The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	24	62159	4929789	terminase,tail,portal,protease,tRNA,holin	Enterobacteria_phage(30.0%)	59	NA	NA
WP_079226141.1|24_528_+	DNA-binding protein	NA	U5P4K1	Shigella_phage	66.2	4.0e-56
WP_079222986.1|700_880_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	1.3e-14
WP_079222988.1|869_1736_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	87.8	1.9e-34
WP_079222990.1|1732_3052_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.3	8.1e-117
WP_003034741.1|3048_3435_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_001704138.1|3448_4132_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.0	3.0e-62
WP_079222992.1|4128_5124_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.3	2.7e-141
WP_079222995.1|5145_5799_+	antitermination protein	NA	NA	NA	NA	NA
WP_079222996.1|6028_6814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079222997.1|6908_7295_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	5.2e-56
WP_079222998.1|7281_7563_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	5.3e-18
WP_033816615.1|7562_8180_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	1.3e-93
WP_079222999.1|8176_8716_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	40.7	1.1e-06
WP_079223000.1|8745_8943_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	2.0e-27
WP_079223001.1|8999_9191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079223002.1|9513_10002_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	93.2	9.8e-76
WP_079223003.1|10001_12104_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	87.4	0.0e+00
WP_069324714.1|12100_12316_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	81.4	2.6e-25
WP_079223004.1|12312_13818_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.6	2.7e-257
WP_079223006.1|13762_15787_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.3	0.0e+00
WP_079226142.1|15878_16205_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	59.3	2.1e-29
WP_000933904.1|16197_16473_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	61.5	2.6e-25
WP_079223009.1|16485_17040_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	77.3	9.1e-62
WP_079223012.1|17036_17435_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	63.6	8.0e-44
WP_079223014.1|17442_18180_+|tail	phage tail protein	tail	O64327	Escherichia_phage	65.7	3.4e-88
WP_079223016.1|18216_18624_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	59.3	5.0e-25
WP_079223018.1|18632_18953_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	1.6e-34
WP_079223021.1|18930_21447_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.3	0.0e+00
WP_079223023.1|21450_21798_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	68.7	4.0e-39
WP_079223024.1|21794_22550_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.1	4.8e-130
WP_079223025.1|22551_23262_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	92.4	1.3e-137
WP_079223031.1|23291_23633_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	89.4	2.4e-52
WP_079223045.1|23676_24282_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	96.5	1.6e-99
WP_079223046.1|24335_27521_+	host specificity protein J	NA	O64335	Escherichia_phage	86.8	0.0e+00
WP_079223047.1|27520_27841_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	49.5	7.7e-21
WP_079223048.1|27840_28521_+	hypothetical protein	NA	T2DR06	Escherichia_virus	37.6	2.1e-28
WP_079223049.1|28580_29822_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.7	5.0e-108
WP_079223050.1|29955_30198_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	7.6e-29
WP_079223051.1|30275_30695_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	8.0e-34
WP_079223052.1|30696_31965_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.3	1.1e-203
WP_079223053.1|31957_32629_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.5e-79
WP_079223055.1|32954_33875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137361384.1|34479_35643_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_079223059.1|35650_37837_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.7	2.1e-16
WP_079223061.1|37833_39243_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_079223063.1|39313_50788_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_043017973.1|51356_51839_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	2.0e-28
WP_071888166.1|51981_52437_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_038642768.1|52420_52717_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003826401.1|52767_53112_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_079223065.1|53261_54923_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_042313284.1|55008_55887_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_038642760.1|56009_56603_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_154050530.1|56652_57942_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_042313291.1|57960_58752_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_006687321.1|58918_60280_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031228.1|60531_60780_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031230.1|60798_61347_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031232.1|61391_62159_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	568083	576503	4929789	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_079223478.1|568083_569031_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.5e-08
WP_079223481.1|569014_569746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|569726_569834_-	protein YohO	NA	NA	NA	NA	NA
WP_079223483.1|569885_570617_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.5	4.0e-105
WP_042307365.1|570842_572528_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.8	3.5e-282
