The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	114026	152180	2804968	protease,transposase	Streptococcus_phage(25.0%)	33	NA	NA
WP_002296623.1|114026_115322_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002287760.1|115810_116764_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289162.1|117910_119533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289161.1|119799_120969_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002289159.1|121172_122348_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289156.1|122483_122963_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002297218.1|123060_124356_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292871.1|124653_125385_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289154.1|125381_126449_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002289153.1|126455_127088_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289151.1|127227_127893_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289149.1|127920_128214_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289148.1|128281_129229_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002289147.1|129406_130210_-	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002317368.1|130355_131270_+	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002292862.1|131317_131788_+	GtrA family protein	NA	NA	NA	NA	NA
WP_002295401.1|131872_132481_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292860.1|132614_132815_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295400.1|133568_134795_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002303667.1|134909_136250_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_077495118.1|136444_136915_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002292856.1|137236_137815_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002295399.1|137988_139371_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002295398.1|139477_140275_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002296955.1|140267_141446_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002290817.1|141539_142073_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002290819.1|142150_142585_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002290821.1|142726_143845_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002295395.1|143972_145349_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002295394.1|145749_147330_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002297218.1|148056_149352_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002290825.1|149477_149798_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002287598.1|149945_152180_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
>prophage 2
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	282677	334398	2804968	tRNA,transposase	Streptococcus_phage(20.0%)	50	NA	NA
WP_002297218.1|282677_283973_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|284228_285116_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|285134_285506_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|285475_286273_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|286256_286826_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|286831_287548_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|287877_288489_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|288866_290390_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|290626_291967_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|292119_292857_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|293021_293243_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|293273_294305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079157995.1|294291_295704_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.6e-64
WP_002294404.1|295761_296397_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|296445_297126_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|297260_298490_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002303667.1|298581_299922_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002296982.1|300213_301524_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|301767_302043_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_002294410.1|302277_303324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|303325_304585_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|304590_305172_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|305253_306129_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|306276_306609_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|306720_307929_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|308082_308538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|308796_310098_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297185.1|310232_311528_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|311922_312198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324658.1|312210_314283_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|314447_316334_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|316345_317293_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|317312_317840_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|317902_318556_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|318687_319530_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|319687_320584_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|320586_321300_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|321319_321838_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|321834_322062_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|322213_322765_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|322847_323390_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|323626_324025_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|324284_325145_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|325137_325905_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|325960_326818_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|326939_329018_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|328986_330363_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002297218.1|330491_331787_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288415.1|332082_332988_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002287107.1|333147_334398_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 3
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	400047	409108	2804968		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|400047_401343_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|401522_401900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|402155_402884_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|402883_403138_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|403139_403811_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|403811_406034_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|406018_407458_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|407489_408533_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|408529_409108_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 4
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	473189	542612	2804968	tRNA,transposase	Lysinibacillus_phage(21.05%)	59	NA	NA
WP_002297185.1|473189_474485_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002297218.1|474845_476141_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296887.1|476411_479939_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_002296885.1|479935_483658_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002303789.1|483726_484068_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010729352.1|484376_485420_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002296881.1|485424_487845_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002288045.1|488014_489025_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296877.1|489278_490016_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288041.1|490029_490845_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002288038.1|490857_491505_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002296876.1|491520_492177_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002317207.1|492338_493160_+	glutamate racemase	NA	NA	NA	NA	NA
WP_002296875.1|493162_494518_+	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002288030.1|494518_495037_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002295789.1|495143_495644_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|495963_497259_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002295791.1|497445_498366_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002296282.1|498530_499544_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295795.1|499653_500409_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002295797.1|500628_501069_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002296283.1|501183_501945_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295800.1|502133_503228_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002303791.1|503313_504273_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002289735.1|504458_505394_+	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002289734.1|505478_506489_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002296575.1|506776_508090_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002295807.1|508310_508898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295809.1|509074_510016_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002296573.1|510012_510801_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002295811.1|510810_511245_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296571.1|511386_513684_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002295813.1|513697_514210_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002297436.1|514498_514717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322319.1|514896_515529_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.3e-16
