-49
WP_079405472.1|4089009_4089477_+	hypothetical protein	NA	A0A1J0MCP1	Streptomyces_phage	72.2	2.2e-61
WP_079405473.1|4089473_4089929_+	hypothetical protein	NA	A0A1V0E637	Streptomyces_phage	63.1	6.4e-37
WP_079405474.1|4090179_4092414_+	hypothetical protein	NA	A0A1J0MCK8	Streptomyces_phage	79.0	1.1e-81
WP_079405475.1|4092418_4093321_+	hypothetical protein	NA	A0A1J0MCF9	Streptomyces_phage	58.2	3.0e-86
WP_079405476.1|4093334_4094297_+	hypothetical protein	NA	A0A1J0MCI7	Streptomyces_phage	56.8	2.2e-63
WP_079405477.1|4094281_4095394_+	hypothetical protein	NA	A0A1J0MCX4	Streptomyces_phage	61.0	1.9e-122
WP_079405478.1|4095393_4096161_+	hypothetical protein	NA	A0A1J0MCQ1	Streptomyces_phage	41.4	2.0e-43
WP_159395614.1|4096255_4097776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405480.1|4097845_4098646_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4PI36	Streptomyces_phage	51.0	1.3e-64
WP_079405481.1|4098674_4098902_+	hypothetical protein	NA	A0A1J0MD62	Streptomyces_phage	67.6	6.9e-16
WP_079405482.1|4098898_4099168_+	hypothetical protein	NA	A0A1J0MCF7	Streptomyces_phage	72.6	3.0e-26
>prophage 3
NZ_CP020039	Streptomyces sp. 3211 isolate 3 chromosome, complete genome	8232231	4686390	4740998	8232231	protease,plate,tail,tRNA	Moumouvirus(14.29%)	51	NA	NA
WP_079405757.1|4686390_4688160_-|tRNA	arginine--tRNA ligase	tRNA	M1PAX3	Moumouvirus	31.1	1.8e-79
WP_053175373.1|4688301_4690068_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_079407988.1|4690133_4691447_-	DUF2637 domain-containing protein	NA	Q6VY65	Streptomyces_phage	64.6	5.1e-79
WP_051779499.1|4691608_4692370_-	DUF3558 family protein	NA	NA	NA	NA	NA
WP_079407989.1|4692485_4693283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079405758.1|4693518_4694712_+	RtcB family protein	NA	A0A1I9SAD2	Rhodococcus_phage	58.6	8.7e-126
WP_079405759.1|4694791_4695598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079405760.1|4695807_4697304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405761.1|4697369_4698488_+	glycosyltransferase	NA	A0A1V0SAJ8	Catovirus	33.9	1.7e-46
WP_079405762.1|4698565_4699237_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_030388058.1|4699263_4700028_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_079405763.1|4700205_4700724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405764.1|4700720_4701449_-	Mut7-C ubiquitin/RNAse domain-containing protein	NA	NA	NA	NA	NA
WP_030388061.1|4701491_4701908_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079407990.1|4702042_4702939_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053703929.1|4702922_4703486_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107470206.1|4703554_4704283_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_079405765.1|4704608_4705151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405766.1|4705224_4705788_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_079405767.1|4705784_4707764_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_030388067.1|4707763_4708186_-	GPW/gp25 family protein	NA	A0A1D8KT65	Synechococcus_phage	30.8	1.7e-07
WP_030388068.1|4708185_4708503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079405768.1|4708554_4710372_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_030388070.1|4710368_4711094_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_030388071.1|4711202_4711628_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_079405769.1|4711662_4714890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030388072.1|4715049_4715553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030388073.1|4715549_4715990_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_030388074.1|4716031_4717591_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.1	3.4e-69
WP_079407992.1|4717763_4719797_-	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	31.7	4.0e-22
WP_079405770.1|4719889_4720594_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_079405771.1|4720590_4723773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078626516.1|4723983_4724667_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_079407993.1|4724871_4726230_+	hydrolytic protein	NA	NA	NA	NA	NA
WP_079405772.1|4726451_4726916_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_078626517.1|4726995_4727595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079405773.1|4727728_4729051_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_030388081.1|4729047_4729752_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_079407994.1|4729918_4731154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079405774.1|4731241_4731868_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_030388084.1|4731872_4732646_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_030388085.1|4732659_4734372_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_053177606.1|4734368_4735466_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_079405775.1|4735491_4735995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078626518.1|4736176_4736581_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107470025.1|4736669_4737104_+	cupin	NA	NA	NA	NA	NA
WP_030388090.1|4737155_4737452_-	membrane protein	NA	NA	NA	NA	NA
WP_030388091.1|4737542_4738997_+	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_079407995.1|4738975_4739470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107085048.1|4739469_4740390_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_079405777.1|4740401_4740998_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP020040	Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence	518852	22708	101058	518852	integrase,transposase	Gordonia_phage(14.29%)	38	21192:21218	61672:61698
21192:21218	attL	AACGTTCGTGGACAACGCACTAGCGGC	NA	NA	NA	NA
WP_079408254.1|22708_23857_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079408255.1|23894_24356_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	30.9	4.1e-07
WP_159395755.1|25953_26256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395756.1|27025_27175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395757.1|27404_28619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395758.1|31821_32115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408257.1|33046_33295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107470299.1|33291_33807_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_079408258.1|34294_35257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079408259.1|35469_36144_+	hypothetical protein	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	36.7	2.6e-26