WP_042307368.1|572524_573244_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_042307978.1|573290_573761_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	6.3e-64
WP_079223485.1|573805_574264_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.8e-51
WP_079223487.1|574469_576503_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
>prophage 3
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	612610	621726	4929789	protease,tRNA	Bacillus_phage(28.57%)	7	NA	NA
WP_042307417.1|612610_614557_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	4.8e-41
WP_003036813.1|614631_614856_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_079223508.1|615179_615500_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_042307424.1|615530_617807_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.1e-164
WP_042307426.1|618076_619438_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.4	2.8e-205
WP_043016895.1|619603_620326_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	7.1e-30
WP_061382035.1|620322_621726_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.5	2.0e-33
>prophage 4
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	663543	671807	4929789		Enterobacteria_phage(28.57%)	7	NA	NA
WP_079223547.1|663543_664929_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.5	2.3e-21
WP_079223549.1|665103_665997_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.1	9.6e-45
WP_079223551.1|666399_667680_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	23.0	4.2e-09
WP_079223553.1|667715_668747_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	45.5	3.7e-72
WP_079223555.1|668749_669838_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.7	2.2e-91
WP_079223557.1|669834_670704_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.2e-108
WP_079223559.1|670700_671807_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	23.8	4.0e-16
>prophage 5
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	874095	885304	4929789	integrase,holin,terminase,tail	Enterobacteria_phage(41.67%)	19	876310:876337	893544:893571
WP_038641397.1|874095_874326_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_038641395.1|874469_874844_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_061381113.1|874847_875717_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_042307834.1|875737_876076_+	YebY family protein	NA	NA	NA	NA	NA
876310:876337	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_079226154.1|876412_877462_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	66.9	3.1e-127
WP_079223723.1|877358_877928_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	92.2	3.5e-93
WP_079223724.1|877927_878134_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	75.8	5.6e-25
WP_079223726.1|878136_878745_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.2	1.6e-46
WP_016156248.1|878741_878879_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	88.4	9.2e-16
WP_079223728.1|878875_879556_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	1.6e-63
WP_079223729.1|879655_880108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079223735.1|880285_880564_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	96.7	2.8e-43
WP_079223736.1|880535_881084_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.0	7.1e-99
WP_079223737.1|881109_881490_-	VOC family protein	NA	NA	NA	NA	NA
WP_079223738.1|882022_882220_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	2.9e-26
WP_079223739.1|882303_882588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154050543.1|882882_883143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079226155.1|883171_883744_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	71.7	2.2e-63
WP_079223741.1|884710_885304_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.4	5.2e-79
893544:893571	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 6
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	1038373	1110390	4929789	integrase,capsid,terminase,tail,head,portal,protease	Enterobacteria_phage(44.68%)	79	1038357:1038372	1081906:1081921
1038357:1038372	attL	TTCTGCAAAACTGGTC	NA	NA	NA	NA
WP_079223861.1|1038373_1039501_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.1	7.5e-103
WP_044691230.1|1039493_1039727_-	excisionase	NA	NA	NA	NA	NA
WP_079223864.1|1039778_1042250_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.8	8.7e-112
WP_079226162.1|1042391_1042718_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_079223866.1|1043197_1043635_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	61.2	3.3e-38
WP_071698699.1|1043724_1043955_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	3.2e-21
WP_079223869.1|1043957_1044512_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.0	4.2e-14
WP_079223872.1|1044565_1045372_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	50.2	3.9e-61
WP_032943874.1|1045374_1046115_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	67.9	3.5e-93
WP_016150448.1|1046134_1046551_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079226163.1|1046556_1046895_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	45.7	3.9e-15
WP_079223874.1|1046891_1047194_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	70.5	2.5e-21
WP_079223876.1|1047195_1047615_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	74.1	3.2e-59
WP_079223877.1|1047611_1047791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223879.1|1047922_1048705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223880.1|1048829_1049030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032944444.1|1049281_1049515_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.7	6.2e-28
WP_079223882.1|1049560_1049806_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.7e-20