WP_002295816.1|515667_515919_+	DUF896 family protein	NA	NA	NA	NA	NA
WP_002295818.1|516020_518018_+	transketolase	NA	NA	NA	NA	NA
WP_002326066.1|518195_519149_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295819.1|519330_520218_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_002296093.1|520357_521284_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.2	2.7e-98
WP_002289542.1|521519_521966_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002289543.1|522238_523591_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_002296094.1|523761_524049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289545.1|524274_524718_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296096.1|524723_525908_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_002289610.1|526175_526874_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	42.5	4.9e-12
WP_002296097.1|526880_527558_+	endonuclease III	NA	NA	NA	NA	NA
WP_002289611.1|527683_528217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289606.1|528513_530895_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002289604.1|530884_531532_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.5	1.7e-22
WP_002299695.1|531595_532135_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295835.1|532224_532644_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_002289183.1|533241_534408_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_002289184.1|534453_535950_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_002289185.1|536030_536714_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	2.5e-13
WP_002289186.1|537358_538549_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	33.3	3.7e-52
WP_002289187.1|538650_539604_+	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_002296108.1|539672_541022_+	amino acid permease	NA	NA	NA	NA	NA
WP_002297218.1|541316_542612_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 5
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	635528	684598	2804968	protease,transposase	Streptococcus_phage(23.08%)	58	NA	NA
WP_079158005.1|635528_637064_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	3.6e-124
WP_002295142.1|637287_637659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|637914_638157_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|638188_639091_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|639103_639292_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|639305_639869_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|639906_640800_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|640877_641816_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|641849_642200_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|642232_643135_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|643127_643985_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|644318_645128_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|645167_645665_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|646309_646633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|646796_647051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|647120_647366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|647441_647807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|647867_648431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|648998_649199_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|649950_650664_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|650656_651742_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|651758_652202_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|652235_652589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|652700_653102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|653138_653648_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|653669_654527_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|654544_655378_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|655391_656189_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|656221_656506_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|656502_657504_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|657505_658408_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|658571_659420_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|660065_660272_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|660473_661475_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|661479_663393_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|663560_664067_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|664226_664667_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002303667.1|664825_666166_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002296632.1|666234_667392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|667394_667751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|668048_669023_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|669218_670058_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|670242_671130_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|671723_672419_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|672402_672801_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|673209_674460_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|674601_675597_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|675614_676169_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|676156_676648_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|676640_678509_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002346994.1|678527_679328_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.6	3.4e-09
WP_002289418.1|679551_679767_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|679905_680391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|680846_681260_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|681396_681657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|681774_682065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|682310_683489_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|683644_684598_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	784954	904027	2804968	tRNA,protease,transposase	Streptococcus_phage(27.27%)	106	NA	NA
WP_000222572.1|784954_785908_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326695.1|785904_786486_-	DUF443 family protein	NA	NA	NA	NA	NA
WP_002321528.1|786672_787323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289698.1|787865_788801_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002289697.1|788834_789833_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289695.1|789829_790714_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002296517.1|790848_791580_-	aspartate racemase	NA	NA	NA	NA	NA
WP_002294441.1|791583_792849_-	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296519.1|793111_795928_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002294444.1|795937_797932_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002346973.1|798190_799693_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002292113.1|799694_800432_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_002296524.1|800661_801291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289374.1|801372_802539_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002292134.1|802689_804519_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002296525.1|804569_805133_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002289532.1|805226_806270_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002289534.1|806503_807670_-	oxygen-independent coproporphyrinogen III oxidase	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	32.8	5.5e-08
WP_002300943.1|807685_807913_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_002289535.1|808396_808987_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002289536.1|809176_809890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289537.1|810004_811015_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002294466.1|811051_811534_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002294467.1|811683_812052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296526.1|812516_812969_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288523.1|813092_813944_-	sugar transporter	NA	NA	NA	NA	NA