WP_159395759.1|36480_36957_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_159395760.1|37724_38567_-	alpha/beta fold hydrolase	NA	A7XCB7	Tanapox_virus	32.8	1.8e-05
WP_159395761.1|39538_39814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408260.1|42176_43355_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159395762.1|44916_45714_-	helix-turn-helix domain-containing protein	NA	S5VXX4	Leptospira_phage	28.0	6.4e-16
WP_079408262.1|56836_57124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395763.1|57816_59034_-	plasmid partitioning protein	NA	NA	NA	NA	NA
WP_079408264.1|59030_60179_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.0	5.6e-05
WP_159395764.1|66573_66768_-	hypothetical protein	NA	NA	NA	NA	NA
61672:61698	attR	AACGTTCGTGGACAACGCACTAGCGGC	NA	NA	NA	NA
WP_159395765.1|66889_67147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408468.1|70199_70412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395766.1|72525_73026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395767.1|75844_76792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408267.1|76784_77681_-	ParA family protein	NA	Q8JL10	Natrialba_phage	25.7	4.7e-07
WP_159395768.1|79409_80030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408269.1|80144_80948_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.0	1.4e-50
WP_079408270.1|81215_81509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395769.1|82370_82745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395770.1|83967_84348_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_107470268.1|84610_84847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395771.1|87247_88075_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_079408274.1|89040_89442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107470331.1|89523_89646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395772.1|89680_90037_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079408470.1|90106_90895_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_159395773.1|92414_92780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107470271.1|96089_96746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395774.1|100515_101058_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020040	Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence	518852	126185	214318	518852	transposase	Mycobacterium_phage(38.46%)	52	NA	NA
WP_079408290.1|126185_127028_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079408473.1|127065_127284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408291.1|127495_128494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395785.1|129070_129325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408292.1|129366_129876_-	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_159395786.1|130070_130514_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_079408294.1|130513_131131_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.6	1.0e-13
WP_107470273.1|132743_133817_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.8	3.5e-33
WP_079408295.1|135004_135886_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079408297.1|139414_139753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408298.1|141402_142500_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_159395787.1|143057_144299_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395788.1|144971_145160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408299.1|145376_146432_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9FHH0	Rhodococcus_phage	30.3	8.5e-24
WP_159395789.1|146421_146892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408300.1|147255_147453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408301.1|147529_147778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408302.1|149799_150102_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	48.5	1.1e-13
WP_079408040.1|151553_152162_+	DDE endonuclease	NA	S5VXX4	Leptospira_phage	29.4	2.3e-05
WP_159395790.1|152244_152679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162500729.1|152894_153116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408304.1|154162_155323_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079408305.1|155793_156555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408306.1|157690_158911_+	MFS transporter	NA	NA	NA	NA	NA
WP_079408307.1|159477_159801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162500731.1|160855_161002_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_162500730.1|161191_161614_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079408476.1|162231_163047_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_162500732.1|163108_163901_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.7	1.0e-21
WP_079408309.1|166598_167258_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_107470275.1|167542_167974_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107470276.1|167808_168084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395791.1|169200_172146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408310.1|176582_177101_-	kinase	NA	NA	NA	NA	NA
WP_079408479.1|179923_180793_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_159395792.1|182978_183527_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079408314.1|183966_184542_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_079408480.1|187147_187798_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_079408315.1|189020_189896_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_159395793.1|189925_190561_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_107470277.1|191324_192141_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
WP_159395794.1|194657_194882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395795.1|195540_196038_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	27.9	1.3e-06
WP_079408481.1|199251_199431_-	hypothetical protein	NA	K4NXG4	Streptomyces_phage	47.7	3.3e-05
WP_159395796.1|201176_202037_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_079408321.1|202608_202959_-	WhiB family transcriptional regulator	NA	A0A222ZLH8	Mycobacterium_phage	46.8	3.0e-10
WP_030387191.1|203291_204347_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.4	5.7e-28
