The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2035	22794	2990310	integrase,portal,terminase,protease	Enterococcus_phage(28.57%)	34	18575:18590	29767:29782
WP_002286523.1|2035_2347_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286527.1|4389_5076_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|5038_6217_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_060811415.1|6236_7931_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.8	7.9e-149
WP_002286538.1|7908_8223_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|8325_8607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045135985.1|8611_8956_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002340810.1|8981_9149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045135986.1|9185_9560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|9905_10319_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_002286693.1|10395_10692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286545.1|10688_11246_-	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_079200753.1|11242_11659_-	hypothetical protein	NA	A0A2H4J466	uncultured_Caudovirales_phage	34.7	4.2e-11
WP_002311440.1|11655_11829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809373.1|11825_12143_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	4.6e-10
WP_002311437.1|12142_12433_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_079200754.1|12426_12738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319167.1|12734_12896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317837.1|12910_13270_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_002323158.1|13266_14118_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_079200755.1|14133_14964_-	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	2.6e-52
WP_077974388.1|14966_15653_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_002286557.1|15658_16330_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|16322_16664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200756.1|16841_17540_-	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	34.6	1.3e-25
WP_002317844.1|17578_18157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060854001.1|18276_18456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317757.1|18460_18781_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
18575:18590	attL	TTTTTCGATATCGATA	NA	NA	NA	NA
WP_002290311.1|18796_19000_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074400049.1|19023_19761_-	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	41.9	4.5e-48
WP_074400050.1|20060_20381_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	35.1	6.5e-12
WP_010729101.1|20398_20821_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_045136055.1|20903_21539_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	52.6	5.1e-32
WP_002369335.1|21654_22794_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	46.8	2.6e-95
29767:29782	attR	TTTTTCGATATCGATA	NA	NA	NA	NA
>prophage 2
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	92465	100937	2990310		Streptococcus_phage(66.67%)	9	NA	NA
WP_079200757.1|92465_94655_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.4	3.1e-286
WP_077974401.1|94969_95572_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.0	4.9e-53
WP_002294035.1|95625_96747_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|96855_97728_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|97796_98144_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|98136_98961_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|98996_99935_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|99948_100278_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002294039.1|100292_100937_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 3
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	524175	590701	2990310	tRNA,transposase	unidentified_phage(30.77%)	59	NA	NA
WP_002294728.1|524175_524916_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_077974433.1|525106_525742_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|525888_527130_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002302657.1|527327_528326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302655.1|528338_530357_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002294735.1|530416_531133_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002294738.1|531359_531902_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002294740.1|531906_532134_-	cation transporter	NA	NA	NA	NA	NA
WP_002302653.1|532212_534093_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	2.2e-99
WP_002302651.1|534281_534896_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302649.1|535037_535598_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294754.1|538660_539224_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002292292.1|539238_540282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292291.1|540414_540819_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002312642.1|541051_541687_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002291912.1|541952_543005_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002291914.1|543017_543956_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002312640.1|544406_545057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296569.1|545156_545666_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002312639.1|545866_546736_-	ROK family protein	NA	NA	NA	NA	NA
WP_002317128.1|546755_547877_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_002312636.1|547878_548274_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002312634.1|548292_549090_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002312633.1|549091_549880_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312631.1|549893_550370_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002323457.1|550441_553099_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002317125.1|553117_553522_-	type I restriction-modification system subunit M N-terminal domain-containing protein	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.7e-15
WP_002313258.1|553753_554011_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_002324517.1|554135_554468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087043335.1|555000_556163_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_010706118.1|556231_556438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974435.1|556600_558235_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	28.8	8.2e-42
WP_002312624.1|558238_559612_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	23.4	1.1e-12
WP_002312623.1|559627_559867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323671.1|560048_562724_-	DUF927 domain-containing protein	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	28.0	2.5e-24
WP_002312619.1|562906_563830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974289.1|564273_565353_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002301399.1|565680_566640_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002312618.1|566810_567815_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002312617.1|567885_568182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296258.1|568174_568468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312616.1|568613_569165_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002312614.1|569338_569638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323668.1|569664_569973_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002312610.1|570089_571049_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002312609.1|571192_571969_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002298781.1|572066_572714_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002312607.1|572713_573544_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|573543_574293_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|574306_574771_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|574820_575282_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|575263_576238_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|576373_577333_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287852.1|583264_584665_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_002287851.1|584677_586189_-	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_002287847.1|587841_588417_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.5	4.4e-51
WP_014748620.1|588459_588657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287845.1|588998_589391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974289.1|589621_590701_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
>prophage 4
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	674429	731635	2990310	transposase	Bacillus_phage(21.43%)	54	NA	NA
WP_106914055.1|674429_675769_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	1.3e-77
WP_002289751.1|676283_676913_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_002289749.1|676996_677692_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289747.1|677704_678421_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002299254.1|678750_679359_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002289744.1|679683_680007_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002289277.1|680188_681559_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002302829.1|681688_682990_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002349198.1|683343_685302_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.0	1.6e-63
WP_002289280.1|685478_685745_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002297086.1|686254_688381_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289282.1|688568_688838_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002289284.1|689088_689652_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002294232.1|689904_690426_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002294234.1|690428_691271_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002297083.1|691263_691989_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002293448.1|692164_692461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297081.1|693028_694621_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002294240.1|694633_695374_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002294242.1|695541_696891_+	amino acid permease	NA	NA	NA	NA	NA
WP_002304052.1|697018_697609_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002326691.1|697844_698924_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_002294246.1|699144_700497_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000997695.1|700970_702149_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289815.1|702578_702953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289814.1|703069_703552_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289813.1|703603_704182_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289812.1|704210_705212_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_060806767.1|705224_705827_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002294252.1|705996_706443_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002294254.1|706519_707233_-	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002297133.1|707455_709444_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294256.1|709528_710089_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297134.1|710110_712219_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002297135.1|712236_714882_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002297137.1|714865_715279_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_002297139.1|715256_716054_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002294261.1|716461_717235_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297142.1|717254_717890_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002321201.1|717917_718769_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002294265.1|719030_719642_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002297145.1|719781_720321_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002297147.1|720395_720905_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_002297149.1|721284_722046_-	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	5.5e-17
WP_002290506.1|722042_722264_-	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002321200.1|722282_723869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294273.1|723868_724570_-	LrgB family protein	NA	NA	NA	NA	NA
WP_002297153.1|724562_724973_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002290500.1|725299_726034_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.4	1.4e-25
WP_000222572.1|726186_727140_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326835.1|727193_728150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|728274_729453_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002287917.1|729550_730009_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002296840.1|730447_731635_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 5
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	807974	834737	2990310	integrase	Streptococcus_phage(80.95%)	29	804930:804945	819832:819847
804930:804945	attL	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_002298578.1|807974_809540_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