WP_002288522.1|813956_814742_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288521.1|815093_816035_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288520.1|816038_816962_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002288514.1|820139_820313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|820563_821859_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297218.1|822042_823338_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288513.1|823450_823798_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002288511.1|823824_826131_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|826143_826455_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|826451_826745_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002288500.1|826766_827942_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|827964_828438_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288497.1|828582_832941_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002288495.1|833152_834862_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002288494.1|834929_836198_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002296531.1|836358_837159_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|837155_837968_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002293875.1|838162_838720_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|838722_839445_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|839580_840462_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|840560_841343_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|841701_842181_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|842397_843489_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002296514.1|843481_843610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|843613_844159_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002287525.1|844375_845524_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|845540_845945_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002288432.1|846503_848195_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|848615_849563_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|849677_850697_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|850787_852017_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|852477_853179_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288444.1|853787_854804_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
WP_002288445.1|854800_855265_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|855271_855814_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|855797_856622_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|856710_857691_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|857714_859199_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|859210_860200_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|860447_860615_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|860676_862488_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|862484_862850_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|863012_863408_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|863425_864388_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|864387_864600_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|864620_865319_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|865338_865881_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002296124.1|866012_867017_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002320813.1|867013_868003_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|867999_868806_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|868971_869928_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|870004_870523_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|870610_870760_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|870987_871434_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|871628_873524_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002322125.1|873798_875262_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	2.0e-124
WP_000997695.1|875871_877050_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296332.1|878294_878861_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|879116_880448_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|880413_880764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296336.1|880855_881275_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|881275_881620_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002286097.1|881891_882845_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287776.1|883036_883633_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|883756_885556_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|885833_886046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|886909_887869_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002312603.1|888905_890369_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002288573.1|890592_890979_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|891286_892633_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|892744_894094_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|894211_895465_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|895535_896021_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002326253.1|896043_896802_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002322842.1|896817_897996_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002333083.1|898225_900346_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	1.7e-220
WP_002297641.1|900568_901294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|901283_901793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|901862_903311_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002293942.1|903310_904027_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
>prophage 7
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	914370	974362	2804968	integrase,transposase	Streptococcus_phage(63.16%)	54	919931:919955	980731:980755
WP_000997695.1|914370_915549_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_010721617.1|915711_916905_+	MFS transporter	NA	NA	NA	NA	NA
WP_010721616.1|917070_917493_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_010721943.1|918075_918570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010721614.1|918731_919904_-	class C sortase	NA	NA	NA	NA	NA
919931:919955	attL	TATGAAGAGGTTGTGAAATCAGCGC	NA	NA	NA	NA
WP_002305732.1|923016_925344_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002323245.1|925566_926739_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002288970.1|927518_927812_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|928214_929393_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002300928.1|929496_929811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|929917_930133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|930432_930675_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288962.1|930661_931090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299190.1|931241_932789_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|932890_933244_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|933233_933428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289210.1|933916_934291_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002296814.1|934313_935714_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289214.1|935717_936128_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289215.1|936145_936637_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289216.1|936646_937438_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289217.1|937430_938204_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289218.1|938359_940894_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289219.1|940974_941847_-	ROK family protein	NA	NA	NA	NA	NA
WP_002289220.1|941882_942350_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289221.1|942359_943829_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296810.1|943899_945318_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002296809.1|945439_946420_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|946699_947862_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002305710.1|947954_948464_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002343922.1|948802_949756_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|949708_949945_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289051.1|950364_951486_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002321361.1|951813_953223_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289053.1|953219_953948_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002289055.1|954075_954987_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289057.1|955003_956011_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289059.1|956007_958137_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002296840.1|958437_959625_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002321772.1|959717_962063_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002288938.1|962049_962439_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002297208.1|962488_963385_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288935.1|963387_965235_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002288934.1|965331_965832_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_033657400.1|965844_966069_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002286940.1|966172_968083_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002305703.1|968828_968966_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286934.1|968962_970147_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002286933.1|970402_970657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286932.1|970681_971824_-	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286930.1|971883_973236_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002305701.1|973306_973660_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286926.1|973660_974035_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286925.1|974047_974362_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
980731:980755	attR	GCGCTGATTTCACAACCTCTTCATA	NA	NA	NA	NA
>prophage 8
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	979297	1045512	2804968	transposase,integrase,protease,tRNA	Bacillus_phage(19.05%)	49	978994:979009	1017993:1018008
