The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	1564190	1656135	4017183	tRNA,capsid,terminase,plate,holin,portal,head,integrase,tail	uncultured_Caudovirales_phage(36.67%)	87	1620634:1620693	1656452:1656562
WP_078220188.1|1564190_1565591_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005804294.1|1565565_1566402_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000501183.1|1566423_1566993_+	YggT family protein	NA	NA	NA	NA	NA
WP_078220189.1|1567045_1569817_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.2	5.1e-68
WP_078220190.1|1569971_1572776_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_005066312.1|1572765_1573683_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002117309.1|1573692_1574514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005804298.1|1574610_1576101_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_005066315.1|1576157_1576589_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005804299.1|1576677_1577115_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044430969.1|1577280_1577655_-	DUF4951 domain-containing protein	NA	NA	NA	NA	NA
WP_032005320.1|1577669_1578494_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_002117273.1|1578523_1579045_-	anti-anti-sigma factor GigB	NA	NA	NA	NA	NA
WP_002117221.1|1579147_1580116_-	RsbU family protein phosphatase GigA	NA	NA	NA	NA	NA
WP_078221376.1|1580227_1581028_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_171063696.1|1587381_1588857_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005071251.1|1589024_1589363_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002115399.1|1589501_1589753_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_002115380.1|1589759_1591016_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_078220191.1|1591015_1591699_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_078220192.1|1591805_1593095_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_005075157.1|1593164_1594250_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_078220193.1|1594253_1595606_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	34.0	1.4e-26
WP_078221377.1|1595967_1596813_+	protein FilA	NA	NA	NA	NA	NA
WP_014208424.1|1597110_1597944_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_078220194.1|1598010_1599189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017387473.1|1599201_1600866_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_153301262.1|1600883_1602188_+	putative pilus assembly protein FilE	NA	NA	NA	NA	NA
WP_078220195.1|1602200_1604201_+	protein FilF	NA	NA	NA	NA	NA
WP_002115876.1|1604256_1604805_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014208431.1|1604919_1605546_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_078210186.1|1605568_1606096_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_078220196.1|1606231_1606897_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_057068031.1|1606908_1607700_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005071224.1|1607836_1609288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032004343.1|1609256_1610102_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000843456.1|1610107_1610380_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
WP_000043044.1|1610564_1611251_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_078220197.1|1611607_1612429_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_134854159.1|1612532_1612928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220198.1|1612969_1614907_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_078221380.1|1614920_1615649_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_078221381.1|1615881_1616673_+	cation transporter	NA	NA	NA	NA	NA
WP_002115842.1|1616822_1617143_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_032056955.1|1617155_1617635_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.2	1.3e-24
WP_078220199.1|1617768_1618989_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_002115913.1|1619133_1620198_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
1620634:1620693	attL	GGGTTCGAATCCCGTCATTCACCCCAATTTCGGAGCATAGCACAGCCTGGTAGTGCACCT	NA	NA	NA	NA
WP_031998263.1|1621576_1622635_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	61.4	1.7e-117
WP_057073733.1|1622634_1624413_-|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	67.7	1.4e-228
WP_078220200.1|1624591_1625422_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	50.6	5.0e-56
WP_031998266.1|1625469_1626480_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	59.1	3.4e-107
WP_078220201.1|1626486_1627377_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	44.0	1.7e-41
WP_078220202.1|1627478_1627928_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	37.4	2.3e-15
WP_078220203.1|1627924_1628137_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	55.2	7.1e-15
WP_005048951.1|1628139_1628496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032007224.1|1628492_1628765_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	40.7	5.7e-09
WP_078220204.1|1628761_1629616_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	43.2	1.7e-46
WP_032007226.1|1629612_1630113_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	62.9	3.4e-39
WP_078220205.1|1630113_1630566_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	46.3	3.6e-24
WP_078220206.1|1630638_1631304_+|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	35.4	1.2e-07
WP_032007229.1|1631300_1631645_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	44.9	1.4e-20
WP_078220207.1|1631641_1632544_+|plate	baseplate J/gp47 family protein	plate	A0A0F7LCJ3	Escherichia_phage	49.1	8.4e-73
WP_078220208.1|1632543_1633152_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	37.9	4.5e-30
WP_078220210.1|1636094_1637267_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	70.5	2.8e-161
WP_068566064.1|1637277_1637796_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	57.3	4.0e-51
WP_031998279.1|1637861_1638197_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	40.7	1.6e-13
WP_031998280.1|1638205_1638325_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	53.8	7.5e-06
WP_078220211.1|1638321_1640967_+|tail	phage tail tape measure protein	tail	A4PE52	Ralstonia_virus	41.6	2.5e-157
WP_078220212.1|1640972_1641395_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	52.8	2.8e-34
WP_078220213.1|1641391_1642894_+	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.6	1.3e-91
WP_078220214.1|1642881_1643685_-	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	60.5	1.6e-86