WP_079404404.1|204350_206141_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_079408323.1|208223_209450_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_079408483.1|211323_212106_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_107470277.1|212633_213450_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
WP_107470278.1|213501_214318_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	2.0e-20
>prophage 3
NZ_CP020040	Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence	518852	246428	313547	518852	transposase,integrase	Bacillus_phage(28.57%)	41	282155:282170	319307:319322
WP_107470277.1|246428_247245_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
WP_159395801.1|247482_248250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408337.1|250834_251374_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.2	5.6e-24
WP_159395802.1|252149_252449_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.1	6.3e-09
WP_079408339.1|252445_253669_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.8	4.0e-33
WP_079408340.1|253816_254020_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159395803.1|258121_265360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408342.1|267865_268276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395857.1|268259_269807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408486.1|270385_270799_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_107470281.1|271877_272198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395804.1|272411_272519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408343.1|272833_273163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395805.1|273338_273581_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395806.1|273658_274090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395807.1|274301_275390_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_079408345.1|275497_276802_-	MFS transporter	NA	NA	NA	NA	NA
WP_079408346.1|277061_277622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408347.1|277859_278372_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_159395808.1|280186_280342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395809.1|280458_280689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408348.1|281276_281699_+	hypothetical protein	NA	NA	NA	NA	NA
282155:282170	attL	GCCTACTGGGCCGACG	NA	NA	NA	NA
WP_079408349.1|283604_284273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395810.1|285058_287872_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_079408350.1|288228_290202_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	1.1e-13
WP_079408489.1|290513_291428_-	recombinase family protein	NA	NA	NA	NA	NA
WP_159395812.1|296188_296500_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395813.1|296540_296861_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079408354.1|297145_297850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408355.1|297846_298371_-	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_159395814.1|298560_299094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395815.1|300617_301934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408358.1|302906_303668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408490.1|303664_304918_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_079408359.1|305080_306076_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079408360.1|306676_307858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408361.1|309082_309262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395816.1|310393_312004_-	S8 family serine peptidase	NA	A0A2K9L5T6	Tupanvirus	35.6	2.6e-16
WP_159395817.1|312559_312988_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	33.6	1.5e-11
WP_159395818.1|313002_313179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408363.1|313184_313547_-|transposase	transposase	transposase	NA	NA	NA	NA
319307:319322	attR	GCCTACTGGGCCGACG	NA	NA	NA	NA
>prophage 4
NZ_CP020040	Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence	518852	331047	412985	518852	transposase,integrase	Mycobacterium_phage(20.0%)	50	371888:371902	413070:413084
WP_079408374.1|331047_331572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_107470277.1|331972_332789_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
WP_079408375.1|336237_337179_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079408376.1|337246_338248_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_079408377.1|338445_338661_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159395823.1|339206_340169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408378.1|340196_341240_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079408379.1|341409_342534_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_079408380.1|343364_349043_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.6	4.7e-177
WP_159395824.1|350296_351952_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.4	5.4e-25
WP_159395825.1|354408_355017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395778.1|355831_355987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408491.1|356089_357031_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5N3F9	Enterobacteria_phage	28.9	3.2e-14
WP_159395826.1|359478_360495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395827.1|361420_362041_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.7	1.2e-06
WP_079408385.1|361965_362505_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159395828.1|362714_362975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395829.1|365092_365734_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_079408388.1|365823_366534_-	transaldolase	NA	A0A0E3FGE1	Synechococcus_phage	27.1	6.5e-12
WP_079408389.1|366605_367844_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_159395830.1|367873_369010_-	MFS transporter	NA	NA	NA	NA	NA
WP_079408391.1|369405_370671_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	66.2	4.7e-146
WP_079408493.1|370827_371292_-	ATP-binding protein	NA	NA	NA	NA	NA
371888:371902	attL	CGGCCGAGCGGCGGT	NA	NA	NA	NA
WP_079408392.1|373523_373925_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107470289.1|375040_375920_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.8	5.4e-16