978994:979009	attL	CGCTGATTCCAGCACC	NA	NA	NA	NA
WP_002293717.1|979297_980059_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|980048_980570_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|980739_981531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|981655_981907_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|981918_982194_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|982446_983001_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|983079_983601_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|983604_984183_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|984294_985713_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|985733_986072_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|986031_986535_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|986665_987370_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297195.1|987366_989103_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|989205_991677_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002320964.1|991949_993218_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002296623.1|993323_994619_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_086953915.1|995818_997158_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|997327_998506_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_008266934.1|1000233_1000647_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|1000878_1001136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|1001421_1002672_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|1003081_1004056_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002347285.1|1004211_1005507_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_086953915.1|1006090_1007429_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_079158006.1|1007469_1008162_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	42.9	6.8e-30
WP_002296536.1|1008156_1008423_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
WP_002294835.1|1008598_1009168_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1009241_1009565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1009718_1010531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1010884_1011733_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002289045.1|1011877_1012819_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002296533.1|1015091_1017263_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002289041.1|1017282_1019469_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
1017993:1018008	attR	CGCTGATTCCAGCACC	NA	NA	NA	NA
WP_002289040.1|1019468_1019678_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289038.1|1019690_1020131_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289037.1|1020204_1020744_-	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002297185.1|1020991_1022287_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296055.1|1030487_1031984_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|1032095_1033100_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|1033100_1033988_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|1034204_1036316_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|1036405_1036951_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|1036950_1038396_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|1038515_1038986_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|1039031_1039457_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|1039523_1039793_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287405.1|1039803_1041399_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|1041413_1044935_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|1044951_1045512_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	1085853	1214491	2804968	tRNA,bacteriocin,transposase,holin	Streptococcus_phage(24.0%)	111	NA	NA
WP_002297218.1|1085853_1087149_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288776.1|1087641_1088001_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002319756.1|1088030_1088372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288769.1|1088368_1089043_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1090218_1091517_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002296294.1|1091556_1092747_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002321579.1|1092767_1093295_-	peptidase	NA	NA	NA	NA	NA
WP_002288763.1|1093341_1096131_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002288762.1|1096277_1096478_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002296295.1|1096930_1097251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294874.1|1097753_1098872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296298.1|1099342_1100650_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002297218.1|1100749_1102045_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296299.1|1102292_1103492_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296300.1|1103518_1104787_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296301.1|1104956_1105598_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296302.1|1106006_1106510_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1106632_1107397_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1107504_1107780_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002317189.1|1108339_1109290_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002311321.1|1109335_1109737_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_079158008.1|1109750_1110560_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311317.1|1110546_1111437_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_024635520.1|1111449_1111929_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002311314.1|1112104_1113046_-	hexose kinase	NA	NA	NA	NA	NA
WP_002311313.1|1113042_1114038_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311312.1|1114030_1115227_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311311.1|1115244_1115973_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311310.1|1116413_1117388_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002294893.1|1117384_1117843_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002317191.1|1117839_1119303_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002317192.1|1119284_1120217_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002347297.1|1120358_1121027_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002337813.1|1120950_1121904_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077974463.1|1122105_1122222_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002297179.1|1125062_1126001_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	3.6e-10
WP_002317228.1|1126243_1127284_-	sugar kinase	NA	NA	NA	NA	NA
WP_002321992.1|1127291_1127810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974461.1|1127755_1128334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297160.1|1128468_1130052_-	3-hydroxy-3-methylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_002297161.1|1130070_1130730_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002297162.1|1130822_1132244_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002343622.1|1132240_1133329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321991.1|1133412_1134648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297168.1|1135265_1136321_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297169.1|1136342_1137365_-	polysaccharide biosynthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	30.8	5.3e-07
WP_002297170.1|1137370_1138477_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002297171.1|1138476_1139613_-	glycosyltransferase family 4 protein	NA	A0A1V0SD18	Indivirus	24.8	4.5e-07
WP_002317234.1|1139644_1141096_-	sugar transferase	NA	NA	NA	NA	NA
WP_002296215.1|1141139_1141904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296213.1|1141931_1142630_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.6	2.4e-27
WP_002296211.1|1142641_1143421_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1143436_1144381_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002296207.1|1144426_1145206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974298.1|1145632_1146541_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002296756.1|1146575_1146926_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002296753.1|1146925_1147129_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000997695.1|1147360_1148539_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|1149086_1150382_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296162.1|1150505_1152581_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002296161.1|1152582_1153500_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002296160.1|1153883_1154696_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002288753.1|1154838_1155738_-	GTPase Era	NA	NA	NA	NA	NA
WP_002296159.1|1155752_1156154_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002288749.1|1156131_1156608_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002296158.1|1156624_1158817_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002287107.1|1159226_1160477_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291698.1|1160623_1161595_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002296157.1|1162300_1163680_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002287318.1|1163833_1164280_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002287321.1|1164306_1164483_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287322.1|1164644_1165073_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002296156.1|1165164_1166025_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002296154.1|1166116_1166410_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296152.1|1166481_1168209_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.6	3.3e-211
