The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	7732	78856	4966744	transposase,protease	Ralstonia_phage(30.0%)	56	NA	NA
WP_011407164.1|7732_8569_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8755_9562_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9838_11032_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11185_11857_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11941_12703_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12749_13172_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13175_13589_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13884_14652_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14662_14932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15006_16467_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17113_18124_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18395_19598_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19739_21878_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22088_22382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22413_22911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23157_24138_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24185_25352_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25498_26065_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27539_28748_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29375_30398_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31220_32189_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_143683679.1|33017_33326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128896914.1|33581_34517_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.7e-05
WP_012443646.1|35118_36495_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_109181928.1|38166_39132_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443643.1|39507_39750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39691_40015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40480_41461_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42079_43369_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43808_44144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44418_44850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45198_46608_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|46885_47101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47925_48186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48202_48535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48534_48993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49352_50567_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51087_51885_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53600_54566_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54562_54841_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407196.1|54984_56304_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56421_57468_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57608_58106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325197.1|58269_58902_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58918_61081_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61195_61381_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61403_64007_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|64003_65893_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65949_67707_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67709_69944_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69940_71524_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71997_73626_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73622_74987_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75179_76121_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76361_78086_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181946.1|78092_78856_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	109373	135589	4966744	transposase	Ralstonia_phage(50.0%)	23	NA	NA
WP_011258529.1|109373_110342_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407218.1|110554_111874_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|112062_113046_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407220.1|113767_116140_+	HPr kinase	NA	NA	NA	NA	NA
WP_027703833.1|117015_118644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119201_119585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119581_120067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|120070_120433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120549_121986_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122227_123079_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123538_123856_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124161_125049_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125755_126706_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126819_127029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|127096_127369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127409_127691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127829_128888_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|129028_129976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130230_130542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|132008_132479_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132648_133341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133432_133831_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134632_135589_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	221023	384918	4966744	tRNA,transposase,holin	Bacillus_phage(16.67%)	112	NA	NA
WP_011257198.1|221023_222928_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|223188_223368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|223501_223969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|224126_225086_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|225070_225688_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|225730_226150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257201.1|226402_227308_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|227556_228441_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|228504_229287_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082325376.1|229331_230093_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|230256_230586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|230904_231996_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|232064_233663_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|233827_235072_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|235523_236153_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|236359_238336_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|239722_240388_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|240674_241685_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|241681_242413_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|242766_244296_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_082325203.1|244405_247438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257218.1|247736_250775_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|250939_251992_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|252160_252406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|252404_253370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|253369_256030_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|257848_258067_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257225.1|260625_261111_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_109182060.1|261142_261469_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257226.1|261690_262335_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|262475_263366_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|263493_263976_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|267011_267545_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|270360_271419_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|271726_272800_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|273562_274615_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|275262_276393_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|277709_278099_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|278306_278513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|278744_279713_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|279966_282129_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_113248444.1|282676_283981_+	TCR/Tet family MFS transporter	NA	NA	NA	NA	NA
WP_011407319.1|284040_284643_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|284639_286544_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|295890_296706_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|297052_298015_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|298119_298882_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|300681_301740_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|301750_302041_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|302030_302693_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|302689_303241_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|303252_304002_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|304001_304796_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|305180_305468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|305486_306044_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|306061_307027_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|307871_308828_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|308899_309662_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|309701_310500_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|310631_311846_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|311905_312736_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|312898_314134_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|315532_315961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|315980_316421_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|316323_316629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|316936_318691_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_094187715.1|319562_320325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|320378_320963_-	gluconokinase	NA	NA	NA	NA	NA
WP_027703801.1|321120_322503_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|322505_324905_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325008_327651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|328398_331848_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332040_332625_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333101_333878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334058_335360_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|335356_335722_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336158_337640_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|337832_338798_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|339624_341787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959687.1|341913_344082_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|344719_345349_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|345351_345783_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_094187815.1|345875_346418_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|346513_347266_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|347490_347880_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|347993_349667_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|349663_350308_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|353992_354277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|354628_355427_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|355486_356250_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153303304.1|358801_360121_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360204_361170_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|362230_363337_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365130_366069_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011407377.1|366187_366937_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
WP_012446343.1|366939_367731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|367748_368744_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_011257315.1|368846_369608_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|369692_370694_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|370759_371032_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|371152_371314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|371517_372105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372101_372302_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|372362_373964_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|373995_374742_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_082325205.1|374738_375932_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|376341_377364_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|377503_379069_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379079_380093_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380082_380784_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|380967_383982_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384155_384918_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	762671	804963	4966744	tRNA,transposase	Enterobacteria_phage(33.33%)	34	NA	NA
WP_151420427.1|762671_763991_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|764306_765491_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|766020_767334_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|767323_768142_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|768364_769306_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|769305_770052_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|770277_771333_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|771388_772276_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|772272_772830_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|772826_773735_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|773851_775255_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|775301_776648_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|776781_777513_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|777512_778142_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|778199_780287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|780283_781933_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|782048_782657_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|783207_783852_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|783848_784775_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|784777_785620_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|785705_786818_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|786987_788247_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|788308_788770_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|788912_790607_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|790718_791123_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|791254_792028_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|792038_792506_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|792511_792985_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407625.1|793543_794863_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407626.1|795020_796340_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|796552_797521_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_099051332.1|799223_801269_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_011257702.1|801535_802576_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|804165_804963_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	865709	909768	4966744	transposase,protease	Ralstonia_phage(25.0%)	37	NA	NA