WP_079223884.1|1049934_1050135_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	6.1e-16
WP_154050547.1|1050137_1050497_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.7	3.7e-40
WP_079223886.1|1050493_1051534_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.0	1.8e-95
WP_079223888.1|1051548_1052127_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	1.2e-48
WP_079223889.1|1052274_1053414_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_079223891.1|1053417_1053918_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_079226165.1|1054157_1054346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016150433.1|1054498_1054777_+	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
WP_079223893.1|1054748_1055297_+	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	9.9e-101
WP_079223894.1|1055293_1055797_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	35.1	8.4e-06
WP_079223896.1|1055892_1056585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079223898.1|1056928_1057474_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	99.4	4.7e-95
WP_079223900.1|1057448_1059371_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.8	0.0e+00
WP_003034782.1|1059370_1059577_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_079223902.1|1059573_1061166_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.9	2.2e-289
WP_079223904.1|1061146_1062484_+	S49 family peptidase	NA	O64320	Escherichia_phage	83.2	6.8e-188
WP_003826193.1|1062493_1062826_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_003034798.1|1062893_1063919_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.7	1.9e-182
WP_048231661.1|1063964_1064369_+	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	53.7	2.1e-23
WP_048231663.1|1064380_1064734_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	76.1	9.0e-47
WP_079223906.1|1064743_1065298_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	90.8	6.1e-74
WP_079223908.1|1065294_1065693_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_048231668.1|1065700_1066438_+|tail	tail fiber protein	tail	O64327	Escherichia_phage	67.3	8.1e-90
WP_079223910.1|1066474_1066882_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	1.9e-24
WP_071524448.1|1066890_1067211_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_079223913.1|1067188_1069705_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.5	0.0e+00
WP_008322439.1|1069708_1070056_+	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_079223915.1|1070052_1070808_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.1	6.3e-130
WP_049001720.1|1070809_1071520_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.9	2.2e-137
WP_008784485.1|1071550_1071886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032941793.1|1071937_1072540_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	72.8	6.0e-75
WP_079223918.1|1072594_1076179_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	88.7	0.0e+00
WP_000497432.1|1078905_1079148_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_079223932.1|1079225_1079645_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	6.1e-34
WP_079223934.1|1079646_1080915_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.0	5.5e-203
WP_079223936.1|1080907_1081579_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.1e-80
WP_079223940.1|1081953_1083534_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
1081906:1081921	attR	TTCTGCAAAACTGGTC	NA	NA	NA	NA
WP_042308060.1|1084233_1084506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042308061.1|1084700_1086173_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.8	1.4e-16
WP_042308062.1|1086205_1087012_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_042308063.1|1087011_1088205_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_079226166.1|1088215_1089574_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.3e-37
WP_038640980.1|1089577_1091173_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.3	1.1e-51
WP_042308066.1|1091172_1092735_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_012905981.1|1092829_1092874_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_154050551.1|1092997_1093888_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_042308069.1|1093884_1094505_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_079223944.1|1095283_1095727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223946.1|1097491_1099210_-	abortive phage resistance protein	NA	NA	NA	NA	NA
WP_079223949.1|1099741_1100299_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.7	3.3e-27
WP_079223951.1|1100514_1100829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324549.1|1100838_1101186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046275908.1|1101357_1101582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223953.1|1101901_1102177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223955.1|1102346_1102850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324553.1|1103110_1103317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079223957.1|1105026_1106559_-	DUF3258 domain-containing protein	NA	NA	NA	NA	NA
WP_038640972.1|1106813_1107689_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_061381239.1|1107772_1108363_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_079223959.1|1108359_1109121_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_079223962.1|1109343_1110390_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 7
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	1564417	1574449	4929789	tRNA	Tupanvirus(28.57%)	10	NA	NA
WP_079224465.1|1564417_1565197_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	1.3e-10
WP_042308802.1|1565193_1566636_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.1	4.1e-53