WP_000237797.1|809607_810801_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|810827_811028_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845143.1|811525_811756_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000804879.1|811752_812175_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_001227350.1|812705_813059_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_032506803.1|813116_813305_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_001817446.1|813402_814443_-	hypothetical protein	NA	A0A1S5SF82	Streptococcus_phage	95.7	3.6e-192
WP_000868795.1|814804_815302_+	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_000163792.1|815373_817326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159903.1|817332_817569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002345019.1|817803_818607_-	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	98.9	6.0e-147
WP_001791010.1|818622_818739_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000584387.1|818983_819913_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
819832:819847	attR	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_000768373.1|819929_820952_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
WP_079200765.1|820948_822976_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.2	1.5e-194
WP_000331165.1|822972_825426_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000723887.1|825409_825805_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|825876_826515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870467.1|826570_827065_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000675717.1|827131_827911_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|827952_828174_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|828170_828461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|828457_829642_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_001130244.1|829823_831227_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000185761.1|831248_832022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|832031_832409_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|832429_832744_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_000181735.1|832943_834737_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
>prophage 6
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	998427	1010188	2990310		Streptococcus_phage(88.89%)	10	NA	NA
WP_002297345.1|998427_999339_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
WP_002297346.1|999357_1000362_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297347.1|1000358_1002482_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_010729283.1|1002486_1004934_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297349.1|1004920_1005310_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297350.1|1005369_1005873_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_033658092.1|1005885_1006110_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002286940.1|1006213_1008124_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002317225.1|1008869_1009007_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002297353.1|1009003_1010188_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
>prophage 7
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	1294990	1353316	2990310	tRNA,transposase,bacteriocin	Bacillus_virus(18.18%)	57	NA	NA
WP_002323245.1|1294990_1296163_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002296384.1|1296613_1297012_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_002296623.1|1297125_1298421_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002288948.1|1298854_1299508_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_002288958.1|1299733_1300732_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_002288947.1|1300907_1302716_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002289850.1|1302794_1303472_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289849.1|1303589_1304165_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289848.1|1304295_1305000_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|1304977_1305775_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|1305776_1306676_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|1306693_1308055_+	magnesium transporter	NA	NA	NA	NA	NA
WP_079200769.1|1308116_1308758_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|1308866_1309733_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289592.1|1309953_1310457_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002294557.1|1310505_1311165_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289594.1|1311184_1313773_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|1313875_1314103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303134.1|1314212_1314806_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289599.1|1314837_1315917_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_077974289.1|1318197_1319277_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002303131.1|1319496_1320669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002303130.1|1320767_1321733_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|1322329_1322833_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|1322888_1323533_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|1323694_1323847_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|1323870_1324041_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|1324141_1324687_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002289897.1|1324745_1325651_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294583.1|1325823_1326843_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_002294584.1|1326933_1327806_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|1327818_1328487_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|1328829_1329252_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|1329355_1330045_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|1330454_1330958_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|1331010_1331379_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002294589.1|1331484_1332174_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002303471.1|1332255_1333458_+	MFS transporter	NA	NA	NA	NA	NA
WP_002290558.1|1333648_1335181_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|1335414_1336116_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|1336369_1337083_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002294593.1|1337391_1338531_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_079200770.1|1338619_1339585_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	4.4e-128
WP_002303469.1|1339634_1341794_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.0	2.5e-264
WP_002287795.1|1341952_1342177_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|1342577_1343051_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|1343047_1345180_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|1345181_1345316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|1345409_1346054_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|1346240_1347434_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|1347426_1349154_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002304799.1|1349547_1349745_+	enterocin	NA	NA	NA	NA	NA
WP_002305452.1|1349746_1350058_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002294600.1|1350161_1350308_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002348775.1|1350383_1351631_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002294602.1|1351645_1352398_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002294603.1|1353100_1353316_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 8
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	1415312	1474128	2990310	portal,holin,integrase,terminase,capsid,head,transposase,protease,tail	Enterococcus_phage(26.83%)	77	1429351:1429369	1471024:1471042
WP_049142676.1|1415312_1416482_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.2	2.5e-32
WP_002322652.1|1417055_1417625_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294132.1|1417611_1418472_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002288850.1|1418661_1419366_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294131.1|1419370_1421206_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288852.1|1421202_1422519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288853.1|1422519_1423389_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_002288854.1|1423443_1424253_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002303461.1|1424355_1424985_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002303458.1|1425154_1426447_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288860.1|1426522_1427185_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288862.1|1427409_1427694_+	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002290607.1|1427744_1429370_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	4.9e-156
1429351:1429369	attL	TGATGGGCGGTATGATGTA	NA	NA	NA	NA
WP_079200772.1|1429458_1430607_-|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	48.4	6.7e-91
WP_002286584.1|1430708_1431293_-	DUF4352 domain-containing protein	NA	A8ASM1	Listeria_phage	42.3	1.2e-16
WP_002286582.1|1431419_1431851_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_079200773.1|1431868_1432189_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	38.3	2.9e-12
WP_002286578.1|1432488_1432629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286679.1|1432926_1433184_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_002286674.1|1433154_1433463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200774.1|1433540_1434278_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	51.0	6.7e-60
WP_002290311.1|1434301_1434505_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002317757.1|1434520_1434841_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_060854001.1|1434845_1435025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317844.1|1435144_1435723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200756.1|1435761_1436460_+	ORF6C domain-containing protein	NA	D2IYT0	Enterococcus_phage	34.6	1.3e-25
WP_002286559.1|1436637_1436979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|1436971_1437643_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_077974388.1|1437648_1438335_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_079200755.1|1438337_1439168_+	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	2.6e-52
WP_002323158.1|1439183_1440035_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002317837.1|1440031_1440391_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_002319167.1|1440405_1440567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200754.1|1440563_1440875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311437.1|1440868_1441159_+	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_060809373.1|1441158_1441476_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	4.6e-10
WP_002311440.1|1441472_1441646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200753.1|1441642_1442059_+	hypothetical protein	NA	A0A2H4J466	uncultured_Caudovirales_phage	34.7	4.2e-11
WP_002286545.1|1442055_1442613_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|1442609_1442906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|1442982_1443396_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_045135986.1|1443741_1444116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340810.1|1444152_1444320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045135985.1|1444345_1444690_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|1444694_1444976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|1445078_1445393_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_060811415.1|1445370_1447065_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.8	7.9e-149
WP_002286530.1|1447084_1448263_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|1448225_1448912_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_079200775.1|1448911_1450072_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	8.0e-100
WP_073466483.1|1450081_1450957_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	73.9	1.6e-129
WP_002286523.1|1450953_1451265_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|1451254_1451608_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|1451597_1451999_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|1451991_1452396_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|1452407_1453016_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|1453035_1453398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|1453400_1453583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045135983.1|1453599_1457019_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002286500.1|1457069_1457807_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_045135982.1|1457816_1460108_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.1	1.3e-90
WP_077974334.1|1460131_1462222_+	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	50.0	2.8e-87