WP_153303305.1|865709_866675_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|867065_867641_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|867753_868263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|868361_868556_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|868645_869623_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|869852_870293_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|870570_871515_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|871597_872341_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|872545_872785_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|872926_874162_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|874332_875688_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|875748_876822_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_082325226.1|876818_877778_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011407663.1|878651_879125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|880144_880471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|880706_882305_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|882450_883347_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|883422_884577_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|884757_887349_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|887671_887809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|888081_889281_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|889730_890699_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|890939_893156_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|893234_894233_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|894342_894525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|895504_898492_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|898666_899614_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|900119_900656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129593127.1|900726_902046_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|902390_903353_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|903487_904048_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|904090_904573_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|904735_905212_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_014502287.1|905622_906522_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	4.5e-18
WP_011257782.1|906761_907148_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|907777_908905_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_027703756.1|908904_909768_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 6
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	915069	1074252	4966744	integrase,transposase,protease	Ralstonia_phage(20.0%)	112	1006616:1006634	1071363:1071381
WP_011257788.1|915069_915852_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_082325228.1|917582_918218_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|918844_919378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|919503_919701_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|919710_920823_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_027704169.1|920803_922138_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_027704168.1|922371_923292_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|923368_924685_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|924957_926337_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|926357_927014_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|927142_927796_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|928066_928528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|929587_930472_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|930592_932041_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|932108_932756_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|933572_934646_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|934976_936539_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|936535_937660_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|937735_937993_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|937976_939698_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|939741_940743_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|942019_943897_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|944322_946674_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|946784_947678_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187800.1|947723_950693_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_094187799.1|951307_952423_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|952569_953106_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|953302_953785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|956072_957038_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|957034_957208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|957492_957984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|959663_960920_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|961079_961643_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|962009_963368_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|963367_963964_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|964110_964995_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|966976_967591_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|967673_968660_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|968775_969270_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|969514_971344_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|971362_971833_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|972755_973883_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|973983_975366_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|975613_977737_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|978265_978784_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|979489_980591_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|981106_982342_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|982955_983846_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011407713.1|987635_988871_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|989853_991173_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|991918_992842_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|993904_994870_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|995171_996749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|996816_997580_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1000248_1001217_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1001477_1001939_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1002487_1002730_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1002723_1003487_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1003519_1004251_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1006070_1006823_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1006616:1006634	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1006824_1007790_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1008053_1009061_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1009204_1009966_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1013283_1014576_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1014668_1015295_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1015419_1016706_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1016849_1019321_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1019534_1019807_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1020638_1022609_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_041182774.1|1023335_1024514_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1024510_1025278_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1025290_1025947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1025974_1026427_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_075243611.1|1026435_1027170_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1027605_1028310_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1029135_1029765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1030656_1030857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1031252_1033976_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1034043_1036194_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1036190_1037888_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257897.1|1038207_1040412_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1040408_1042103_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_075239641.1|1042099_1042363_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1042424_1042982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1043064_1044030_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1044128_1044815_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1044925_1045330_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1045540_1046590_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1046610_1047360_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1047359_1048109_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1048108_1049140_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1049157_1049517_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1049541_1050039_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1050035_1050281_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1050277_1050724_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1051285_1053382_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1053388_1053709_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1053806_1054400_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1054501_1054852_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1054971_1055505_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1055501_1057454_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1057446_1058403_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1058408_1059362_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1059400_1061269_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1062784_1063300_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1063816_1064575_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1065047_1065794_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1066410_1068012_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1069000_1070236_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1071064_1072033_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1071363:1071381	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1072500_1072851_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1072932_1074252_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	1133240	1195648	4966744	transposase	Orpheovirus(25.0%)	50	NA	NA
WP_099051298.1|1133240_1134038_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1134186_1134486_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1134614_1136786_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1136865_1137246_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1137266_1139420_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1139545_1140484_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1140555_1140798_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1141011_1142301_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1142678_1143329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1143638_1146161_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1146283_1147342_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1147341_1148100_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1148096_1148762_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1148758_1149292_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1149311_1151261_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1151331_1152130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1152272_1153508_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1153578_1154613_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258000.1|1155235_1156255_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011258001.1|1156275_1157238_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1157240_1157702_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1157698_1158706_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_082325235.1|1158702_1160505_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1160501_1162259_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1162554_1162872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1163069_1164350_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1164569_1166570_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1167388_1168105_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011407808.1|1168107_1169100_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1169419_1172134_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1172253_1173429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1173563_1175522_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1175697_1176345_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1176341_1177841_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1177837_1178512_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1178511_1179351_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1180017_1180716_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1180733_1182095_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1182194_1182560_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407821.1|1182549_1183866_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1183862_1184447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1184789_1185404_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1185403_1186096_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407824.1|1186106_1186883_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1186953_1187784_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445839.1|1187797_1188571_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1191644_1191785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1192441_1193443_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181945.1|1193830_1194593_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153303306.1|1194682_1195648_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	1200220	1278151	4966744	transposase	Xanthomonas_phage(50.0%)	56	NA	NA
WP_113081219.1|1200220_1201205_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1201379_1203467_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1203618_1204278_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1204358_1205156_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1205178_1205358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1205376_1205781_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1205814_1206174_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1206417_1207290_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1207362_1208589_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1208834_1209452_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011407845.1|1211012_1212596_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1212592_1213018_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1213042_1213546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1214988_1215438_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1218684_1219974_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_103057244.1|1221987_1223439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258055.1|1223935_1224805_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1224826_1225498_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|1225494_1225716_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082325237.1|1225889_1228898_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|1229121_1229421_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|1229424_1229619_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_153303307.1|1229887_1233283_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182759.1|1233422_1233722_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
WP_041182100.1|1233725_1233920_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_153296744.1|1233986_1234133_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_082325238.1|1234188_1238613_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408408.1|1238836_1239136_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_041182100.1|1239139_1239334_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_082325239.1|1239602_1243319_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258066.1|1244790_1245855_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_011407864.1|1245869_1246121_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258068.1|1246422_1247535_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011258069.1|1247531_1248074_-	shikimate kinase	NA	NA	NA	NA	NA
WP_011258070.1|1248240_1248840_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1249020_1249437_+	YjfI family protein	NA	NA	NA	NA	NA
WP_011258072.1|1249449_1250223_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_011258073.1|1250248_1251331_+	potassium channel protein	NA	NA	NA	NA	NA
WP_094187792.1|1251333_1252005_+	YjfK family protein	NA	NA	NA	NA	NA