WP_079408393.1|376130_377285_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079405015.1|377514_378660_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079408495.1|380833_381703_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107470290.1|381994_383647_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_079408395.1|384311_384824_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_107470291.1|386480_387416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408396.1|388386_388773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395831.1|388904_389399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395832.1|389532_390036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408399.1|390080_390992_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159395833.1|390998_392042_-	cytochrome P450	NA	NA	NA	NA	NA
WP_159395834.1|392185_392491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395835.1|392630_393500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395836.1|393502_394669_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159395837.1|394661_395480_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_079408404.1|395493_396000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408405.1|395999_397004_-	thymidylate synthase	NA	G3MA60	Bacillus_virus	28.8	7.0e-28
WP_079408406.1|399523_399904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408407.1|399840_400320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395838.1|403733_405446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408408.1|405834_406044_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	41.5	5.0e-05
WP_107470292.1|407185_407452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408410.1|410075_410516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408411.1|410698_411757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408412.1|411851_412985_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
413070:413084	attR	ACCGCCGCTCGGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP020040	Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence	518852	429276	501669	518852	transposase	Mycobacterium_phage(37.5%)	40	NA	NA
WP_159395840.1|429276_429900_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_079408426.1|430216_431317_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	25.5	1.2e-09
WP_079408427.1|431662_432544_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079408428.1|432719_433076_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_159395841.1|433027_433408_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_079408429.1|433385_433682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107470277.1|437263_438080_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
WP_079408431.1|438536_438719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408432.1|438875_439436_+	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_159395842.1|439432_440092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408434.1|440655_442395_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_079408435.1|442409_443603_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_079408504.1|446475_447759_+	MFS transporter	NA	NA	NA	NA	NA
WP_159395843.1|448939_450670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395844.1|454725_455955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395845.1|456355_456766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395846.1|458055_458526_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079408439.1|459445_459637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408440.1|463325_464096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408441.1|465453_466653_+	ParA family protein	NA	NA	NA	NA	NA
WP_079408442.1|466649_467840_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	29.9	9.0e-06
WP_159395847.1|472894_473236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408506.1|473308_473836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408446.1|475695_477354_+	S8 family serine peptidase	NA	A0A2L0UZX3	Agrobacterium_phage	27.5	1.2e-11
WP_159395848.1|478439_478691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395849.1|478699_479053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408448.1|479226_479601_-	transcription factor	NA	NA	NA	NA	NA
WP_079408449.1|479597_481112_-	DNA primase	NA	A0A1D8EQ76	Mycobacterium_phage	42.8	7.2e-93
WP_079408450.1|481108_482215_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_159395850.1|485095_485602_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	39.0	2.7e-12
WP_159395851.1|488420_488618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408507.1|489342_490956_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	26.4	4.0e-17
WP_079408452.1|490966_491761_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_079408453.1|491826_492276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408454.1|492909_493500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395852.1|494902_495997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408508.1|497908_498439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408456.1|498738_499194_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_079408457.1|500195_500792_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_162500733.1|500875_501669_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	31.2	3.6e-19
>prophage 1
NZ_CP020041	Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence	240209	7221	66031	240209	transposase	Saccharomonospora_phage(75.0%)	39	NA	NA
WP_162500736.1|7221_8424_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_079408522.1|12745_13435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408523.1|13427_13955_-	SigE family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_079408524.1|15182_15476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079405015.1|15691_16837_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_107470308.1|16927_18181_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079408525.1|18466_19627_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_159395862.1|19740_19881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408526.1|20164_20947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408527.1|20949_21237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395863.1|21560_22205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408529.1|22541_24410_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	42.1	3.2e-90
WP_159395864.1|24406_25030_+	hypothetical protein	NA	I4AZM7	Saccharomonospora_phage	41.3	2.7e-22
WP_107470335.1|25196_26330_-	methyltransferase domain-containing protein	NA	I4AZP9	Saccharomonospora_phage	41.8	7.5e-10