WP_002290627.1|1462238_1462388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|1462384_1462831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1462832_1462970_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|1463007_1463301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|1463297_1463522_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|1463518_1464544_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|1465483_1466645_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|1467568_1467976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1467989_1468391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1468392_1468764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|1468837_1470139_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002330703.1|1470300_1470600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293622.1|1470614_1470836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1471329_1472625_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
1471024:1471042	attR	TGATGGGCGGTATGATGTA	NA	NA	NA	NA
WP_002323245.1|1472955_1474128_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
>prophage 9
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	1591272	1713362	2990310	portal,integrase,terminase,capsid,transposase,head,tRNA,tail	Streptococcus_phage(13.33%)	114	1699623:1699649	1714431:1714457
WP_002297404.1|1591272_1592523_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287122.1|1592932_1593814_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002294021.1|1594113_1594491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287124.1|1595096_1595711_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294022.1|1596483_1598223_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287126.1|1598379_1599564_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002287127.1|1599674_1599878_+	CsbD family protein	NA	NA	NA	NA	NA
WP_002287128.1|1599978_1600641_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_002287129.1|1600653_1602156_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287130.1|1602703_1604383_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002287132.1|1604509_1604989_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287133.1|1605207_1605888_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287134.1|1605895_1607227_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287135.1|1607241_1608204_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002287137.1|1608314_1608653_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287139.1|1608731_1609439_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|1609685_1610981_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_077974461.1|1611125_1612421_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002287140.1|1612585_1614067_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287143.1|1614375_1614912_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287145.1|1614989_1616360_+	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002287147.1|1616426_1616762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305494.1|1616842_1617700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002287154.1|1617806_1618322_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002287155.1|1618638_1620024_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002287156.1|1620060_1620738_+	YutD family protein	NA	NA	NA	NA	NA
WP_002287159.1|1620745_1621510_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287161.1|1621511_1622171_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287163.1|1622200_1622710_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002287165.1|1622821_1623820_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002287167.1|1624020_1624605_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002311494.1|1624681_1625875_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287231.1|1625938_1626319_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287172.1|1626392_1626755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1632753_1634049_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_086956687.1|1634450_1635613_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287966.1|1635821_1636196_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287965.1|1636309_1636939_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002296289.1|1637569_1637734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294080.1|1638028_1639357_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|1639558_1640392_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002287962.1|1640407_1641145_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|1641299_1642268_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|1642499_1643333_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|1643366_1644206_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|1644231_1644792_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|1644990_1646712_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|1646876_1648019_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287955.1|1648034_1649246_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|1649818_1650466_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|1650858_1653504_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|1653813_1655127_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|1655116_1655770_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002300186.1|1656506_1657592_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	1.2e-12
WP_002300187.1|1657588_1659481_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000361059.1|1659487_1659865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000067268.1|1660018_1660801_+	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_001072201.1|1660926_1661658_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_001092058.1|1662166_1662829_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002294067.1|1663356_1663557_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|1663810_1665490_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|1665491_1665704_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|1666096_1667827_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|1667823_1669584_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|1669678_1669876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|1670028_1670514_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|1670617_1671211_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|1671390_1671918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|1672008_1672746_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|1672749_1673667_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|1673668_1674898_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|1674931_1675885_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|1676535_1678149_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296511.1|1678289_1679198_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|1679380_1680505_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287756.1|1680529_1680709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287755.1|1680731_1681649_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287754.1|1681641_1682475_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|1682557_1683676_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002321415.1|1683669_1685568_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|1685561_1686785_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002287747.1|1686870_1688805_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|1689030_1689687_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|1689760_1690114_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|1690305_1691235_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|1691245_1692082_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287742.1|1692329_1693106_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287741.1|1693281_1694025_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|1694017_1695598_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|1695848_1696328_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289867.1|1696343_1697096_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296505.1|1697643_1698369_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002290885.1|1698623_1698890_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296503.1|1698886_1699318_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290887.1|1699342_1699648_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
1699623:1699649	attL	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
WP_002296502.1|1699728_1700874_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002296501.1|1700934_1701582_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296500.1|1701775_1702069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|1702112_1702424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296496.1|1703185_1703344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296495.1|1703344_1703707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296494.1|1703743_1704592_+	bifunctional DNA primase/polymerase	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296493.1|1704581_1706057_+	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296492.1|1706322_1706730_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296491.1|1706732_1706948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304527.1|1706951_1707332_+	HNH endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296489.1|1707465_1707621_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296488.1|1707689_1708163_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296487.1|1708159_1709854_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002317249.1|1709819_1710005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296486.1|1710008_1711184_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002296485.1|1711176_1712700_+|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296484.1|1712755_1713040_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296483.1|1713026_1713362_+|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
1714431:1714457	attR	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
>prophage 10
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	1826137	1874904	2990310	holin,tRNA,transposase,bacteriocin	Bacillus_phage(33.33%)	43	NA	NA
WP_002289566.1|1826137_1826488_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002289568.1|1826654_1827593_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289570.1|1827607_1828438_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002296128.1|1828481_1829507_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289574.1|1829521_1830460_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002289575.1|1830584_1831025_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002296133.1|1831027_1831630_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002296134.1|1831688_1832795_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002291653.1|1833004_1834006_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_002296135.1|1834342_1836688_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002296136.1|1836966_1837869_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.0	1.5e-21
WP_002294959.1|1838081_1839857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296138.1|1839922_1841509_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002294955.1|1841759_1841984_+	YneF family protein	NA	NA	NA	NA	NA
WP_002296139.1|1842125_1843877_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	8.2e-56
WP_002296141.1|1843876_1845661_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	7.8e-46
WP_002296142.1|1845986_1846838_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002311278.1|1846891_1848643_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296145.1|1848646_1848817_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296146.1|1848856_1849759_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296147.1|1849989_1851393_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296149.1|1851392_1852826_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296150.1|1852970_1853897_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002296152.1|1854110_1855838_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.6	3.3e-211
WP_002321425.1|1855852_1856203_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296156.1|1856294_1857155_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002287322.1|1857246_1857675_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002287321.1|1857836_1858013_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287318.1|1858039_1858486_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002296157.1|1858639_1860019_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002291698.1|1860724_1861696_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002296158.1|1861719_1863912_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002288749.1|1863928_1864405_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002301250.1|1864388_1864784_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002288753.1|1864798_1865698_+	GTPase Era	NA	NA	NA	NA	NA
WP_002296160.1|1865840_1866653_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002296161.1|1867036_1867954_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002296162.1|1867955_1870031_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002297218.1|1870154_1871450_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_000997695.1|1871997_1873176_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296753.1|1873407_1873611_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002296756.1|1873610_1873961_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_077974298.1|1873995_1874904_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	1894535	2016482	2990310	tRNA,transposase,protease	Streptococcus_phage(29.41%)	109	NA	NA