WP_011407869.1|1252042_1252447_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_011258076.1|1252459_1253032_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011258077.1|1253033_1254200_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011258079.1|1256179_1256626_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_069959759.1|1256845_1258852_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187791.1|1259910_1263057_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407875.1|1263388_1264141_+	SapC family protein	NA	NA	NA	NA	NA
WP_011407876.1|1264151_1265198_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011258084.1|1265238_1266756_+	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_011258085.1|1266793_1267798_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407877.1|1267942_1268341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407879.1|1268903_1270301_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011407881.1|1270755_1272138_-	APC family permease	NA	NA	NA	NA	NA
WP_011407882.1|1272330_1273095_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258090.1|1273408_1274350_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011258091.1|1275105_1276494_+	amino acid permease	NA	NA	NA	NA	NA
WP_011257854.1|1276915_1278151_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	1445208	1582500	4966744	tRNA,transposase	Ralstonia_phage(19.23%)	104	NA	NA
WP_109181897.1|1445208_1446174_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258243.1|1446553_1447231_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1447768_1447993_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1447992_1450065_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1450296_1451154_+	pirin family protein	NA	NA	NA	NA	NA
WP_082325378.1|1452189_1454592_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	6.0e-41
WP_027704078.1|1454646_1455507_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080493518.1|1455467_1456154_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1456143_1457556_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|1457565_1459989_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_011258529.1|1460679_1461648_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_041182394.1|1463087_1463636_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1464030_1464588_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1464637_1466746_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|1466767_1468669_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1468723_1469584_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_129593120.1|1469535_1470231_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1470694_1470928_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1471148_1471715_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082325241.1|1472500_1474909_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1475253_1475715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1475961_1476852_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1477029_1477548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1477619_1478333_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1478436_1479186_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1479546_1479798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1480130_1482188_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1484135_1485257_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1485271_1486099_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1486082_1487366_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1487392_1487908_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1487918_1490075_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1490142_1492140_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1492158_1492488_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1492527_1492746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1492977_1496442_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1496844_1497387_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1497798_1498707_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1499052_1499851_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1499994_1500714_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1500869_1501904_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1501924_1502737_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1503472_1503856_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1503978_1505148_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_082325242.1|1505142_1506201_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.3	6.0e-70
WP_011408017.1|1506261_1507074_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075251837.1|1507589_1507973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408019.1|1508113_1509277_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1509307_1510120_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258802.1|1510869_1511838_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407237.1|1512396_1513353_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1513426_1514158_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1514179_1515283_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1515351_1516755_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1516768_1517275_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1517680_1518139_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1518916_1519120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1520681_1521167_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1521394_1521610_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1521860_1522340_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1522471_1522900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258297.1|1522972_1523803_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_012444390.1|1523864_1524632_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1524631_1524847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1524992_1525784_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|1525941_1527105_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1529338_1529977_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1530152_1532093_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1532309_1532864_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1533085_1534516_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1534582_1536037_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011258309.1|1536453_1537179_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1537277_1537688_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1537739_1538696_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1538939_1541321_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258314.1|1543963_1544374_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1544673_1544856_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1544988_1546029_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1546101_1547547_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1549077_1550046_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1550203_1550749_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1550745_1552209_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1553669_1553924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1554326_1554860_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1554885_1555287_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1555255_1555636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1555632_1555875_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075242556.1|1555911_1556565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1557241_1559146_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1559409_1561806_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1561955_1562678_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1565597_1566098_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1566039_1567716_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1567862_1569128_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1569186_1570380_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1570376_1571066_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_069964938.1|1571171_1572641_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1572660_1573497_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_059317474.1|1573522_1574626_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_082325243.1|1574622_1577679_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1577744_1578335_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1578466_1580299_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1580374_1581138_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1581180_1582500_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	1634742	1717949	4966744	tRNA,transposase	Hokovirus(16.67%)	60	NA	NA
WP_109181906.1|1634742_1635540_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182403.1|1635685_1636141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|1636395_1637139_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408089.1|1637250_1637754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408090.1|1637981_1638887_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408091.1|1638957_1639728_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011258392.1|1639751_1640216_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075242206.1|1640329_1640737_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012444462.1|1640733_1643700_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_011258394.1|1643992_1644313_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011258395.1|1644325_1644586_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258396.1|1644818_1645871_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003484323.1|1645962_1646232_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_082325247.1|1646348_1647953_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_082325248.1|1648151_1649168_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_082325249.1|1649174_1652006_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.1	1.4e-41
WP_024711667.1|1652320_1652839_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_048488678.1|1652905_1653856_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1654369_1655305_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1655304_1657305_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|1657307_1657934_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1657933_1658269_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_011258405.1|1658618_1660316_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|1660540_1662787_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_041182048.1|1662810_1664430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408101.1|1664573_1669157_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_125168749.1|1669146_1669746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181910.1|1671481_1672583_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_011408105.1|1674458_1677014_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_012445369.1|1679983_1681378_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011258422.1|1682765_1684322_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|1686905_1688144_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1688584_1688878_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1689375_1690152_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1690309_1692076_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258428.1|1692587_1693115_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1693214_1693892_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1693981_1694710_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1694824_1695349_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1695506_1696091_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1696290_1698198_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1698326_1699364_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1699416_1699875_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012445351.1|1699886_1700666_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1700822_1701272_+	protein TolR	NA	NA	NA	NA	NA
WP_044756956.1|1701261_1702302_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_041182054.1|1702561_1703881_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1703938_1704457_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1704463_1705282_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1705324_1706008_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_019301562.1|1706837_1706948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408120.1|1707237_1707948_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|1708182_1708389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408122.1|1708592_1709021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113233824.1|1709024_1709585_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	9.4e-14
WP_103057679.1|1710182_1710761_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011257031.1|1711611_1712580_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257310.1|1714456_1715692_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1715742_1716506_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1716572_1717949_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
>prophage 11
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	1921276	1980052	4966744	tRNA,transposase,protease	Acidithiobacillus_phage(25.0%)	49	NA	NA
WP_011258626.1|1921276_1924105_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1924165_1925266_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1925734_1926262_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1926663_1926837_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1926997_1927252_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1927426_1927693_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1927883_1928450_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1929937_1931257_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1931649_1931835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1932024_1933401_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1933540_1934014_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1935685_1936735_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1936849_1937185_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1937473_1937764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1938654_1939773_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1939993_1941205_+	MFS transporter	NA	NA	NA	NA	NA
WP_103057306.1|1941375_1941537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258643.1|1943127_1943583_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1943856_1944459_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1944494_1945103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1945162_1945357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1945426_1946797_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1947081_1947844_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408287.1|1948235_1950800_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|1951780_1952128_+	RidA family protein	NA	NA	NA	NA	NA
WP_011408291.1|1952289_1953360_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408292.1|1953377_1954160_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011408293.1|1954156_1954702_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011408294.1|1954698_1955994_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_099051285.1|1955990_1956950_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011408296.1|1956874_1958125_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|1958121_1959120_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_153303309.1|1959345_1960191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|1960175_1960739_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|1960797_1961166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464748.1|1961251_1962034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408301.1|1962652_1963081_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_012445212.1|1963082_1963679_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|1963868_1965953_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|1966177_1966627_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1967390_1968449_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1968719_1970117_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1970113_1971091_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1971272_1973210_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1973630_1974407_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1974411_1975086_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1976716_1978093_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1978132_1978528_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082325258.1|1978570_1980052_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