WP_079224467.1|1566697_1567411_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042308806.1|1567729_1568194_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.4	1.0e-13
WP_079224470.1|1568271_1569021_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	23.9	5.1e-07
WP_042308809.1|1569020_1569572_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_079224472.1|1569632_1570613_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	1.1e-14
WP_003030571.1|1570758_1571058_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_079224474.1|1571062_1573450_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|1573465_1574449_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 8
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	1639527	1726022	4929789	capsid,integrase,terminase,tail,head,portal,tRNA,holin	Klebsiella_phage(28.57%)	104	1710581:1710599	1731809:1731827
WP_061381486.1|1639527_1640043_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_042308914.1|1640168_1640615_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_042308917.1|1640619_1641390_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042308919.1|1641489_1642677_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_042308921.1|1642714_1643422_-	CTP synthase	NA	NA	NA	NA	NA
WP_042308923.1|1643620_1643968_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_079224523.1|1643975_1644227_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_079224525.1|1644413_1645439_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.1	5.5e-12
WP_038640017.1|1645486_1645585_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_137349652.1|1645587_1645662_+	protein YoaJ	NA	NA	NA	NA	NA
WP_042308928.1|1645710_1645959_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_079224527.1|1646320_1648468_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_042308932.1|1648520_1649165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832433.1|1649385_1649568_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_061381493.1|1649571_1649934_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_079226177.1|1650107_1650746_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_079224529.1|1650885_1651536_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_042308939.1|1651624_1652215_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_079224531.1|1652198_1652993_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_061381496.1|1652986_1653799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_061381523.1|1653788_1654763_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_061381497.1|1654762_1656349_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042308947.1|1656778_1658866_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042309317.1|1659207_1659498_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	51.5	1.8e-21
WP_042308948.1|1659626_1659833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079224533.1|1659999_1661523_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_042308953.1|1661760_1662033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079224535.1|1662182_1662722_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	72.2	4.7e-39
WP_061381500.1|1662922_1663165_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	3.8e-28
WP_079224537.1|1663565_1664423_+	protein YibB	NA	NA	NA	NA	NA
WP_079224540.1|1664601_1665852_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
WP_079224543.1|1666053_1666677_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_042308976.1|1666686_1667148_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_061381741.1|1667201_1668308_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_042309320.1|1668342_1668984_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_016153410.1|1668987_1670358_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
WP_167371267.1|1670649_1670955_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	52.8	1.3e-17
WP_048241099.1|1671272_1671923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079224551.1|1672665_1674225_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_080700411.1|1674524_1674638_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	81.1	3.6e-10
WP_079224553.1|1674888_1675314_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	8.0e-50
WP_079224556.1|1675326_1676616_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.2	2.1e-165
WP_079224558.1|1676660_1676981_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	3.8e-20
WP_075146256.1|1677066_1677765_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	3.8e-89
WP_038641316.1|1678495_1679107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079224560.1|1679160_1679448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038641319.1|1679735_1680467_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_079224562.1|1681380_1681965_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	46.9	2.3e-47
WP_079224564.1|1681976_1683944_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	51.2	3.5e-23
WP_079224566.1|1683985_1687375_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	69.8	0.0e+00
WP_079224569.1|1687446_1688124_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	73.3	8.0e-76
WP_079224571.1|1688021_1688756_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.0	2.9e-116
WP_079224573.1|1688767_1689463_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	71.4	4.6e-95
WP_079224576.1|1689471_1689804_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	6.9e-41
WP_079224578.1|1689804_1693107_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	64.3	0.0e+00
WP_071993054.1|1693106_1693334_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	65.3	9.0e-24
WP_079224580.1|1693354_1693717_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.9	1.4e-26