WP_002296150.1|1168422_1169349_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002296149.1|1169493_1170927_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296147.1|1170926_1172330_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296146.1|1172560_1173463_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296142.1|1175481_1176333_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002296141.1|1176658_1178443_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	7.8e-46
WP_002296139.1|1178442_1180194_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	8.2e-56
WP_002294955.1|1180335_1180560_-	YneF family protein	NA	NA	NA	NA	NA
WP_002296138.1|1180810_1182397_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002294959.1|1182462_1184238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296136.1|1184450_1185353_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.0	1.5e-21
WP_002291653.1|1188314_1189316_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002296134.1|1189525_1190632_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002296133.1|1190690_1191293_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002289575.1|1191295_1191736_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002289574.1|1191860_1192799_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002296128.1|1192813_1193839_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|1193882_1194713_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|1194727_1195666_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|1195832_1196183_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|1196182_1196500_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002289495.1|1196799_1198368_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_002294975.1|1198467_1199235_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002296593.1|1199231_1200263_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002289490.1|1200500_1201178_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002289489.1|1201190_1201949_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
WP_002289486.1|1201964_1202771_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.8e-13
WP_002296590.1|1202785_1203670_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|1203669_1204590_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|1204704_1205562_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002296589.1|1205898_1207347_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002317241.1|1207498_1208392_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|1208375_1209062_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_096157771.1|1209166_1210268_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002296588.1|1210393_1212928_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002302440.1|1213189_1214491_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 10
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	1276930	1371346	2804968	transposase,integrase,head,tRNA,capsid,portal,terminase,tail	Staphylococcus_phage(12.5%)	88	1298792:1298811	1369711:1369730
WP_002297218.1|1276930_1278226_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296457.1|1278338_1280117_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002290803.1|1280298_1280613_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.8	3.6e-15
WP_002296458.1|1280699_1283060_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.7e-24
WP_002295087.1|1283779_1284217_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002296459.1|1284418_1285336_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002295084.1|1285591_1286503_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	41.1	5.3e-06
WP_002295080.1|1286905_1287484_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296462.1|1287503_1288172_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.8e-35
WP_002296464.1|1288186_1289257_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296465.1|1289427_1290792_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	9.3e-07
WP_002311258.1|1290788_1292348_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296469.1|1292403_1294884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301068.1|1294867_1295203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296471.1|1295216_1296251_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002296472.1|1296340_1297021_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002296473.1|1297304_1298408_-	L-lactate oxidase	NA	NA	NA	NA	NA
1298792:1298811	attL	AAAATATGAGGAACTATTTT	NA	NA	NA	NA
WP_002296474.1|1299036_1299507_-	DUF4809 family protein	NA	NA	NA	NA	NA
WP_002296476.1|1299836_1301477_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002296477.1|1301630_1302953_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002296478.1|1303020_1303455_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002296480.1|1303519_1304356_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002296481.1|1305097_1305724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296483.1|1306018_1306354_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|1306340_1306625_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|1306680_1308204_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|1308196_1309372_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|1309375_1309561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|1309526_1311221_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|1311217_1311691_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296489.1|1311759_1311915_-	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002304527.1|1312048_1312429_-	endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296491.1|1312432_1312648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296492.1|1312650_1313058_-	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296493.1|1313323_1314799_-	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296494.1|1314788_1315637_-	DNA replication protein	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296495.1|1315673_1316036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|1316956_1317268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296500.1|1317311_1317605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296501.1|1317798_1318446_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296502.1|1318506_1319652_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002290887.1|1319732_1320038_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296503.1|1320062_1320494_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290885.1|1320490_1320757_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296505.1|1321011_1321737_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002289867.1|1322284_1323037_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289868.1|1323052_1323532_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002296509.1|1323782_1325363_-	ABC transporter	NA	NA	NA	NA	NA
WP_002287741.1|1325355_1326099_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002287742.1|1326274_1327051_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287743.1|1327298_1328135_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287744.1|1328145_1329075_-	permease	NA	NA	NA	NA	NA
WP_002287745.1|1329266_1329620_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287746.1|1329693_1330350_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287747.1|1330575_1332510_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002321414.1|1332595_1333819_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002321415.1|1333812_1335711_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002287753.1|1335704_1336823_-	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002287754.1|1336905_1337739_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287755.1|1337731_1338649_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287756.1|1338671_1338851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287757.1|1338875_1340000_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002296511.1|1340182_1341091_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287759.1|1341231_1342845_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_000222572.1|1343495_1344449_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|1344482_1345712_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|1345713_1346631_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|1346634_1347372_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|1347462_1347990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|1348169_1348763_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|1348866_1349352_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|1349504_1349702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|1349796_1351557_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|1351553_1353284_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|1353676_1353889_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|1353890_1355570_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|1355823_1356024_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_001092058.1|1356551_1357214_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072201.1|1357722_1358454_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|1358579_1359362_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|1359515_1359893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002300187.1|1359899_1361792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002300186.1|1361788_1362874_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	1.2e-12