>prophage 12
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2074140	2196123	4966744	tRNA,transposase	Ralstonia_phage(13.64%)	91	NA	NA
WP_109181923.1|2074140_2075460_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2075794_2076721_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2076850_2077456_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2077794_2079564_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_011258750.1|2079560_2080154_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2080421_2081015_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2081213_2082650_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2082891_2084094_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2084136_2086965_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2087145_2088078_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2088074_2089574_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2089911_2090175_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2090454_2090955_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2091196_2092564_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2095587_2096350_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296746.1|2096310_2096454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2097802_2099206_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2099328_2099751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2100383_2101220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756884.1|2101229_2102216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2102212_2103088_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2103084_2103447_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2103449_2103698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2103833_2104391_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2104482_2105448_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2105473_2106823_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2106815_2107052_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2107052_2107805_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2108138_2108984_+	transporter	NA	NA	NA	NA	NA
WP_082325382.1|2109124_2110300_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011408378.1|2110313_2111624_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_103057264.1|2111548_2112607_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2112603_2113809_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_082325261.1|2114195_2116949_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2117091_2118231_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2118227_2119223_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057266.1|2119344_2120493_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2120492_2120633_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2121004_2122450_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2123016_2125545_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2125755_2126554_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2127624_2128392_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2128393_2128741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|2128899_2129868_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181928.1|2131220_2132186_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2132630_2133815_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2133869_2135345_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2135666_2135849_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2135997_2137197_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_153303311.1|2139241_2140561_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|2140710_2141679_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181933.1|2142855_2143958_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2144144_2144612_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258821.1|2144972_2145737_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2145743_2147093_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2147242_2148041_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153303312.1|2148480_2149800_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2150012_2150981_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2151044_2151629_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2151728_2152742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2153432_2153699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|2153942_2154038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325264.1|2154111_2157627_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2157850_2158150_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2158153_2158348_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_115840167.1|2158616_2162423_-	avirulence protein	NA	NA	NA	NA	NA
WP_082325265.1|2165606_2169734_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408412.1|2170022_2171342_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2173173_2174259_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2174586_2175285_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2175287_2175854_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2175865_2176543_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2176631_2178062_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2178138_2179620_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2179756_2180344_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2180499_2181741_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2181949_2183368_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2183402_2183702_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2183698_2185570_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258847.1|2185859_2186879_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2186872_2187283_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2187300_2187903_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2187895_2189833_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2190001_2190472_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2190468_2190639_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2190635_2191388_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258853.1|2191482_2192178_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2192174_2192819_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2193045_2194194_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2194333_2195137_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2195157_2196123_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2298493	2346058	4966744	coat,transposase,capsid	Xanthomonas_phage(81.25%)	60	NA	NA
WP_094187798.1|2298493_2299292_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2299605_2299932_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2299941_2300856_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2300852_2302148_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2302144_2303236_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2303232_2304360_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2304356_2304959_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2304955_2305690_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2305683_2306460_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2306449_2307070_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_082325269.1|2307655_2311477_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2311701_2312001_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2312004_2312199_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011258951.1|2316308_2317088_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2317129_2317228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2317981_2318167_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2318166_2318370_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2318505_2319579_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2319683_2319983_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2320346_2320586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2320692_2322177_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2322178_2322499_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2322495_2323680_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2323734_2323905_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2325013_2325274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325271.1|2325480_2325864_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	92.9	3.0e-64
WP_075241061.1|2326430_2326751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325272.1|2326986_2327235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325273.1|2327352_2328675_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	56.1	1.8e-132
WP_082325274.1|2328676_2328997_-|coat	phage coat protein	coat	Q4LAU3	Stenotrophomonas_phage	44.2	3.5e-21
WP_075241205.1|2329007_2329247_-	hypothetical protein	NA	Q94MX3	Xanthomonas_phage	97.5	1.3e-36
WP_153303313.1|2329331_2329904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075241186.1|2330159_2330288_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_153303314.1|2330318_2330435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117231554.1|2330380_2330542_-|coat	coat protein	coat	NA	NA	NA	NA
WP_082325276.1|2330573_2330870_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	66.3	2.5e-26
WP_082325277.1|2330866_2331973_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	74.7	3.8e-160
WP_011408508.1|2332125_2332338_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_047339861.1|2332337_2332523_-	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	98.4	5.4e-27
WP_082325278.1|2332651_2333050_+	hypothetical protein	NA	A0A1D6ZIU9	Xanthomonas_phage	47.2	1.1e-19
WP_069959845.1|2333776_2334088_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_113085484.1|2334112_2334325_-	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959846.1|2334380_2334674_-	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_069959847.1|2334834_2335482_-	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959848.1|2335483_2336677_-	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_011408503.1|2336676_2337006_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959849.1|2337005_2338412_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011347634.1|2338548_2338779_-	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_042464854.1|2338790_2338994_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_069959850.1|2338997_2339294_-	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_080496434.1|2339290_2340331_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.1	7.7e-203
WP_011408508.1|2340483_2340696_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_011408509.1|2340695_2340881_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
WP_069970101.1|2341008_2341638_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2341762_2341945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2342066_2342378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2342447_2343210_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2343714_2344038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2344651_2345164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2345295_2346058_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2355911	2413737	4966744	transposase	Xanthomonas_phage(23.08%)	47	NA	NA
WP_109181946.1|2355911_2356674_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296744.1|2356693_2356840_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|2356905_2357100_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2357103_2357403_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|2357627_2361644_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2361817_2362039_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2362035_2362707_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2363732_2363978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2363961_2364918_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|2365332_2366301_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_153303315.1|2366445_2367411_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2367388_2371489_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2371797_2372982_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2373032_2373932_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2374098_2374605_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2375079_2375712_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2375711_2377568_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2377564_2379064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2379006_2379471_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2379467_2380247_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2380538_2381579_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2381575_2383345_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2383341_2383806_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2383809_2384472_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2384500_2386909_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2387162_2388128_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2389521_2390256_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2390248_2391490_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2391513_2391966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2391916_2392165_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2392275_2393058_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2393074_2393284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2393287_2395078_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2395112_2395499_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2395495_2395891_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2395950_2396217_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2396160_2397033_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2397161_2398259_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2398688_2400119_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2400115_2401123_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2401119_2401839_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2401941_2403858_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2403913_2404573_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2406199_2406403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2407418_2407799_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2408013_2411409_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2412974_2413737_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2526707	2574803	4966744	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2526707_2528102_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2528103_2528361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2528357_2528663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2528659_2528986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2529712_2530375_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2530463_2530994_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2533217_2534489_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2534660_2536028_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_012444800.1|2536331_2537777_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2537773_2538460_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2538432_2539452_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2539493_2540054_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2540074_2541031_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2541198_2541975_-	NAD kinase	NA	NA	NA	NA	NA