WP_002297179.1|1894535_1895474_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	3.6e-10
WP_077974463.1|1898314_1898431_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002337813.1|1898632_1899586_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002347297.1|1899509_1900178_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317192.1|1900319_1901252_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002317191.1|1901233_1902697_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002294893.1|1902693_1903152_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311310.1|1903148_1904123_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311311.1|1904563_1905292_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311312.1|1905309_1906506_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311313.1|1906498_1907494_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311314.1|1907490_1908432_+	hexose kinase	NA	NA	NA	NA	NA
WP_002311317.1|1909099_1909990_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002311319.1|1909976_1910786_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311321.1|1910799_1911201_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317189.1|1911246_1912197_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|1912756_1913032_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|1913139_1913904_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002296302.1|1914026_1914530_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002296301.1|1914938_1915580_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296300.1|1915749_1917018_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296299.1|1917044_1918244_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296298.1|1918364_1919672_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002294874.1|1920142_1921261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296295.1|1921763_1922084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|1922536_1922737_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002288763.1|1922883_1925673_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002321579.1|1925719_1926247_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002296294.1|1926267_1927458_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|1927497_1928796_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002288769.1|1929971_1930646_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002319756.1|1930642_1930984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|1931013_1931373_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|1931865_1933161_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296577.1|1933419_1935504_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_077974307.1|1935794_1937261_+	amino acid permease	NA	NA	NA	NA	NA
WP_079200778.1|1937731_1939027_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.5	5.0e-10
WP_002289037.1|1939274_1939814_+	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002289038.1|1939887_1940328_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|1940340_1940550_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289041.1|1940549_1942736_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
WP_002296533.1|1942755_1944927_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_079200779.1|1947199_1948141_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002304700.1|1948285_1949134_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|1949487_1950300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|1950453_1950777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|1950850_1951420_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_077974309.1|1951856_1952549_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	5.2e-30
WP_086953915.1|1952588_1953928_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|1954097_1955276_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002305693.1|1956985_1957417_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|1957648_1957906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|1958191_1959442_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|1959851_1960826_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002347285.1|1960981_1962277_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289617.1|1962563_1962824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|1963185_1963425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1963710_1964025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|1964995_1965769_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|1965912_1966263_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002293942.1|1966243_1966960_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|1966959_1968408_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|1968477_1968987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297641.1|1968976_1969702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002333083.1|1969924_1972045_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	1.7e-220
WP_002322842.1|1972274_1973453_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326253.1|1973468_1974227_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002288577.1|1974249_1974735_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|1974805_1976059_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|1976176_1977526_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|1977637_1978984_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|1979291_1979678_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002288571.1|1979901_1981347_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_002311774.1|1982401_1983361_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002293931.1|1983613_1983763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297633.1|1984224_1984437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|1984714_1986514_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|1986637_1987234_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002325884.1|1987425_1988379_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|1988650_1988995_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|1988995_1989415_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1989506_1989857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021415240.1|1989822_1991043_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|1991408_1991975_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997695.1|1993219_1994398_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296918.1|1995025_1996471_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	1.5e-124
WP_002288533.1|1996745_1998641_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288531.1|1998835_1999282_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|1999509_1999659_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|1999746_2000265_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|2000341_2001298_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|2001463_2002270_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002320813.1|2002266_2003256_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002296124.1|2003252_2004257_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|2004388_2004931_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|2004950_2005649_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002293902.1|2005669_2005882_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|2005881_2006844_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|2006861_2007257_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|2007419_2007785_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288458.1|2007781_2009593_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|2009654_2009822_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|2010069_2011059_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|2011070_2012555_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|2012578_2013559_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288447.1|2013647_2014472_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|2014455_2014998_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|2015004_2015469_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288444.1|2015465_2016482_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
>prophage 12
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2149369	2195489	2990310	tRNA,transposase,integrase	Streptococcus_phage(23.08%)	41	2168314:2168331	2204537:2204554
WP_002297404.1|2149369_2150620_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296405.1|2151574_2152516_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296404.1|2152584_2153316_+	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296403.1|2153459_2155640_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296402.1|2155659_2156142_+	SprT family protein	NA	NA	NA	NA	NA
WP_002296401.1|2156157_2156919_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296400.1|2157049_2158384_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002296398.1|2158811_2159297_+	dehydratase	NA	NA	NA	NA	NA
WP_002296397.1|2159289_2159973_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002303538.1|2160098_2162744_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002288323.1|2162788_2163625_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002288324.1|2163588_2164218_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002303537.1|2164269_2164602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288327.1|2164913_2165405_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288329.1|2165427_2166801_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_002288331.1|2166800_2167727_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288333.1|2167855_2168296_+	lipoprotein	NA	NA	NA	NA	NA
2168314:2168331	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002297218.1|2168461_2169757_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288335.1|2169961_2170663_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|2170659_2171781_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|2171795_2173028_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|2173159_2174068_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|2174102_2174375_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|2174385_2175432_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002301554.1|2175682_2178292_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002321495.1|2178442_2179129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|2179106_2179601_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|2179620_2180841_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|2180987_2182823_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|2182916_2184044_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|2184100_2185054_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079200781.1|2185209_2186388_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289415.1|2187438_2187852_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|2188307_2188793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|2188931_2189147_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002346994.1|2189370_2190171_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.6	3.4e-09
WP_002289421.1|2190189_2192058_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|2192050_2192542_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|2192529_2193084_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|2193101_2194097_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002297404.1|2194238_2195489_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
2204537:2204554	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 13
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2400585	2447730	2990310	tRNA,transposase	Lysinibacillus_phage(14.29%)	40	NA	NA
WP_002297185.1|2400585_2401881_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295819.1|2401989_2402877_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_016171142.1|2403058_2404012_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295818.1|2404189_2406187_-	transketolase	NA	NA	NA	NA	NA
WP_002295816.1|2406288_2406540_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_002296572.1|2406686_2407310_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.2e-16