WP_159395865.1|27154_27379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408532.1|27977_28250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162500734.1|28486_29191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408533.1|30255_30483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395866.1|32757_34113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107470310.1|35798_36230_+	hypothetical protein	NA	S5Z5E8	Mycobacterium_phage	54.3	1.2e-37
WP_079408536.1|36544_36940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408537.1|37971_38463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408538.1|38545_38941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408539.1|38946_39783_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079408540.1|39849_40269_-	RacP protein	NA	NA	NA	NA	NA
WP_079408541.1|40271_41270_-	RacO protein	NA	NA	NA	NA	NA
WP_159395867.1|42227_42398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408543.1|42511_42970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408544.1|43999_44212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408545.1|44844_45924_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_107470314.1|45916_47770_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_079408547.1|47778_49740_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_079408548.1|52036_53284_-	cytochrome P450	NA	NA	NA	NA	NA
WP_159395868.1|53349_54564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395869.1|55361_56399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408550.1|57211_57856_-	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_159395870.1|61842_62361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107470315.1|62612_63323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408648.1|64870_66031_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP020041	Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence	240209	88638	162765	240209	transposase	Mycobacterium_phage(22.22%)	57	NA	NA
WP_079408572.1|88638_89394_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_159395871.1|90892_91441_-	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
WP_079408574.1|91437_92832_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_079408575.1|92834_94211_-	cytochrome P450	NA	NA	NA	NA	NA
WP_079408576.1|94391_95546_-	glycine amidinotransferase	NA	D5GV78	Campylobacter_virus	31.0	2.8e-44
WP_079408652.1|97318_98188_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079408577.1|98362_98704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395872.1|98703_99153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408579.1|99776_100718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408580.1|100736_102911_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_079408581.1|102907_103369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395873.1|106249_107152_+	DUF1864 family protein	NA	NA	NA	NA	NA
WP_079408583.1|107148_108066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162500735.1|108155_108380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395874.1|108649_108901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162500737.1|109097_110063_-	C40 family peptidase	NA	A0A222YZS8	Streptomyces_phage	40.5	4.1e-25
WP_079408587.1|112638_115182_-	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	23.7	1.9e-21
WP_079408588.1|115196_115817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030387976.1|115813_116098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408589.1|116111_117224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408590.1|117220_117490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408591.1|117540_118476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395875.1|119317_119896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395876.1|120694_120850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408593.1|121704_122568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408594.1|123716_123911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395877.1|124056_124221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408654.1|124469_124673_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.3	2.1e-16
WP_107470318.1|126666_126888_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079408596.1|126814_128200_+	helicase	NA	NA	NA	NA	NA
WP_079408597.1|128209_128500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408598.1|128496_129756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408599.1|129906_131115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079408601.1|132997_134413_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079408602.1|135425_135776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408603.1|136781_138431_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_079408604.1|138479_139076_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_107470319.1|139154_139972_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.8	3.6e-22
WP_079408607.1|140011_140542_-	GTP cyclohydrolase	NA	S4VV34	Pandoravirus	40.0	1.4e-22
WP_159395878.1|140612_141008_-	VOC family protein	NA	NA	NA	NA	NA
WP_159395879.1|141041_141611_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_079408610.1|141828_142128_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107470320.1|142395_143331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159395880.1|144784_145483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408612.1|146338_146602_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079408613.1|146849_148241_-	hypothetical protein	NA	I4AZE5	Saccharomonospora_phage	32.6	4.5e-57
WP_159395881.1|148740_148830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395882.1|148842_148986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159395883.1|149783_150098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408614.1|150210_151185_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159395884.1|153483_154254_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159395885.1|155433_155658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408616.1|155896_157483_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.4	2.2e-23
WP_107470324.1|157857_158445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159395886.1|158809_159721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079408618.1|159717_161736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107470277.1|161947_162765_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.9	3.6e-22