WP_082325285.1|2542458_2544594_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2544590_2544782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2546556_2547063_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2547103_2547631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2547627_2548119_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2548142_2548718_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2548794_2549748_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2549836_2550709_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2550705_2551473_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2551663_2552362_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2552525_2553308_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2553316_2553697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2553693_2554404_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2555714_2556263_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2556434_2557403_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408623.1|2558007_2559243_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2559806_2560127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2560466_2561717_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2561851_2562925_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2563112_2564204_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2564316_2565291_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2565290_2566160_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2566182_2567013_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2567141_2567852_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2567984_2568392_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2568669_2569311_+	ribonuclease T	NA	NA	NA	NA	NA
WP_153303316.1|2569381_2570701_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2570937_2571999_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2572049_2573234_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_153303317.1|2573483_2574803_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2581522	2653702	4966744	tRNA,transposase,protease	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
WP_011259125.1|2581522_2582668_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2582737_2583808_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2583987_2584419_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2584542_2586039_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2586383_2587091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2590428_2591550_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2593822_2594248_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2594440_2595073_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2595469_2596232_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2596512_2597544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2597550_2599344_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2599340_2599625_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2599856_2600342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2600400_2600907_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2600903_2601524_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2601764_2603669_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2603756_2604814_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2604911_2606231_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2606464_2607622_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2607898_2608864_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2608841_2610317_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2612856_2613825_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069970072.1|2613900_2614857_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_075243670.1|2615150_2615390_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2617265_2618486_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2618800_2620198_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2620208_2621429_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2621425_2622064_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2622134_2622995_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2622991_2623780_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2623790_2624996_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2625014_2625440_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2625658_2626291_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2626315_2628688_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2628845_2630051_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2630371_2631703_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2631699_2632050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2632081_2632489_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2632485_2632812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2632843_2634220_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2634456_2638623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259178.1|2638735_2639365_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2639471_2641400_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2641562_2643923_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2644206_2645175_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2645232_2646354_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2647781_2648534_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2648614_2648833_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2649113_2651396_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2651539_2651860_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2652110_2652569_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2652565_2653702_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2735483	2768037	4966744	transposase	Ralstonia_phage(33.33%)	15	NA	NA
WP_011258529.1|2735483_2736452_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_128896930.1|2736546_2737083_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_103073433.1|2737115_2741951_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.4e-09
WP_011407175.1|2743868_2744837_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|2746461_2746941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2755065_2755458_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2755466_2755928_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2756348_2756747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2758450_2759416_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2759422_2760721_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2760889_2762575_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075243754.1|2762571_2764308_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.1e-15
WP_082325289.1|2764907_2765864_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011259267.1|2766666_2766930_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2767071_2768037_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	2784915	2835194	4966744	tRNA,transposase,protease	Moumouvirus(11.11%)	43	NA	NA
WP_011259285.1|2784915_2786346_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2786843_2787281_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2787277_2788528_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2788595_2789657_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2789799_2790840_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2790930_2791212_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2791208_2792558_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011259291.1|2792497_2793397_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_109181916.1|2794295_2795057_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2795083_2795347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|2796068_2797103_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408733.1|2797546_2798863_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2799062_2800031_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408734.1|2800167_2801487_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2801846_2803028_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2804616_2806287_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2806503_2807193_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2807221_2807926_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2807999_2808719_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011408737.1|2808749_2810099_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_094187830.1|2810106_2810943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2811101_2811668_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2811769_2812798_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2813016_2815134_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187831.1|2815130_2816051_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2816111_2816876_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2816994_2817828_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2818080_2818692_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2818946_2819387_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2819383_2819809_+	barstar family protein	NA	NA	NA	NA	NA
WP_011259317.1|2820257_2822153_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_011259318.1|2822242_2823619_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2823721_2824282_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2824379_2825936_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2826219_2827095_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408743.1|2827295_2827994_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2828164_2828374_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2828643_2829129_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2829199_2829748_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2829744_2830926_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2831149_2833219_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2833318_2834197_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2834294_2835194_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 20
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3013794	3094884	4966744	tRNA,transposase	uncultured_Caudovirales_phage(44.44%)	54	NA	NA
WP_011408813.1|3013794_3014754_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3014686_3015001_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_143699981.1|3017878_3018262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|3018880_3019111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3019368_3020336_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|3020992_3021493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187833.1|3021801_3024843_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|3025892_3026345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|3026599_3028405_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|3028406_3028754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|3028829_3029537_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|3029688_3030081_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075242238.1|3030103_3030619_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3030615_3030969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3031057_3031798_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3031804_3032779_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3032780_3033563_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3033559_3034582_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3034682_3034991_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3034987_3035353_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|3035386_3037396_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|3037570_3037825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|3039503_3040193_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|3040508_3041270_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|3041283_3043626_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_011258188.1|3043928_3044897_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182116.1|3045283_3046249_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082325298.1|3046489_3048748_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.9e-13
WP_069964640.1|3049478_3051590_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	2.5e-14
WP_044757389.1|3052273_3054349_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_069964556.1|3054942_3057204_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011259432.1|3057597_3059859_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259433.1|3060816_3061614_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3061749_3062232_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3063080_3063878_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408843.1|3064139_3064445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408844.1|3064523_3066923_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.9e-09
WP_011408845.1|3067181_3068048_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|3068044_3068641_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|3068637_3069714_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|3069822_3072066_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|3072721_3073537_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011259443.1|3073890_3076482_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259444.1|3076547_3076958_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|3076954_3077203_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259446.1|3077350_3080119_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011259449.1|3080768_3082451_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011408848.1|3082627_3083497_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_082325299.1|3083508_3085686_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|3086050_3087187_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_011408850.1|3087328_3088846_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
WP_014503214.1|3089049_3090175_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_041182178.1|3090428_3091376_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959908.1|3094182_3094884_+|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
>prophage 21
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3143051	3154826	4966744	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3143051_3143351_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3143393_3143624_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3143867_3144617_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3144621_3145317_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3145252_3145480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3145502_3145802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3146189_3146594_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3147319_3147532_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3147671_3150320_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3150421_3150910_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3151212_3152247_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3152419_3153061_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3153149_3154826_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 22
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3195102	3274499	4966744	transposase,plate	Xanthomonas_phage(44.44%)	57	NA	NA
WP_011407237.1|3195102_3196059_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3196157_3197270_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3197266_3198397_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3198518_3199217_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3199213_3200449_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3200461_3201304_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3201584_3202436_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_042465636.1|3202481_3203615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325301.1|3203611_3204562_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011408910.1|3204558_3205812_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_011408911.1|3205808_3206921_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	1.4e-29