WP_002287525.1|2407631_2408780_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|2408796_2409201_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002297436.1|2409380_2409599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295813.1|2409887_2410400_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002296571.1|2410413_2412711_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002303793.1|2412852_2413296_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296573.1|2413296_2414085_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002295809.1|2414081_2415023_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_002295807.1|2415199_2415787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303792.1|2416007_2417315_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002289734.1|2417608_2418619_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289735.1|2418703_2419639_-	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002303791.1|2419824_2420784_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002295800.1|2420869_2421964_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002296283.1|2422152_2422914_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295797.1|2423028_2423469_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002295795.1|2423688_2424444_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002296282.1|2424553_2425567_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295791.1|2425731_2426652_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002295789.1|2426931_2427432_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002288030.1|2427538_2428057_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002296875.1|2428057_2429413_-	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002317207.1|2429415_2430237_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002296876.1|2430398_2431055_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288038.1|2431070_2431718_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288041.1|2431730_2432546_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002296877.1|2432559_2433297_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288045.1|2433550_2434561_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296881.1|2434730_2437151_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002295783.1|2437155_2438199_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002303789.1|2438507_2438849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296885.1|2438917_2442640_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002296887.1|2442636_2446164_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_002297218.1|2446434_2447730_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 14
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2511945	2521006	2990310		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|2511945_2512524_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002288011.1|2512520_2513573_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|2513595_2515035_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|2515019_2517242_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|2517242_2517914_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|2517915_2518170_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|2518169_2518898_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|2519153_2519531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|2519710_2521006_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 15
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2581259	2635227	2990310	tRNA,transposase,protease	Streptococcus_phage(15.0%)	51	NA	NA
WP_002288421.1|2581259_2582660_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002288419.1|2582673_2583222_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002287107.1|2583631_2584882_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288415.1|2585041_2585947_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_086953915.1|2587257_2588597_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002320953.1|2589085_2590462_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288411.1|2590430_2592509_-	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002303743.1|2592630_2593488_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002296990.1|2593543_2594311_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002296988.1|2594303_2595164_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002288405.1|2595423_2595822_+	VOC family protein	NA	NA	NA	NA	NA
WP_002320949.1|2596100_2596601_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002294418.1|2596683_2597235_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002288398.1|2597386_2597614_-	YozE family protein	NA	NA	NA	NA	NA
WP_002288397.1|2597610_2598129_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288396.1|2598148_2598862_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002288395.1|2598864_2599761_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288394.1|2599918_2600761_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288393.1|2600892_2601546_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288392.1|2601608_2602136_-	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002294416.1|2602155_2603103_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288390.1|2603114_2605001_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002324658.1|2605165_2607238_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002290188.1|2607250_2607526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|2607920_2609216_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290187.1|2609409_2609865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294414.1|2610018_2611227_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290045.1|2611338_2611671_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294412.1|2611818_2612694_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002289878.1|2612775_2613357_-	YpiB family protein	NA	NA	NA	NA	NA
WP_002289879.1|2613362_2614622_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002294410.1|2614623_2615670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290178.1|2615904_2616180_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_002296982.1|2616422_2617733_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002294406.1|2617914_2619144_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002303123.1|2619278_2619959_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294404.1|2620007_2620643_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303122.1|2620708_2622112_-	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002305295.1|2622098_2623130_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294401.1|2623160_2623382_+	ferredoxin	NA	NA	NA	NA	NA
WP_002294400.1|2623546_2624284_-	thioesterase	NA	NA	NA	NA	NA
WP_002294399.1|2624436_2625777_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002290168.1|2626013_2627537_-	YfcC family protein	NA	NA	NA	NA	NA
WP_002296977.1|2627914_2628526_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002294391.1|2628855_2629572_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296975.1|2629577_2630147_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002305297.1|2630130_2630928_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002294387.1|2630897_2631269_-	protein RibT	NA	NA	NA	NA	NA
WP_002294386.1|2631287_2632175_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002302440.1|2632493_2633795_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297218.1|2633931_2635227_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 16
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2658583	2732348	2990310	transposase	Lysinibacillus_phage(20.0%)	60	NA	NA
WP_077974289.1|2658583_2659663_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002289270.1|2659864_2661019_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002289269.1|2661040_2661793_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002294372.1|2662156_2664823_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-82
WP_002289473.1|2665163_2666615_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002289472.1|2666943_2667759_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002289474.1|2668052_2668328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|2668754_2669210_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289470.1|2669289_2670039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289468.1|2670039_2670366_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289467.1|2670513_2670954_-	universal stress protein	NA	NA	NA	NA	NA
WP_002296967.1|2671034_2672432_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_079200783.1|2672584_2673856_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296966.1|2673982_2674702_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288275.1|2675079_2676054_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002288276.1|2676106_2676712_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288278.1|2676805_2677558_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_002288318.1|2677571_2677832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288281.1|2677853_2679215_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288285.1|2679287_2679587_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|2679996_2681247_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291790.1|2681389_2681722_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297183.1|2681721_2683584_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_079200784.1|2683808_2684762_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|2684988_2686167_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289063.1|2686374_2686569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289065.1|2686837_2687137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289050.1|2687233_2687668_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002295327.1|2687899_2688610_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002289048.1|2688599_2689460_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002288832.1|2689464_2690103_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002288830.1|2690117_2690417_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303570.1|2690459_2691944_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295331.1|2691963_2692425_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288825.1|2692442_2693510_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002288823.1|2693727_2694498_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288821.1|2694770_2695598_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288819.1|2696165_2697401_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002295336.1|2698399_2698660_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002288817.1|2698686_2699988_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288815.1|2700279_2700738_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288813.1|2700750_2702082_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_002348871.1|2702092_2703535_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002288811.1|2703521_2704286_-	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_002288809.1|2704389_2705265_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002298265.1|2712768_2714274_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.1	3.9e-06
WP_002290973.1|2714270_2714957_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	4.8e-28
WP_002295350.1|2715149_2716571_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	31.1	4.2e-34
WP_002297185.1|2716797_2718093_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_060799217.1|2718262_2718442_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002295352.1|2718499_2719069_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002295354.1|2719254_2720157_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295355.1|2720191_2721976_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002304759.1|2722049_2723012_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002303521.1|2723179_2726494_-	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002295359.1|2726724_2726910_+	YjzD family protein	NA	NA	NA	NA	NA
WP_077974372.1|2726971_2728168_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295362.1|2728337_2729774_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002296740.1|2730066_2730876_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297218.1|2731052_2732348_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 17
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2764401	2869785	2990310	integrase,transposase,protease	Streptococcus_phage(46.88%)	96	2811325:2811341	2862633:2862649
WP_002302440.1|2764401_2765703_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287603.1|2765868_2767596_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	35.9	9.3e-20
WP_002287602.1|2767595_2767862_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002287598.1|2768340_2770575_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|2770722_2771043_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002295394.1|2771668_2773249_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|2773649_2775026_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|2775153_2776272_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002297185.1|2776784_2778080_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290817.1|2778447_2778981_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|2779074_2780253_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|2780245_2781043_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|2781149_2782532_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|2782705_2783284_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_077495118.1|2783605_2784076_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|2784183_2785410_-	LCP family protein	NA	NA	NA	NA	NA