WP_002287951.1|1363610_1364264_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|1364253_1365567_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|1365876_1368522_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|1368914_1369562_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|1370134_1371346_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
1369711:1369730	attR	AAAATATGAGGAACTATTTT	NA	NA	NA	NA
>prophage 11
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	1549246	1591221	2804968	tRNA,integrase,protease,transposase	Bacillus_phage(38.46%)	32	1546961:1546979	1587766:1587784
1546961:1546979	attL	GTGAATTTCTTCTTATTTC	NA	NA	NA	NA
WP_002288860.1|1549246_1549909_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|1549984_1551277_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|1551446_1552076_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|1552178_1552988_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|1553042_1553912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|1553912_1555229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|1555225_1557061_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|1557065_1557770_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|1557959_1558820_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|1558806_1559376_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002302440.1|1560069_1561371_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_079158015.1|1561486_1562620_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.0	1.5e-31
WP_002347603.1|1562663_1562894_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002347602.1|1563203_1563425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049142675.1|1563748_1563994_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049142674.1|1563987_1564389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296127.1|1564535_1566083_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1566184_1566538_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1566527_1566722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049142673.1|1566913_1568722_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	47.3	3.0e-154
WP_049142672.1|1568749_1570516_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_049142671.1|1570528_1571323_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_049142670.1|1571333_1572710_-	MFS transporter	NA	NA	NA	NA	NA
WP_049142669.1|1572838_1573486_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_049142668.1|1573569_1574997_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_049142667.1|1575070_1576150_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002354485.1|1577755_1578442_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002295268.1|1583877_1584567_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	1.8e-38
WP_002295267.1|1584553_1585762_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.7e-26
WP_002295265.1|1586055_1587327_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.4	2.0e-88
WP_002295264.1|1587875_1589360_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.8	5.6e-98
1587766:1587784	attR	GTGAATTTCTTCTTATTTC	NA	NA	NA	NA
WP_002297218.1|1589925_1591221_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 12
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	2126749	2138510	2804968		Streptococcus_phage(88.89%)	10	NA	NA
WP_002297345.1|2126749_2127661_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
WP_002297346.1|2127679_2128684_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297347.1|2128680_2130804_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_010729283.1|2130808_2133256_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297349.1|2133242_2133632_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297350.1|2133691_2134195_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_033658092.1|2134207_2134432_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002286940.1|2134535_2136446_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002317225.1|2137191_2137329_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002297353.1|2137325_2138510_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
>prophage 13
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	2353113	2411594	2804968	tRNA,bacteriocin,transposase	Streptococcus_phage(18.18%)	57	NA	NA
WP_002323245.1|2353113_2354286_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_002296384.1|2354741_2355140_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_002296623.1|2355253_2356549_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002288948.1|2356982_2357636_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_002288958.1|2357861_2358860_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_002288947.1|2359035_2360844_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002289850.1|2360922_2361600_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289848.1|2362424_2363129_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|2363106_2363904_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|2363905_2364805_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|2364822_2366184_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002294560.1|2366245_2366887_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|2366995_2367862_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002304784.1|2368079_2368586_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002294557.1|2368634_2369294_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289594.1|2369313_2371902_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|2372004_2372232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303667.1|2372352_2373693_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002303134.1|2373883_2374477_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289599.1|2374508_2375588_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002294551.1|2376642_2377788_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002303131.1|2377774_2378947_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002303130.1|2379045_2380011_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|2380607_2381111_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|2381166_2381811_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|2381972_2382125_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|2382148_2382319_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|2382419_2382965_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002294581.1|2383041_2383929_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294583.1|2384101_2385121_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002294584.1|2385211_2386084_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|2386096_2386765_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|2387107_2387530_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|2387633_2388323_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|2388732_2389236_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|2389288_2389657_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002294589.1|2389762_2390452_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002303471.1|2390533_2391736_+	MFS transporter	NA	NA	NA	NA	NA
WP_002290558.1|2391926_2393459_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|2393692_2394394_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|2394647_2395361_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002294593.1|2395669_2396809_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|2396897_2397863_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002303469.1|2397912_2400072_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.0	2.5e-264
WP_002287795.1|2400230_2400455_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|2400855_2401329_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|2401325_2403458_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|2403459_2403594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|2403687_2404332_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|2404518_2405712_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|2405704_2407432_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002304799.1|2407825_2408023_+	enterocin	NA	NA	NA	NA	NA
WP_002305452.1|2408024_2408336_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002294600.1|2408439_2408586_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002348775.1|2408661_2409909_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002294602.1|2409923_2410676_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002294603.1|2411378_2411594_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	2724063	2732535	2804968		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|2724063_2724708_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|2724722_2725052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|2725065_2726004_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|2726039_2726864_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|2726856_2727204_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|2727272_2728145_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|2728253_2729375_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|2729428_2730031_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|2730345_2732535_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 15