WP_011408912.1|3206920_3207853_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408913.1|3207839_3208793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3208796_3209468_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3209464_3209896_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3210290_3210821_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3210904_3212245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3212270_3212663_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_082325385.1|3213105_3213894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3213957_3214539_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_094187764.1|3214430_3215192_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3215188_3216514_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_069964830.1|3216524_3217283_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011408923.1|3217279_3217486_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3217482_3217953_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011259570.1|3218016_3220005_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3220001_3220544_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3220543_3221041_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_044756732.1|3221040_3221745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325302.1|3221953_3225673_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3225941_3226136_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3226139_3226439_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_082325303.1|3226662_3231012_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|3231280_3231475_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408408.1|3231478_3231778_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_082325304.1|3232001_3236957_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444515.1|3238019_3239495_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3239577_3242166_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3242222_3243335_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3243459_3244038_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3245524_3247612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325305.1|3247997_3249095_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3249511_3252592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3255627_3256335_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3256331_3257324_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3257320_3259780_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3259893_3260874_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3260882_3261911_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3262077_3262875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3262937_3263735_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408943.1|3263795_3264122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408944.1|3264118_3267022_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3267018_3267741_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3267737_3268385_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|3268381_3271840_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3271843_3273160_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3273161_3274499_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 23
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3283463	3357811	4966744	transposase,plate	Ralstonia_phage(75.0%)	53	NA	NA
WP_011408954.1|3283463_3284474_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3284437_3286315_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3286318_3286822_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3286809_3287643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3287678_3288182_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3288281_3289796_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3289788_3290295_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3291653_3292622_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|3292757_3294074_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|3294244_3295480_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153303311.1|3295610_3296930_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3297142_3298111_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3298162_3300079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113262626.1|3300103_3300286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3301928_3304271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3304288_3305035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325208.1|3305251_3306220_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.5e-99
WP_082325307.1|3306271_3309058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3309715_3311545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3311558_3312158_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3312245_3312602_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3312598_3313021_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3313036_3313270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960235.1|3313296_3313557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3313905_3315690_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3315722_3316709_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3317119_3320833_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3321358_3322122_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3322225_3322873_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3323094_3323856_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3324013_3324982_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3325115_3325481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3325539_3325971_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3325982_3327245_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3327228_3328521_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3328890_3329661_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011408979.1|3332953_3333211_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3333650_3334634_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3334949_3335918_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3336046_3337009_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3337258_3337417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3337448_3337628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3337992_3338958_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3340165_3341143_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3341951_3342146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3343539_3343902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3343885_3344455_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3344492_3345746_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3345951_3346329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3348257_3349493_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3350330_3351365_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408994.1|3352040_3354416_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_011408998.1|3356626_3357811_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
>prophage 24
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3492476	3552985	4966744	tRNA,transposase,protease	Burkholderia_virus(14.29%)	51	NA	NA
WP_094187736.1|3492476_3493240_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3494072_3494318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3494263_3496630_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3496626_3497301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3497510_3498449_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3498571_3499921_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3499917_3500805_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3501122_3501929_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3502374_3503592_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3503697_3504666_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3505078_3505747_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3505743_3506517_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|3507090_3509157_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3509723_3510749_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3510833_3511907_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3511899_3513003_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3513013_3513940_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3514020_3514671_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3514667_3515516_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3516066_3517650_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3519072_3520290_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3520250_3520538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3520648_3521155_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3521276_3522677_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3522939_3523515_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3523511_3523946_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3523973_3524141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3524918_3525104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3525138_3525708_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3525800_3526652_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3528039_3530055_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3530325_3531024_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3531064_3531472_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3531909_3532872_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3534155_3535406_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3535413_3536658_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3536885_3537365_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3537475_3538012_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3538121_3538871_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3539078_3539570_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3540683_3542003_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3542146_3543853_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3543886_3545191_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3545222_3545483_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3545484_3546360_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3548194_3548659_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3548710_3548899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963878.1|3548871_3549192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3549188_3550556_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3550701_3551283_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3551539_3552985_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 25
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3572085	3620757	4966744	tRNA,transposase,integrase	Ralstonia_phage(40.0%)	37	3594874:3594933	3611544:3612207
WP_082325314.1|3572085_3574728_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3574800_3575412_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_082325315.1|3575616_3576474_+	thioredoxin	NA	NA	NA	NA	NA
WP_027703806.1|3576729_3577179_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181988.1|3577478_3578444_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3578568_3579331_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756598.1|3579941_3580235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3580708_3580942_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3580975_3581989_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3581956_3582148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153303319.1|3582238_3583558_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3583645_3584860_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011259834.1|3585006_3585534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3585530_3586496_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3586736_3587499_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3587801_3589934_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3590484_3591453_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258351.1|3591613_3592582_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.9e-99
WP_115840192.1|3592726_3593692_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082325317.1|3593657_3594071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3594067_3594831_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3594874:3594933	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3595702_3596500_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3596533_3596926_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3597016_3597409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3599747_3600167_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3601883_3603668_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3603858_3604059_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3604594_3605389_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3605690_3606449_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3606524_3608387_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3608444_3608786_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3609045_3609321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3612367_3613081_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3611544:3612207	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3613141_3613564_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3613695_3614459_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3617532_3618444_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3619791_3620757_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3668289	3747572	4966744	transposase,plate	Ralstonia_phage(14.29%)	55	NA	NA
WP_011407175.1|3668289_3669258_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3670278_3671313_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3671696_3672422_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3672553_3673015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3676461_3678582_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3678848_3679694_-	transporter	NA	NA	NA	NA	NA
WP_011407175.1|3680512_3681481_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011259903.1|3681978_3683949_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3684377_3685775_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3685887_3686706_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_094187840.1|3687016_3690214_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.7e-80
WP_011259908.1|3690449_3691868_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3691877_3692480_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3692529_3693135_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3693284_3693506_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3693515_3693941_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3694432_3695230_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3696307_3697087_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3697301_3697931_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3697991_3698747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3699075_3699852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3700260_3701835_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3702083_3702350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3702628_3705808_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011409174.1|3705807_3706482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3706481_3707228_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_082325320.1|3707224_3708736_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|3708728_3709163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3709173_3710703_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3711005_3711998_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_011259923.1|3712050_3712359_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011409182.1|3712365_3712629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465160.1|3712938_3716412_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_103057308.1|3716443_3717550_+	Abi family protein	NA	NA	NA	NA	NA