WP_003832379.1|1693779_1694262_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	80.6	6.1e-62
WP_032943069.1|1694295_1694697_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	88.0	6.8e-59
WP_042309009.1|1694693_1695083_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	65.3	3.9e-43
WP_003832373.1|1695051_1695402_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	75.7	2.4e-44
WP_003832371.1|1695398_1695716_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
WP_044700565.1|1695696_1696074_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
WP_079224583.1|1696171_1697458_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	1.8e-209
WP_079224585.1|1697531_1698452_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.4	8.7e-134
WP_079224587.1|1698488_1699748_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.3	2.2e-220
WP_079224589.1|1699747_1699927_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	63.2	4.7e-12
WP_079224591.1|1699920_1701642_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	58.6	7.0e-193
WP_042309017.1|1701641_1702076_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.1	1.2e-29
WP_003841965.1|1702309_1702825_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.2	1.4e-32
WP_079224593.1|1702960_1703323_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	88.3	4.4e-57
WP_032943057.1|1703599_1704139_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	80.0	1.3e-44
WP_079224595.1|1704510_1704684_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000756041.1|1704888_1705119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079226178.1|1705192_1705381_-	cold-shock protein	NA	NA	NA	NA	NA
WP_079224597.1|1705391_1705604_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_079224599.1|1705995_1706139_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_079224601.1|1706176_1706374_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	87.7	8.3e-26
WP_000990801.1|1706764_1706995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079224603.1|1706991_1707507_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	30.5	5.6e-05
WP_079224606.1|1707503_1708052_-	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	7.6e-101
WP_079224608.1|1708023_1708302_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	97.8	1.6e-43
WP_044700587.1|1708455_1708644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079224612.1|1709523_1710159_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	73.8	5.3e-82
WP_154050578.1|1710155_1710515_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.9	6.8e-42
WP_044700593.1|1710517_1710718_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	1.2e-16
1710581:1710599	attL	GAACGCGCTGATCGTCCAG	NA	NA	NA	NA
WP_071681812.1|1710847_1711093_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
WP_038641360.1|1711138_1711372_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	87.0	3.7e-33
WP_079224614.1|1711659_1712751_-	permease	NA	NA	NA	NA	NA
WP_079224617.1|1712850_1713147_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038641366.1|1713214_1713640_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
WP_038641369.1|1713652_1714942_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
WP_079224619.1|1714988_1716740_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641374.1|1716757_1717120_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_038641375.1|1717167_1717521_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_079224621.1|1717644_1718316_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	1.3e-65
WP_079224625.1|1719265_1719820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032949519.1|1719822_1720038_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.3e-16
WP_032949520.1|1720139_1720529_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.8	3.5e-36
WP_071681809.1|1720914_1721229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038643238.1|1721514_1721841_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_079224627.1|1721982_1724454_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.6	5.6e-111
WP_003832298.1|1724520_1724736_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	54.9	1.7e-19
WP_048235615.1|1724735_1726022_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.4	5.5e-110
1731809:1731827	attR	CTGGACGATCAGCGCGTTC	NA	NA	NA	NA
>prophage 9
NZ_CP019986	Citrobacter werkmanii strain BF-6 chromosome, complete genome	4929789	4918769	4929425	4929789		Salmonella_phage(44.44%)	14	NA	NA
WP_079226132.1|4918769_4919816_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	42.3	4.8e-19
WP_079226133.1|4920377_4921289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079226134.1|4921293_4921620_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_079226135.1|4921630_4922248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079226136.1|4922239_4923412_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	2.6e-146
WP_065554929.1|4923617_4924187_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.8	5.6e-91
WP_079226137.1|4924516_4925065_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	70.6	7.2e-43
WP_079226138.1|4925294_4925882_-	hypothetical protein	NA	K7PLZ3	Enterobacterial_phage	84.3	9.7e-46
WP_049015418.1|4925878_4926133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253787.1|4926129_4926306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079226139.1|4926293_4926833_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.3	4.7e-79
WP_048241176.1|4926961_4927789_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.5	2.5e-140
WP_079226140.1|4927846_4928218_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	7.7e-57
WP_048217445.1|4928798_4929425_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.8	1.9e-47