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	2751620	2779715	2804968	protease,integrase,head,tail,capsid,portal,terminase	Enterococcus_phage(29.17%)	43	2743798:2743812	2760103:2760117
2743798:2743812	attL	ATGACAACAGAAGAA	NA	NA	NA	NA
WP_002289451.1|2751620_2751965_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289452.1|2751977_2752271_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002301539.1|2752363_2753512_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|2753523_2753835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|2753887_2754283_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|2754318_2754663_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|2754963_2755185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|2755311_2756088_+	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002305401.1|2756084_2756279_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002349273.1|2756280_2756565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|2756585_2756774_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|2757099_2757339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|2757344_2758031_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|2758033_2758864_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|2758880_2759732_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|2759728_2760088_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|2760102_2760264_+	hypothetical protein	NA	NA	NA	NA	NA
2760103:2760117	attR	ATGACAACAGAAGAA	NA	NA	NA	NA
WP_002305393.1|2760260_2760566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|2760565_2760922_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|2760881_2761127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|2761311_2761779_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002349267.1|2762053_2762290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305389.1|2762313_2762655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020944850.1|2762647_2762827_-	YegP family protein	NA	NA	NA	NA	NA
WP_002305387.1|2763048_2763696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|2763955_2764300_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|2764304_2764586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|2764688_2765003_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|2764980_2766675_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|2766694_2767873_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|2767835_2768522_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_074400045.1|2768521_2769682_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|2769691_2770567_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|2770563_2770875_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|2770864_2771218_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|2771207_2771609_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|2771601_2772006_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002305379.1|2772017_2772623_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|2772642_2773005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|2773007_2773190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079158045.1|2773206_2776626_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_079157991.1|2776676_2777414_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_060799178.1|2777423_2779715_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.1	3.3e-89
>prophage 16
NZ_CP019970	Enterococcus faecium isolate 2014-VREF-114 chromosome, complete genome	2804968	2788806	2799324	2804968	integrase	Enterococcus_phage(40.0%)	17	2788814:2788827	2796913:2796926
WP_002305361.1|2788806_2789601_-	DUF4428 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	32.9	4.3e-12
2788814:2788827	attL	TCTAATAATTCTTG	NA	NA	NA	NA
WP_002301539.1|2789905_2791054_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|2791065_2791377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|2791429_2791825_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|2791860_2792205_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|2792505_2792727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|2792853_2793630_+	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002305401.1|2793626_2793821_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002349273.1|2793822_2794107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|2794127_2794316_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|2794641_2794881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|2794886_2795573_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|2795575_2796406_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305394.1|2797271_2797631_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
2796913:2796926	attR	CAAGAATTATTAGA	NA	NA	NA	NA
WP_002290675.1|2797645_2797807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322165.1|2798453_2798672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|2798856_2799324_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
>prophage 1
NZ_CP019971	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence	129683	2793	46552	129683	integrase,transposase,protease	Streptococcus_phage(58.33%)	47	4399:4415	37713:37729
WP_002311842.1|2793_3237_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002311840.1|3556_3994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311838.1|4006_4861_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	31.4	6.4e-30
4399:4415	attL	CTGTAAATTCTGAAACT	NA	NA	NA	NA
WP_002311837.1|4940_5177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311835.1|5528_5753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317408.1|5864_6464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311832.1|6781_9145_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	33.4	6.0e-54
WP_002311831.1|9193_9571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317407.1|9705_10005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311828.1|10238_11840_-	replication protein	NA	NA	NA	NA	NA
WP_002297218.1|12038_13334_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002311827.1|13758_14013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311824.1|14578_14875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163792.1|14881_16834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868795.1|16905_17403_-	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_002354485.1|17937_18624_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_153302734.1|18624_18747_+	ErmCL family antibiotic resistance leader peptide	NA	NA	NA	NA	NA
WP_001072201.1|18804_19536_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|19661_20444_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|20597_20975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002300187.1|20981_22874_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002300186.1|22870_23956_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	33.9	4.0e-13
WP_077974285.1|24074_24716_-	DNA repair protein RadC	NA	A0A0A7DN12	Lactobacillus_phage	28.9	7.0e-05
WP_060799201.1|26137_26485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799202.1|26477_27803_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	44.2	1.7e-98
WP_002302440.1|28020_29322_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_077974282.1|30230_31457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347491.1|31590_31791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077974280.1|32309_33938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799118.1|33957_34851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321530.1|35105_35426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730971.1|35458_36577_-	hypothetical protein	NA	F0PIJ1	Enterococcus_phage	48.8	5.3e-85
WP_010730972.1|36605_37400_-	hypothetical protein	NA	F0PIJ0	Enterococcus_phage	33.7	1.1e-23
WP_060799120.1|37409_38381_-	hypothetical protein	NA	NA	NA	NA	NA
37713:37729	attR	AGTTTCAGAATTTACAG	NA	NA	NA	NA
WP_002350566.1|38500_38758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320840.1|38760_38991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350567.1|39167_40217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350568.1|40395_40650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016922247.1|40839_41055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799117.1|41106_42021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799116.1|42020_42920_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002350572.1|42919_43507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042957131.1|43741_44170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350574.1|44274_44469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799115.1|44541_45444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350576.1|45460_45937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016922336.1|45952_46552_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP019971	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence	129683	68921	109718	129683	transposase,protease	Streptococcus_phage(41.67%)	48	NA	NA
WP_002326066.1|68921_69875_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.1e-34