WP_011409185.1|3717596_3719141_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_115844559.1|3719118_3720486_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3720519_3720828_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3720834_3721098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325321.1|3721820_3722576_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_113342862.1|3722869_3723520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|3723628_3724585_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_082325322.1|3724559_3726998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3726909_3727941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|3727949_3729887_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3729798_3730818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|3730822_3732766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|3732677_3733700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325326.1|3733709_3735680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3735664_3736690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325327.1|3736693_3739561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3739579_3740425_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325328.1|3740426_3743189_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3743281_3743635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3743665_3746395_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3746480_3747572_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 27
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	3924228	3995908	4966744	tRNA,transposase	Bacillus_phage(18.18%)	56	NA	NA
WP_042465726.1|3924228_3925185_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	3.7e-42
WP_011260084.1|3925243_3926089_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|3926290_3926854_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|3927044_3928637_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_012444268.1|3928728_3929670_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409284.1|3930096_3930528_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_011409285.1|3930590_3931559_+	transaldolase	NA	NA	NA	NA	NA
WP_109182002.1|3932222_3933188_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260092.1|3934621_3935200_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011409288.1|3935615_3936266_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011409289.1|3936361_3936877_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_153303322.1|3938499_3939467_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011260099.1|3940320_3940716_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012445944.1|3940712_3941021_-	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_011260101.1|3941170_3942817_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260102.1|3942997_3943687_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.4e-34
WP_011409292.1|3943744_3945088_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	3.8e-29
WP_011260104.1|3945203_3947306_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_011409293.1|3947477_3949004_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_011409294.1|3949208_3950345_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_011409295.1|3950325_3950868_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011260108.1|3951515_3952259_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011260109.1|3952438_3952858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409297.1|3953926_3954751_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011409298.1|3954889_3956356_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.7	1.8e-85
WP_011409299.1|3956386_3957133_-	CvpA family protein	NA	NA	NA	NA	NA
WP_011260113.1|3957347_3958430_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011409300.1|3958497_3959796_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011409301.1|3960768_3961413_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409302.1|3961504_3963655_-	S46 family peptidase	NA	NA	NA	NA	NA
WP_011409304.1|3965866_3968200_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409305.1|3968714_3969737_+	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_011409306.1|3969806_3970520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703808.1|3970873_3971908_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.4e-25
WP_011260122.1|3971915_3972869_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_011260123.1|3972865_3973726_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_011260124.1|3973729_3974827_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011260125.1|3974917_3976126_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	1.3e-20
WP_011409307.1|3976128_3976521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260126.1|3976471_3977332_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011260127.1|3977351_3977861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409308.1|3978053_3979151_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011260129.1|3979566_3980589_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011260130.1|3980796_3982836_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_011260131.1|3982934_3984305_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409312.1|3986075_3986717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465733.1|3986829_3987006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187801.1|3987458_3988256_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260134.1|3988253_3989084_+	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_011409313.1|3989080_3989545_+	response regulator	NA	NA	NA	NA	NA
WP_012444257.1|3989659_3989896_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011260137.1|3989897_3990539_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011260138.1|3990943_3992683_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_094187736.1|3993772_3994536_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_070807999.1|3994740_3994950_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|3995109_3995908_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	4156111	4252407	4966744	transposase	Ralstonia_phage(22.22%)	66	NA	NA
WP_115840193.1|4156111_4157719_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4157880_4158144_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4158148_4158808_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4158994_4160359_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4160574_4161270_+	VIT family protein	NA	NA	NA	NA	NA
WP_011258802.1|4162062_4163031_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409413.1|4163376_4164000_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4164201_4164942_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4165035_4165686_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4165777_4166593_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4166642_4167380_+	endonuclease	NA	NA	NA	NA	NA
WP_082325341.1|4169308_4170304_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
WP_041182588.1|4170426_4173000_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4173192_4173955_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4174028_4174997_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409421.1|4175730_4175997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4176928_4177727_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4179373_4180606_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4180645_4181608_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4181783_4182740_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|4182951_4183920_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187715.1|4184255_4185018_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182027.1|4188428_4189394_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4189861_4190092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4190716_4192759_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4192760_4194659_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4194660_4195914_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4195910_4196516_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4196935_4198090_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4198092_4199121_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4199117_4200194_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4200234_4201512_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4201556_4202324_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4202538_4203705_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4206248_4209146_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_082325342.1|4209296_4211987_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4212268_4213225_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|4213715_4214951_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|4216386_4217571_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4217638_4218376_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4218544_4219060_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4219151_4220654_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4220657_4221098_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4221094_4222906_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4223191_4223554_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4223713_4224766_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4225105_4226047_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4226067_4227405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4227576_4227957_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4228081_4228843_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4231091_4232495_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4232617_4233673_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4233845_4234700_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4234991_4237175_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_041182498.1|4237673_4238669_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_041182275.1|4238764_4240576_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4240820_4241834_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4241848_4242547_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4242534_4242813_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4243878_4245084_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4245584_4247000_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4246996_4248136_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4249361_4249904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4249875_4251150_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4251149_4251368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325344.1|4251444_4252407_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	4278378	4423514	4966744	tRNA,transposase,protease	Erwinia_phage(14.29%)	108	NA	NA
WP_011260359.1|4278378_4279746_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4279856_4280408_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4280923_4281841_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011260362.1|4282040_4282721_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4282708_4283563_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4283552_4283789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4283846_4284245_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4284617_4286753_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4286876_4288061_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_082325346.1|4288286_4289522_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011409480.1|4289706_4290138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4290220_4292314_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4292381_4292693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4293080_4293650_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4293758_4294724_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4295282_4296083_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4296633_4297548_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4297578_4298316_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4298346_4299399_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4299403_4300072_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4300223_4302161_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4302887_4303650_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240244.1|4303776_4304037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260378.1|4303964_4305614_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4307004_4308492_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_069963930.1|4308699_4310154_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4311388_4314013_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4314268_4317139_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|4317686_4318616_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4318654_4319659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4319901_4320665_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4321712_4322498_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4322751_4324425_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4324968_4325415_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4325745_4326030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4326624_4327536_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4327781_4328777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4328870_4330247_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_082325347.1|4331413_4333114_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_082325348.1|4333522_4335295_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_099051318.1|4335570_4336455_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4336643_4337522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4339561_4340653_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4342555_4344880_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4345075_4347022_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4347396_4347588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4347978_4349562_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4349909_4350506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4351854_4352703_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4352737_4354213_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_082325349.1|4354803_4355733_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4355967_4356459_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4356455_4357127_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4357521_4357851_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_011260412.1|4358053_4358986_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_094187728.1|4359774_4360573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4360720_4361755_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409520.1|4364622_4365108_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4365646_4368475_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4368474_4368849_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_011409524.1|4368845_4370396_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_011409525.1|4370392_4370899_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011409526.1|4370895_4371180_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4371176_4371530_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4371977_4372316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409528.1|4372739_4374065_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011409529.1|4374429_4375500_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4375670_4376159_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4376515_4377106_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409531.1|4377117_4378626_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