WP_002292860.1|2786163_2786364_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|2786497_2787106_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|2787190_2787661_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|2787708_2788623_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|2788768_2789572_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|2789749_2790697_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002289149.1|2790764_2791058_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|2791085_2791751_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|2791890_2792523_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|2792529_2793597_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|2793593_2794325_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|2794493_2794973_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|2795108_2796284_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|2796487_2797657_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002349576.1|2797923_2799558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287760.1|2800692_2801646_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|2802138_2803434_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_079200785.1|2803656_2804952_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_079200786.1|2805136_2806432_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289618.1|2806556_2807054_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_077974323.1|2807183_2807894_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002297645.1|2807906_2809571_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_077974320.1|2809778_2810441_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_010721620.1|2810450_2811266_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
2811325:2811341	attL	TCTTCATTTCTTTGTAA	NA	NA	NA	NA
WP_016631212.1|2811526_2811970_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002302962.1|2812429_2812807_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010721617.1|2813030_2814224_+	MFS transporter	NA	NA	NA	NA	NA
WP_010721616.1|2814389_2814812_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010721943.1|2815394_2815889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010721614.1|2816050_2817223_-	class C sortase	NA	NA	NA	NA	NA
WP_002288981.1|2817428_2818244_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288979.1|2818393_2818840_-	cell wall anchor	NA	NA	NA	NA	NA
WP_158003446.1|2818836_2819841_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002352916.1|2819880_2820210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305732.1|2820335_2822663_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|2823505_2823799_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_079200787.1|2824201_2825380_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|2825483_2825798_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077974317.1|2825904_2826123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|2826664_2828212_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|2828313_2828667_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|2828656_2828851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289210.1|2829339_2829714_-	VOC family protein	NA	NA	NA	NA	NA
WP_002296814.1|2829736_2831137_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289214.1|2831140_2831551_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289215.1|2831568_2832060_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289216.1|2832069_2832861_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289217.1|2832853_2833627_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289218.1|2833782_2836317_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002289219.1|2836397_2837270_-	ROK family protein	NA	NA	NA	NA	NA
WP_002289220.1|2837305_2837773_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289221.1|2837782_2839252_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296810.1|2839322_2840741_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002296809.1|2840862_2841843_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|2842122_2843285_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|2843377_2843887_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002343922.1|2844225_2845179_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|2845131_2845368_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289051.1|2845787_2846909_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|2847236_2848646_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|2848642_2849371_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|2849498_2850410_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|2850426_2851434_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289059.1|2851430_2853560_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002296840.1|2853860_2855048_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002321772.1|2855140_2857486_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002288938.1|2857472_2857862_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002297208.1|2857911_2858808_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|2858810_2860658_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|2860754_2861255_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_033657400.1|2861267_2861492_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002286940.1|2861595_2863506_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
2862633:2862649	attR	TCTTCATTTCTTTGTAA	NA	NA	NA	NA
WP_002305703.1|2864251_2864389_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|2864385_2865570_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|2865825_2866080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|2866104_2867247_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286930.1|2867306_2868659_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286928.1|2868729_2869074_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286926.1|2869083_2869458_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|2869470_2869785_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
>prophage 18
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2878440	2917859	2990310	portal,holin,integrase,terminase,capsid,head,transposase,protease,tail,plate	Enterococcus_phage(32.26%)	54	2874247:2874287	2918000:2918040
2874247:2874287	attL	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
WP_002286683.1|2878440_2878665_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002303476.1|2878661_2878955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002327992.1|2878991_2879129_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002332429.1|2879130_2879577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164853016.1|2879573_2879723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200790.1|2879736_2881779_-|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	46.8	2.0e-82
WP_079200791.1|2881796_2882621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071244211.1|2882624_2883674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342059.1|2883670_2884543_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_077974380.1|2884546_2891281_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.6	2.0e-17
WP_002337251.1|2891475_2891784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371755.1|2891829_2892297_-	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_077974382.1|2892369_2892957_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	1.6e-35
WP_077974383.1|2893017_2893428_-	hypothetical protein	NA	A0A059T681	Listeria_phage	48.0	1.6e-23
WP_073357564.1|2893424_2893829_-	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.5	7.7e-18
WP_073357576.1|2893844_2894216_-|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_002371763.1|2894196_2894475_-	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_071244203.1|2894550_2895711_-|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.7	8.3e-65
WP_002371767.1|2895715_2896420_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_073357563.1|2896406_2897579_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.6	6.8e-83
WP_158182303.1|2897622_2898705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073357561.1|2898739_2900383_-|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.3	1.8e-206
WP_073357560.1|2900379_2900739_-	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	67.2	5.2e-34
WP_071244186.1|2900899_2901160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974384.1|2901150_2901462_-	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	59.2	6.3e-28
WP_079200793.1|2901462_2902035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060809366.1|2902367_2902628_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809367.1|2902617_2902806_-	hypothetical protein	NA	F0PII8	Enterococcus_phage	83.3	2.2e-20
WP_002287525.1|2903335_2904484_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|2904500_2904905_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002318885.1|2905256_2905673_-	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_164450255.1|2905766_2905925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200794.1|2905914_2906214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101706191.1|2906210_2906588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200795.1|2906584_2907253_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	45.7	1.5e-21
WP_079200796.1|2907252_2907669_-	DNA-packaging protein	NA	D2IZL0	Enterococcus_phage	54.0	6.9e-30
WP_002375499.1|2907665_2907839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079200797.1|2907835_2908147_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	56.0	2.0e-26
WP_079200798.1|2908146_2908452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317837.1|2908624_2908984_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_002323158.1|2908980_2909832_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_079200755.1|2909847_2910678_-	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	2.6e-52
WP_077974388.1|2910680_2911367_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_002286557.1|2911372_2912044_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|2912036_2912378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|2912555_2913254_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|2913340_2913811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|2913853_2914033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325021.1|2914063_2914312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315391.1|2914323_2914509_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002337457.1|2914794_2915169_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_070676686.1|2915173_2915602_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077974389.1|2915692_2916607_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_077974390.1|2916722_2917859_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	1.7e-54
2918000:2918040	attR	GATTTCTTTGATACGAGCAGCTTTTCCGTGTAATGCACGTA	NA	NA	NA	NA
>prophage 19
NZ_CP019992	Enterococcus faecium isolate 2014-VREF-268 chromosome, complete genome	2990310	2931125	2985790	2990310	holin,tail,transposase,integrase	Escherichia_phage(18.75%)	52	2936006:2936022	2976226:2976242
WP_002320964.1|2931125_2932394_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002296623.1|2932499_2933795_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289372.1|2933968_2934916_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002289370.1|2934920_2935673_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|2935673_2936582_-	dehydrogenase	NA	NA	NA	NA	NA
2936006:2936022	attL	CAAACTGTTTTTTTACT	NA	NA	NA	NA
WP_002289366.1|2936581_2937559_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002326811.1|2937571_2938714_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289363.1|2938703_2939381_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002289362.1|2939353_2940502_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|2940498_2941503_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|2941514_2942522_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|2942534_2943956_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002302730.1|2943942_2945013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292877.1|2945014_2946442_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_079200799.1|2946434_2947397_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002289069.1|2947429_2948515_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|2948533_2949574_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_077974393.1|2949589_2950981_-	sugar transferase	NA	NA	NA	NA	NA
WP_002289074.1|2951358_2952342_+	serine hydrolase	NA	NA	NA	NA	NA
WP_077495122.1|2952709_2954848_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289078.1|2954886_2956473_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289079.1|2956462_2957683_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|2957694_2958501_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077974396.1|2958710_2959991_-	EpaQ family protein	NA	NA	NA	NA	NA