WP_078220215.1|1643650_1643851_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057090968.1|1643964_1644258_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_057691960.1|1644254_1644497_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	50.0	1.1e-11
WP_078220216.1|1644493_1644934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220217.1|1644982_1645990_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_078220218.1|1646101_1646992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220219.1|1647055_1647499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220220.1|1647656_1648592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171262261.1|1649010_1649577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073301.1|1649619_1649964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220221.1|1650046_1650265_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_057073299.1|1650271_1650505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057073298.1|1650509_1650692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220222.1|1650707_1653425_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	38.7	1.7e-177
WP_078220223.1|1653589_1654747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220224.1|1654974_1656135_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	41.2	1.8e-72
1656452:1656562	attR	GGGTTCGAATCCCGTCATTCACCCCAATTTCGGAGCATAGCACAGCCTGGTAGTGCACCTGGTTTGGGACCAGGGGGTCGTAGGTTCGAATCCTACTGCTCCGACCATATT	NA	NA	NA	NA
>prophage 2
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	2183168	2190443	4017183		Acinetobacter_phage(50.0%)	9	NA	NA
WP_069119405.1|2183168_2184434_-	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	30.1	2.1e-13
WP_005070233.1|2184941_2185175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002119885.1|2185327_2185999_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.8	1.2e-63
WP_002119927.1|2186670_2186925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002119864.1|2187134_2187524_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	76.7	3.0e-51
WP_078220435.1|2187554_2188100_+	hypothetical protein	NA	A0A0N7IRE7	Acinetobacter_phage	70.7	3.9e-73
WP_014206232.1|2188196_2188814_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005076885.1|2189053_2189986_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	34.2	3.6e-42
WP_005070223.1|2190227_2190443_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.7	5.9e-17
>prophage 3
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	2211865	2218657	4017183		Acinetobacter_phage(80.0%)	12	NA	NA
WP_078220454.1|2211865_2212831_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	51.7	4.3e-75
WP_078220455.1|2212846_2213614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220456.1|2213625_2213955_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	64.8	5.5e-30
WP_078220457.1|2213957_2214146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220458.1|2214688_2215387_-	S24 family peptidase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	40.7	7.3e-32
WP_078220459.1|2215502_2215751_+	helix-turn-helix domain-containing protein	NA	A0A0R6PIJ0	Moraxella_phage	51.4	4.6e-13
WP_078220460.1|2215759_2216116_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	92.4	7.7e-54
WP_078220461.1|2216171_2216447_+	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	45.2	2.0e-09
WP_078220462.1|2216443_2216737_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	56.2	6.4e-22
WP_078220463.1|2216736_2217678_+	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	57.8	2.4e-22
WP_078220464.1|2217744_2218161_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	81.7	1.1e-56
WP_078220465.1|2218141_2218657_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	33.1	4.4e-18
>prophage 4
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	2225878	2244731	4017183	terminase,capsid,tail	Acinetobacter_phage(90.48%)	27	NA	NA
WP_078220475.1|2225878_2226316_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	67.4	1.0e-44
WP_078220476.1|2226275_2226917_+	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	84.5	2.0e-108
WP_078220477.1|2226976_2227534_+	DUF2280 domain-containing protein	NA	A0A0P0IKR0	Acinetobacter_phage	77.8	5.0e-60
WP_078220478.1|2227517_2228834_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	96.8	1.2e-258
WP_078220479.1|2228873_2230220_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	88.4	3.3e-230
WP_078220480.1|2230229_2231321_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	85.6	5.2e-178
WP_078220481.1|2231452_2232478_+	Arc family DNA-binding protein	NA	A0A0P0IKW9	Acinetobacter_phage	35.6	3.1e-07
WP_000003096.1|2232711_2232981_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.9	1.8e-10
WP_078220482.1|2233074_2233920_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	52.2	6.1e-33
WP_057065990.1|2234083_2234686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002043639.1|2234880_2235030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220483.1|2235114_2235906_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	71.9	2.3e-82
WP_078220484.1|2235919_2236870_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	91.1	3.4e-165
WP_078220485.1|2236912_2237221_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	76.6	1.2e-34
WP_078220486.1|2237224_2237605_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	81.7	2.5e-50
WP_078220487.1|2237604_2237973_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	93.4	1.8e-61
WP_078220488.1|2238014_2238611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078221411.1|2238800_2239154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220489.1|2239465_2240302_+	DUF4882 family protein	NA	NA	NA	NA	NA
WP_078220490.1|2240361_2240730_+	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	90.2	1.3e-56
WP_078220491.1|2240731_2241130_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	78.0	4.1e-56
WP_078220492.1|2241135_2241501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068563072.1|2241557_2241776_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	91.7	8.6e-32
WP_078220493.1|2241870_2242221_+	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	85.5	1.7e-50
WP_078220494.1|2242220_2243186_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	48.7	7.1e-86
WP_078220495.1|2243238_2244156_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	91.8	6.0e-159
WP_078220496.1|2244221_2244731_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	82.2	1.1e-64
>prophage 5
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	2248029	2260974	4017183		Acinetobacter_phage(100.0%)	9	NA	NA