WP_011260428.1|4379068_4379962_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4381366_4382032_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_109182021.1|4382664_4383630_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4384162_4384543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057253.1|4384745_4385651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4385719_4387015_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_094187850.1|4387105_4387669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4388094_4389360_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4389356_4390334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4390437_4391241_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4391416_4392226_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4392233_4393032_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4393074_4393722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4393816_4394392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4394603_4395923_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4396072_4397041_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4397166_4397919_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4397956_4398397_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4398603_4398945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4399170_4399548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4399758_4399956_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4400262_4401009_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4401101_4401908_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4402131_4403544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4403540_4404638_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_099051302.1|4404792_4405591_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4405811_4406774_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4407214_4407978_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4408259_4409036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4409032_4410349_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4410865_4412101_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4412694_4412976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4413536_4413971_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4414145_4415324_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4416319_4417282_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4419615_4421787_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4422014_4422371_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4422449_4423514_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 30
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	4446471	4504991	4966744	tRNA,transposase	Acinetobacter_phage(30.0%)	44	NA	NA
WP_094187805.1|4446471_4447450_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115840195.1|4447529_4448495_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4448507_4448978_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4449320_4449536_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4449616_4450234_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4450782_4451175_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4451178_4451607_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4451792_4452446_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_011409578.1|4452732_4453047_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4453206_4454001_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_082325355.1|4454138_4454831_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4455151_4455868_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4455860_4456658_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4456794_4457832_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4457949_4458579_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4458730_4459312_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4460739_4461841_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4462445_4464677_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4464866_4466579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4466727_4468104_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4470311_4471110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4472094_4473063_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4473229_4474201_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4474393_4475578_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4476045_4476861_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4477619_4478936_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4479195_4480440_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4480532_4483781_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4483914_4487055_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_082325356.1|4487344_4488712_-	VOC family protein	NA	NA	NA	NA	NA
WP_069964616.1|4490839_4491805_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4492267_4492738_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4492766_4493189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4493264_4493699_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4493808_4494324_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4494339_4495365_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4495687_4496284_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4496641_4498369_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4498418_4499861_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4499845_4501192_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4501382_4502132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4502233_4502845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4502949_4504173_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4504514_4504991_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	4517858	4577888	4966744	transposase,integrase	Leptospira_phage(25.0%)	38	4519240:4519259	4533939:4533958
WP_011260549.1|4517858_4519235_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
4519240:4519259	attL	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_094187715.1|4519305_4520068_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325359.1|4520028_4520595_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4521023_4522283_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4522421_4523729_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4525813_4526848_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4527198_4527744_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4527769_4528036_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4528210_4530049_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4530279_4531155_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_012445230.1|4532640_4533876_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057293.1|4534297_4534561_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4533939:4533958	attR	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_075240199.1|4536852_4537752_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4538699_4541501_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4541577_4541868_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_109182030.1|4542225_4543253_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	3.9e-42
WP_125168768.1|4543431_4544103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133260589.1|4544162_4545068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504812.1|4545257_4547945_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_082325360.1|4551266_4555196_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4556884_4557397_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_082325361.1|4557393_4557630_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	56.9	6.7e-06
WP_033013372.1|4557914_4558262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4558479_4560486_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4560482_4560914_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4560910_4561330_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075241332.1|4561815_4562556_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011260581.1|4562766_4563357_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_082325391.1|4563490_4564438_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_027703830.1|4565333_4565834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4568921_4569482_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4569577_4572403_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4572564_4573083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4573082_4574003_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4574431_4575055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|4575064_4575256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4575352_4575973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4576922_4577888_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP011532	Xanthomonas oryzae pv. oryzae strain XF89b, complete genome	4966744	4655421	4834004	4966744	tRNA,transposase,tail	Arthrobacter_phage(13.04%)	118	NA	NA
WP_109182036.1|4655421_4656387_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4656487_4656913_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4656955_4657718_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4657780_4658812_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4660172_4661429_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4661425_4662316_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4662312_4662708_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4662727_4663306_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4663191_4664049_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011260667.1|4670153_4672238_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_069964730.1|4672337_4674365_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4674607_4676218_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_075243274.1|4676228_4677392_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_075243275.1|4677520_4678141_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4678471_4678660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4678702_4679038_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_082325365.1|4680662_4680974_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4682092_4682611_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4682882_4684601_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4684691_4685078_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4685139_4686465_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_069970072.1|4686917_4687874_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011260682.1|4689049_4689775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4689991_4690654_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4690732_4691827_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4693331_4696091_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4696343_4697933_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4697932_4700170_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4700458_4701367_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4701456_4703271_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4703656_4712482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4712580_4713378_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4713922_4714675_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4714734_4715634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4715785_4716541_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4716537_4717173_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4717188_4717416_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4717488_4718391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4718545_4719511_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4719608_4720364_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4720444_4720903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4721173_4721959_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4722585_4723491_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4723554_4724472_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4725075_4726413_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4726638_4727706_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011409722.1|4727881_4730077_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4730073_4732038_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4732049_4733309_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4733308_4735009_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4735011_4737726_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4737948_4739421_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4740398_4741454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4741681_4743100_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4743140_4744118_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_011409726.1|4745534_4747016_-	MFS transporter	NA	NA	NA	NA	NA
WP_099051314.1|4747357_4750231_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4750329_4751817_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4751848_4752883_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4753299_4754097_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4754973_4755111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4755403_4756360_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|4757087_4757850_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4757867_4758968_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4759033_4760155_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4760164_4761259_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4761333_4762014_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4762046_4762845_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4762973_4764293_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4764395_4765352_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4766818_4767277_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4767378_4767807_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4768053_4768917_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4772093_4772360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4772521_4772770_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4772978_4773737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4773733_4774429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4774527_4774860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4775331_4775766_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4775881_4776127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4776462_4776795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4777043_4777142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4777244_4778639_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4779576_4779867_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4779884_4780166_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4780260_4782513_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4782700_4786768_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4786764_4790178_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_128415416.1|4790213_4790516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4797091_4797637_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4797705_4798233_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4798291_4798828_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4798915_4799881_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704180.1|4800163_4800796_-	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_011409759.1|4800866_4801346_-	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
WP_011409760.1|4801967_4803395_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011260761.1|4803387_4804443_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011260762.1|4804713_4806189_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260763.1|4806178_4806517_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011260764.1|4806794_4808204_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260765.1|4808425_4809223_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260766.1|4809359_4810166_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_011409764.1|4811319_4811931_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011409765.1|4812125_4814198_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409766.1|4815660_4816464_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260771.1|4816583_4817012_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011260772.1|4817317_4819333_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260773.1|4819329_4819902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409767.1|4819905_4820382_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409768.1|4820397_4821030_-	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_011260776.1|4821382_4822300_-	AEC family transporter	NA	NA	NA	NA	NA
WP_082325368.1|4823391_4827099_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_011260780.1|4827241_4827862_+	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_011260781.1|4827858_4829136_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260782.1|4829180_4830167_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011409772.1|4830163_4831447_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_011260784.1|4831518_4832700_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011407587.1|4832969_4834004_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