WP_002296543.1|2960034_2962068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294531.1|2962102_2962954_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296544.1|2963051_2964080_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002286442.1|2964101_2964674_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|2964687_2965554_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|2965653_2966388_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|2966365_2967193_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|2967192_2967993_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077974399.1|2967985_2969125_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286461.1|2969200_2970124_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|2970155_2970920_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|2971077_2971518_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|2971695_2972265_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|2972518_2973751_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002286470.1|2974055_2974256_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286680.1|2974504_2974807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|2974842_2975214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|2975215_2975617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|2975630_2976038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|2976960_2978123_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
2976226:2976242	attR	CAAACTGTTTTTTTACT	NA	NA	NA	NA
WP_002286484.1|2979062_2980088_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|2980084_2980309_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002286686.1|2980305_2980599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|2980636_2980774_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|2980775_2981222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|2981218_2981368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974334.1|2981384_2983475_-	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	50.0	2.8e-87
WP_045135982.1|2983498_2985790_-|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.1	1.3e-90
>prophage 1
NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	243818	1322	58243	243818	holin,transposase,integrase	Streptococcus_phage(38.1%)	54	31704:31722	52844:52862
WP_002316074.1|1322_1526_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303313.1|1666_2152_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002303312.1|2154_3054_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303311.1|3066_3660_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303309.1|3735_3885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305772.1|3900_6105_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_060809967.1|6115_7576_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002347694.1|7636_10009_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002297404.1|10418_11669_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295674.1|11905_12247_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002323647.1|12865_13198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303636.1|14021_15062_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002348857.1|16413_16608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|17314_18463_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|18479_18884_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002303208.1|19242_19497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|19497_19815_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002326174.1|20448_21357_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002324486.1|21575_22946_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_002303603.1|22966_23251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|24443_25745_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293041.1|25873_26071_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.9e-23
WP_010729620.1|26266_27220_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	4.8e-34
WP_002324485.1|27289_27640_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002303335.1|28053_28872_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002303333.1|28944_29304_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002314359.1|30044_31235_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.2	3.5e-26
31704:31722	attL	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
WP_002319817.1|31776_32457_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002303241.1|33133_34084_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002303240.1|34601_35057_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172820227.1|35454_36000_+	hypothetical protein	NA	F2Y1B5	Organic_Lake_phycodnavirus	31.8	7.0e-14
WP_072538890.1|36093_36426_+	topoisomerase I	NA	A0A1X9I6W8	Streptococcus_phage	96.8	2.2e-42
WP_002290556.1|37560_38328_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|38816_39242_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|39258_39774_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002290553.1|39784_40717_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290551.1|40719_41700_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290550.1|41727_42045_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002290549.1|42044_43751_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290548.1|43892_45299_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|45321_45594_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|45614_46514_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_102642289.1|46985_48148_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.5e-77
WP_002303153.1|48796_49213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297422.1|49318_49582_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002314366.1|49581_49854_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002292678.1|49930_50260_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292680.1|50821_51679_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|51679_52228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331383.1|52897_53578_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
52844:52862	attR	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
WP_002323245.1|54716_55889_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_079200801.1|55954_56446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729386.1|56601_57051_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_087121905.1|57080_58243_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
>prophage 2
NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	243818	61941	131716	243818	transposase,integrase	Streptococcus_phage(26.92%)	58	89803:89862	130902:132554
WP_077974474.1|61941_63141_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	24.7	1.3e-25
WP_010729383.1|63130_64609_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	3.1e-125
WP_002299928.1|65957_67247_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014748799.1|67313_68204_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002299926.1|68193_69009_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002299925.1|69024_70149_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.0e-22
WP_002299923.1|70126_70930_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002299921.1|71380_71653_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002299919.1|71642_71972_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_010729381.1|73565_74840_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002302980.1|75222_75951_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002340467.1|75928_77503_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.0	9.4e-11
WP_002304874.1|77731_78670_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002289655.1|78681_79593_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010729380.1|79616_81089_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002304878.1|81139_81751_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002304880.1|81780_83694_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002305865.1|83821_86803_+	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002288608.1|86799_88461_+	hyaluronate lyase	NA	NA	NA	NA	NA
WP_002288609.1|88500_89433_+	hypothetical protein	NA	NA	NA	NA	NA
89803:89862	attL	GAATCGGGAATGTTTGGCGTTTTTAGTTACGAGAAAAATGTTGTTGTACATCCTTGTTCC	NA	NA	NA	NA
WP_002296127.1|89824_91372_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|91473_91827_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|91816_92011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729379.1|92236_93439_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	26.2	4.8e-23
WP_002351139.1|93441_93636_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_010729378.1|93682_94531_-	rep protein	NA	Q3ZVF7	Spiroplasma_phage	45.8	3.0e-11
WP_010729377.1|94735_95086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025481119.1|95680_96127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005233042.1|96750_97743_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005230433.1|97758_98643_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010729375.1|98691_100299_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010729374.1|100299_101784_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_010729373.1|101960_102953_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.8	8.2e-13
WP_010729372.1|103004_103874_+	ROK family protein	NA	NA	NA	NA	NA
WP_032494987.1|104293_105859_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_010729371.1|105913_107188_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
WP_002285815.1|107475_108129_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002300494.1|108125_109445_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002325565.1|109546_110227_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_000751236.1|110357_110810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|110823_111513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|111637_113989_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|114068_114464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|114788_115406_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|115446_115746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|115779_115947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321606.1|115991_116597_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_002319817.1|116856_117537_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002387940.1|118908_119421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002303110.1|119417_120455_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_025189010.1|122064_122457_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_001028141.1|122457_123897_+	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_001015311.1|124004_124685_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002285758.1|125811_126006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|125995_126349_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_106914055.1|126787_128127_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	1.3e-77
WP_002296127.1|129391_130939_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_001015311.1|131035_131716_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
130902:132554	attR	GGAACAAGGATGTACAACAACATTTTTCTCGTAACTAAAAACGCCAAACATTCCCGATTCGGTTCTGTTGCAAAGTTTTAAATCTACTATCAAATAAGGTAGAATAATAGAAAAAGATAGCAGGAGGAATGACGATGAATCATTTTAAAGGAAAGCAATTTCAGCAGGATGTGATTATTGTAGCCGTGGGCTACTATCTTCGTTATAACCTTAGCTATCGTGAAGTTCAAGAAATCTTATATGATCGTGGCATTAACGTTTCTCATACGACGATTTATCGTTGGGTGCAAGAATATGGCAAACTACTCTATCAAATTTGGAAAAAGAAAAATAAAAAATCCTTTTATTCATGGAAAATGGATGAAACGTACATCAAAATTAAAGGAAAATGGCATTATTTGTATCGAGCCATCGATGCAGATGGTTTAACCTTGGATATTTGGTTACGTAAAAAACGGGACACACAAGCAGCCTATGCTTTTCTTAAGCGGTTAGTGAAGCAGTTTGATGAACCGAAGGTTGTAGTCACAGATAAAGCCCCCTCTATTACAAGTGCCTTTAAGAAACTAAAAGAATACGGCTTTTATCAAGGGACAGAACATCGTACCATTAAATACCTGAATAATTTGATTGAACAAGACCATCGTCCAGTAAAGAGACGCAATAAATTCTATCGAAGTTTACGCACTGCCTCTACCACGATTAAAGGCATGGAAGCCATTCGAGGATTATATAAGAAAACCCGAAAAGAAGGCACTCTCTTCGGGTTTTCGGTCTGTACTGAAATCAAGGTATTATTGGGAATCCCAGCTTAAATCATAGATACCGTAAGGGATTTTATTCTTTATTTAAAACTTTGCAACAGAACCCTTAAAAGTTTTTGATCCTTTATTTTCAAGTCTGATTTGGCAGCTTTTCGGCAGCTCATTTATTTATGGTCAGAAATAGATGCTGAAATTTTAATCTATTAGCAAATAGTCCAGAACGTATGAAGAGGAGTCGGATATCATTTGTCATTAACACCATAAATATTTATAAAATTCGTGTTCACCTACAATTAAATTTAATATATAATATTCGTTGTAAGGGCTTATAATTTTTTGTTAATGAACAAGATAGGAAGAAACATTTAATGGACAGTTTTCAGAGATTGTCACTAGTAAATCAATTTGAGTTATTGGCTAAATTTGAGGACCAAAACAGATCTTATTATGAAAGAAAAATCGAAATATTGAGAGAAGGTTACGAGTATCATTATGATGATGAAATTTGGAGTGATCTTTCTGAGCCATTTCCGAAAGAAGATTCTCGATTTGTATTAGATGTATTGAACATGTATCGAGATATCAATTTTAGTAAATCAAAGCTAAACTTAGATGAAAACCAAATTACTAATTCATACTATACTCATTTCGGTTCTGTTGCAAAGTTTTCCAAAAAATCTATTTTAGTGTAAAATTGAGAAAAAAGACAGAGAGGACAGAGTAATGAATCATTTTAAAGGCAAACAATTCAAAAAAGACGTCATTATTGTCGCTGTTGGTTACTACCTGCGTTACAATCTAAGCTATCGTGAAGTTCAGGAATTGTGATATGATCGTGGAATAAATGTTTGTCATACTACGATTTATCGTTGGGTACAAGAGTACAGCA	NA	NA	NA	NA
>prophage 3
NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	243818	136143	199428	243818	transposase,integrase	Bacillus_phage(17.65%)	53	154126:154143	204890:204907
WP_044383156.1|136143_136824_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
WP_002350449.1|137588_138596_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016922317.1|139062_140469_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.2	3.4e-44
WP_002350447.1|140491_140815_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016922316.1|140825_142508_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002350442.1|144132_144885_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.9e-17