WP_002347509.1|70389_70755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347508.1|70760_71504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347507.1|71634_72357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347506.1|72362_72608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347505.1|72618_73203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347719.1|73324_74908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729677.1|75164_75500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|75706_76855_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|76871_77276_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002347721.1|77361_77619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320766.1|77785_79756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320767.1|79770_80637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|80626_80860_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002347429.1|80871_83028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033624104.1|83047_83269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|83378_83717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347432.1|84116_87758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730985.1|87760_89710_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.9e-30
WP_002321771.1|89751_90810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320776.1|90928_91384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320777.1|91967_92771_-	replication initiation protein	NA	NA	NA	NA	NA
WP_025480441.1|93728_94952_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_010729833.1|94986_95754_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320781.1|95945_96344_+	antitoxin HicB	NA	NA	NA	NA	NA
WP_079158048.1|96563_96968_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.1	1.6e-52
WP_002323589.1|96984_98133_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_025478686.1|98541_98937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350538.1|98937_99315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320784.1|99304_99700_-	antitoxin HicB	NA	A0A0C5AN56	Paenibacillus_phage	39.7	4.1e-16
WP_002320785.1|99766_99952_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0A7RWW9	Clostridium_phage	40.4	7.6e-05
WP_002347534.1|100033_100288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347535.1|100309_100546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347536.1|100561_100846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347537.1|100948_101131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|101363_102050_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002303114.1|102537_102888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127821124.1|102944_103631_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.0e-126
WP_002347151.1|103678_103897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303415.1|103944_104217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303414.1|104206_104416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349053.1|104546_104867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303412.1|105129_105438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347150.1|105611_105980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347149.1|106093_106909_-	replication initiation protein	NA	NA	NA	NA	NA
WP_002354485.1|106986_107673_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000026576.1|108044_108335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059355959.1|108539_109718_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
>prophage 1
NZ_CP019972	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-2 sequence	128951	8323	57124	128951	protease,transposase	Streptococcus_phage(61.54%)	44	NA	NA
WP_002311842.1|8323_8767_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002311843.1|8911_9235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079158051.1|9652_13282_+	collagen-binding protein	NA	NA	NA	NA	NA
WP_002311845.1|13341_13704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311847.1|13937_14360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311848.1|14371_15787_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_002313315.1|15803_16619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311850.1|16618_17416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311851.1|17433_17796_+	DUF4320 family protein	NA	NA	NA	NA	NA
WP_002326867.1|17967_18189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311852.1|18207_18483_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_002311853.1|18591_20418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311854.1|20430_21147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311855.1|21159_24018_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002313318.1|24068_26705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326869.1|26728_27064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311858.1|27060_27678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311859.1|27693_28161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305177.1|30489_32367_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	9.1e-29
WP_002354485.1|32428_33115_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002288897.1|33204_33828_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_002305130.1|34050_34239_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	66.1	1.7e-15
WP_002305129.1|34284_34662_+	antitoxin HicB	NA	A0A1X9I5X0	Streptococcus_phage	52.1	6.9e-29
WP_002311882.1|35221_36394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311876.1|37062_37419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311875.1|37443_38448_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002287522.1|38806_39211_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|39227_40376_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002311872.1|41724_43551_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002354485.1|44427_45114_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_073120187.1|46210_46783_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_000170424.1|47255_47828_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_000599739.1|47843_48449_-	cell filamentation protein	NA	NA	NA	NA	NA
WP_002325565.1|48646_49327_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002311861.1|49681_50818_+	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	39.3	1.6e-52
WP_002311862.1|50832_51483_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002311863.1|51496_52393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311864.1|52428_52659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311865.1|53009_53306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311867.1|53302_53770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311868.1|53836_55372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311869.1|55393_55723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311870.1|55724_55988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|56437_57124_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 2
NZ_CP019972	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-2 sequence	128951	116598	127393	128951	transposase	Streptococcus_phage(100.0%)	14	NA	NA
WP_002354485.1|116598_117285_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001835296.1|117574_117790_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_000301765.1|117806_118079_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|118080_118944_+	toxin zeta	NA	NA	NA	NA	NA
WP_023843711.1|119122_119263_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001038796.1|119207_119945_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|120069_120153_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|120694_121489_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002297218.1|122078_123374_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002324522.1|123474_124383_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002347175.1|124385_124634_-	hypothetical protein	NA	A0A1B0RXL7	Streptococcus_phage	96.1	9.5e-27
WP_044384724.1|124630_125521_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	100.0	3.7e-174
WP_002354485.1|125585_126272_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001092058.1|126730_127393_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	30.3	5.9e-07
>prophage 1
NZ_CP019973	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-3 sequence	56285	9353	21871	56285	transposase	Streptococcus_phage(33.33%)	15	NA	NA
WP_010730992.1|9353_10409_+	ParM/StbA family protein	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	31.7	4.0e-42
WP_010729838.1|10428_10782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320793.1|10963_11260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002360989.1|11263_12082_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010729836.1|12307_12529_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_010729835.1|12530_12797_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_002354485.1|13326_14013_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001226076.1|14239_14815_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.8	9.0e-20
WP_002323245.1|15036_16209_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|16360_17056_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|17033_18188_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|18402_19371_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|19363_20395_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|20400_21009_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_002354485.1|21184_21871_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