WP_078220502.1|2248029_2252553_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	62.4	0.0e+00
WP_078220503.1|2252642_2253230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220504.1|2253322_2253721_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	96.2	2.0e-71
WP_078220505.1|2253720_2254227_+	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	92.3	6.8e-88
WP_078220506.1|2254223_2254586_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	84.2	9.2e-55
WP_078220507.1|2254578_2258010_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	89.9	0.0e+00
WP_078220508.1|2258074_2259004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220509.1|2259253_2260510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078220510.1|2260587_2260974_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	92.2	2.4e-61
>prophage 6
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	3263068	3299340	4017183	capsid,terminase,coat,integrase,tail,lysis	Acinetobacter_phage(47.83%)	49	3255054:3255070	3297705:3297721
3255054:3255070	attL	TAGAAAAAGTAGAATCC	NA	NA	NA	NA
WP_078220991.1|3263068_3263353_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_078220992.1|3263418_3265908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220993.1|3265907_3266336_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	33.1	1.3e-07
WP_078220994.1|3266326_3267439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220995.1|3267435_3269142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078220996.1|3269199_3270057_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	25.4	9.6e-10
WP_078220997.1|3270053_3270707_-	DUF2460 domain-containing protein	NA	NA	NA	NA	NA
WP_078220998.1|3270717_3273756_-|tail	phage tail protein	tail	D4FUM0	Pseudomonas_phage	45.2	4.0e-42
WP_078220999.1|3273858_3274164_-	NINE protein	NA	M4ZS56	Bacillus_phage	59.4	9.6e-13
WP_078221000.1|3274244_3274472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221001.1|3274507_3274822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090027.1|3274828_3275596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221002.1|3275658_3276102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221003.1|3276094_3276577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221004.1|3276584_3276776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221005.1|3276785_3277169_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_078221006.1|3277178_3277556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221007.1|3277569_3278565_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	35.8	5.7e-46
WP_078221008.1|3278571_3279042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221009.1|3279056_3280235_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	35.3	6.8e-22
WP_078221010.1|3280298_3281222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221011.1|3281260_3282073_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.0	1.6e-51
WP_078221012.1|3282017_3283352_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.4	1.7e-85
WP_078221013.1|3283360_3284887_-|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.0	2.6e-90
WP_005068136.1|3284864_3285341_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	1.0e-32
WP_078221014.1|3285398_3286040_-	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	86.9	7.7e-113
WP_078221015.1|3286008_3286437_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	65.5	7.8e-45
WP_078221016.1|3286538_3287369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221017.1|3287518_3287758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221018.1|3287848_3288079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221019.1|3288193_3288421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221020.1|3288417_3288654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221021.1|3288805_3289219_-	antitermination protein	NA	NA	NA	NA	NA
WP_078221022.1|3289237_3289696_-	hypothetical protein	NA	G3EN88	Psychrobacter_phage	41.4	1.8e-23
WP_134853961.1|3289688_3289811_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	83.3	9.7e-09
WP_078221023.1|3289807_3290752_-	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	57.8	4.2e-22
WP_078221024.1|3290748_3291069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078221025.1|3291129_3291486_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	91.5	7.7e-54
WP_078221026.1|3291494_3291713_-	helix-turn-helix domain-containing protein	NA	G3EN82	Psychrobacter_phage	49.2	2.3e-08
WP_078221027.1|3291841_3292516_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	31.9	4.9e-17
WP_078221028.1|3292528_3292933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078221029.1|3293160_3293601_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	67.3	3.9e-47
WP_068555534.1|3293603_3293927_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	75.7	3.0e-41
WP_078221030.1|3293937_3294705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078221031.1|3294719_3295709_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	70.5	2.9e-119
WP_078221032.1|3295708_3296005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060466208.1|3296005_3296275_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	95.5	1.9e-41
WP_078221033.1|3296280_3297543_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	92.1	1.6e-234
WP_078221034.1|3298311_3299340_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
3297705:3297721	attR	TAGAAAAAGTAGAATCC	NA	NA	NA	NA
>prophage 7
NZ_CP017938	Acinetobacter pittii strain YMC2010/8/T346 chromosome, complete genome	4017183	3638717	3653518	4017183		Acinetobacter_phage(100.0%)	10	NA	NA
WP_014207264.1|3638717_3639293_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	7.2e-110
WP_078221174.1|3639391_3642163_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.7	0.0e+00
WP_078221175.1|3642170_3644903_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	96.0	0.0e+00
WP_002118605.1|3645260_3646310_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.1	3.1e-188
WP_078221176.1|3646319_3647126_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.0	2.4e-143
WP_078221177.1|3647135_3647831_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	96.1	1.5e-117
WP_078221178.1|3647841_3648825_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	90.8	7.8e-173
WP_078221179.1|3648831_3651207_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.2	0.0e+00
WP_078221180.1|3651208_3652708_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.2	8.0e-278
WP_002118643.1|3652969_3653518_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	6.6e-97