WP_002350440.1|145477_146935_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002350439.1|146956_147259_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002350438.1|147315_147795_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010731480.1|147959_148733_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	1.3e-18
WP_079200802.1|148752_149181_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_010731482.1|149199_149715_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	29.0	9.5e-05
WP_002350433.1|149727_150654_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002350432.1|150666_151653_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350430.1|152108_152777_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
WP_010731484.1|152767_153901_+	ATP-binding protein	NA	NA	NA	NA	NA
154126:154143	attL	GACCCCCAAAAGTTAGAC	NA	NA	NA	NA
WP_002326540.1|155263_156049_-	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_044383147.1|156173_157769_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	1.8e-126
WP_016922464.1|157758_158976_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.7	9.2e-14
WP_044383143.1|158989_162139_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	1.1e-21
WP_016252778.1|162350_163031_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	4.5e-127
WP_002344897.1|163165_163522_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002344896.1|163511_163778_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087121905.1|164691_165854_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_008271463.1|167530_167776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|167873_168095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319325.1|169158_169776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300314.1|170795_171965_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002290383.1|172437_172992_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002290382.1|173164_173638_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002342357.1|173649_174186_+	VOC family protein	NA	NA	NA	NA	NA
WP_002290380.1|174225_174597_+	VOC family protein	NA	NA	NA	NA	NA
WP_002290379.1|174880_176152_+	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002338088.1|176396_177422_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002350067.1|177715_178825_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002350071.1|179819_180644_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002329911.1|180675_181986_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_002290371.1|182133_183393_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002290370.1|183402_184275_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290368.1|184286_185117_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290367.1|185156_187340_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002290366.1|187400_187556_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
WP_010731456.1|187651_188620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002335326.1|188616_190077_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002290357.1|191581_191791_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002290356.1|191783_191933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324528.1|192086_192752_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	31.1	3.9e-19
WP_002290352.1|193035_194121_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290351.1|194454_194688_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002329899.1|194684_195092_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002287870.1|196228_196747_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_086956687.1|197864_199026_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_158514107.1|199317_199428_+|transposase	transposase	transposase	NA	NA	NA	NA
204890:204907	attR	GACCCCCAAAAGTTAGAC	NA	NA	NA	NA
>prophage 4
NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	243818	226625	236334	243818	transposase	Streptococcus_phage(50.0%)	11	NA	NA
WP_010729749.1|226625_227918_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002285758.1|227996_228191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|228180_228534_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|228635_230183_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002302440.1|230411_231713_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|231891_232161_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_014748823.1|232150_232417_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|232485_232713_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|232917_233550_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_010861579.1|234880_235561_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002299575.1|235749_236334_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
>prophage 1
NZ_CP019994	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2	99829	2859	49162	99829	protease,transposase	Streptococcus_phage(33.33%)	49	NA	NA
WP_100083950.1|2859_3539_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	4.5e-127
WP_002347145.1|3576_3891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947691.1|4025_5519_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000429439.1|6130_7084_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|7055_7331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199136.1|7523_7778_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_002322130.1|7888_8143_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_001015311.1|8303_8984_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_073120187.1|9658_10231_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002303206.1|10586_11159_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|11174_11780_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_001015311.1|11977_12658_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002288897.1|12753_13377_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_000774078.1|13647_14160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|14166_14685_-	YfbU family protein	NA	NA	NA	NA	NA
WP_002349227.1|14846_15059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|15496_16798_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002347536.1|17260_17545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347535.1|17560_17797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347534.1|17818_18073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320785.1|18154_18340_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0A7RWW9	Clostridium_phage	40.4	7.6e-05
WP_002320784.1|18406_18802_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AN56	Paenibacillus_phage	39.7	4.1e-16
WP_002350538.1|18791_19169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347532.1|19190_19565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287525.1|19973_21122_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|21138_21543_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002320781.1|21762_22161_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_010729833.1|22352_23120_-	replication initiation protein	NA	NA	NA	NA	NA
WP_025480441.1|23154_24378_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_002320777.1|25313_26117_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320776.1|26699_27155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321771.1|27273_28332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010730985.1|28373_30323_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.9e-30
WP_002347432.1|30325_33967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|34366_34705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347429.1|35055_37212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|37223_37457_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002320767.1|37446_38313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|38327_40298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|40807_41212_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|41228_42377_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_010729677.1|42583_42919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347719.1|43175_44759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347505.1|44880_45465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347506.1|45475_45721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347507.1|45726_46449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347508.1|46579_47323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347509.1|47328_47694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326066.1|48208_49162_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.1e-34
>prophage 1
NZ_CP019995	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-3	58211	3860	53936	58211	transposase	Streptococcus_phage(55.17%)	60	NA	NA
WP_002323245.1|3860_5033_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_010729835.1|6866_7133_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_010729836.1|7134_7356_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_002360989.1|7581_8400_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002320793.1|8403_8700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729838.1|8881_9235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730992.1|9254_10310_-	ParM/StbA family protein	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	31.7	4.0e-42
WP_010730993.1|10525_10924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320797.1|10926_11100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320797.1|13072_13246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730993.1|13248_13647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730992.1|13862_14918_+	ParM/StbA family protein	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	31.7	4.0e-42
WP_010729838.1|14937_15291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320793.1|15472_15769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002360989.1|15772_16591_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010729836.1|16816_17038_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_010729835.1|17039_17306_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_002323245.1|19139_20312_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|20463_21159_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|21136_22291_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|22505_23474_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|23466_24498_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|24503_25112_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001015311.1|25200_25881_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001812592.1|26175_27087_+	D-Ala-D-Ala carboxypeptidase VanY-A	NA	NA	NA	NA	NA
WP_000516404.1|27239_27725_+	glycopeptide resistance protein VanZ-A	NA	NA	NA	NA	NA
WP_154067203.1|28011_28341_-	metalloregulator ArsR/SmtB family transcription factor	NA	E4ZFI8	Streptococcus_phage	47.3	8.5e-15
WP_059355960.1|28402_29089_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.5	1.2e-124
WP_002297218.1|29148_30444_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_001096887.1|31032_31827_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_031929417.1|32368_32452_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001038796.1|32576_33314_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_001284311.1|33576_34440_-	toxin zeta	NA	NA	NA	NA	NA
WP_000301765.1|34441_34714_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_000527318.1|34730_34940_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_002347171.1|35037_35295_-	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	9.1e-41
WP_001015311.1|35350_36031_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002303408.1|36799_37033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044384217.1|37025_37445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171970646.1|37423_37762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298418.1|37765_38128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162536231.1|39214_39757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|40544_41225_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002299939.1|41704_41860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299940.1|42476_42698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299941.1|42698_42956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200807.1|43091_43376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|43417_44098_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002347145.1|44135_44450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947691.1|44584_46078_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000429439.1|46689_47643_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|47614_47890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199136.1|48082_48337_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_002322130.1|48447_48702_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_001015311.1|48862_49543_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_073120187.1|50217_50790_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002303206.1|51145_51718_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|51733_52339_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_001015311.1|52536_53217_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002288897.1|53312_53936_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
