The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	2375	57961	4911496	capsid,portal,transposase,holin,tail,terminase,head	Stx2-converting_phage(29.63%)	65	NA	NA
WP_001296031.1|2375_2651_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2647_3205_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|3616_3886_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|3942_4611_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|4809_4992_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|5117_6086_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|6101_6629_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|6659_7193_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|7194_10020_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|10481_11228_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|11242_12784_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|13424_16898_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_061089814.1|17240_17873_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|17818_18562_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|18572_19271_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|19270_19612_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|19604_22847_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|22894_23104_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|23199_23574_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|23588_24305_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|24371_24716_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|24712_25159_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|25155_25506_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|25515_25842_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|25838_28424_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|28369_28591_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|28635_30573_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|30636_32298_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|32294_32858_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|33147_33513_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|33554_33755_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|33953_34169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|34254_34440_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|34661_34748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|35302_35836_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|35941_36214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|36179_36524_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|36528_36744_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|36894_38748_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|39008_39344_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|39624_39756_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|40557_41607_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|41758_41956_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|42182_43004_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|43000_43381_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|43381_44437_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|44438_44711_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|44878_45091_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|45271_45937_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|46111_46537_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|46552_47323_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|47344_48091_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|48097_49060_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|49082_49508_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|49504_49720_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|49769_50486_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|50758_50914_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|51073_51292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|51857_52046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|52042_52234_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|52326_54798_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|54862_55111_+	excisionase	NA	NA	NA	NA	NA
WP_000080195.1|55544_57158_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|57188_57539_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|57535_57961_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 2
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	197497	243206	4911496	capsid,portal,tRNA,integrase,holin,tail,terminase,head,lysis	Enterobacteria_phage(56.0%)	58	216281:216295	244875:244889
WP_000654172.1|197497_197776_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|197772_199794_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|199852_203335_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|203395_203998_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|203934_204678_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|204682_205381_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|205380_205710_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|205706_208268_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|208260_208695_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|208676_209099_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|209114_209855_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|209862_210258_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|210254_210833_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|210844_211198_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|211209_211608_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|211649_212675_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|212730_213063_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|213072_214392_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|214372_215974_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|215970_216177_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|216173_218099_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
216281:216295	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|218073_218619_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|219182_219365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|219571_219898_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|220378_220672_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|220762_220945_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|221161_221638_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|221624_221930_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|222251_222941_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|222937_223078_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|223074_223437_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|223433_223724_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|223716_223887_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|223886_224342_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|224338_224440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|224789_225833_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|225869_230135_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|230384_231086_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|231082_232012_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|232098_232638_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|232707_232938_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|232976_233732_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|234327_234534_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|234609_234906_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|234911_235697_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|235693_236374_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|236370_236553_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|236525_236717_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|236727_237009_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|237107_237329_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|237328_237655_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|237638_237878_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|238017_238254_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|238243_239386_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|239499_240750_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|240921_241575_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|241584_242046_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|242099_243206_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
244875:244889	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 3
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	440315	536859	4911496	capsid,protease,transposase,tRNA,integrase,tail,plate	Burkholderia_virus(26.87%)	106	449600:449615	468921:468936
WP_001295930.1|440315_441101_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|441236_442016_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|441992_442886_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|443039_443786_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|443782_443965_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|444016_445249_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|445285_446272_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|446268_448017_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|448053_450318_-	ComEC family protein	NA	NA	NA	NA	NA
449600:449615	attL	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_000167336.1|450523_450808_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|450967_452641_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|452751_453435_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|453607_454390_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|454533_454923_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|454894_455344_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|455345_455552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|455541_455772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|455768_456452_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|456448_456664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|456678_456975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|456984_457257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|457545_458076_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|458103_458373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|458375_459542_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|459552_461322_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|461337_461655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|461654_462575_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|462585_462894_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|462946_463135_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|463228_463585_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|463701_464466_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|464656_464872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|464870_465275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|465250_465979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|466109_466460_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|466462_467203_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|467186_467837_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|467833_468160_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|468159_468471_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|468470_469016_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
468921:468936	attR	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_001295924.1|469075_470608_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000090684.1|470607_472104_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|472084_472906_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|472908_473367_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|473581_474697_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|474711_475665_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|475674_476013_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|476014_476461_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|476460_476925_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|476921_477176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|477165_478593_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|478592_479114_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|479116_479398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|479495_479831_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|479754_479913_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|479988_482940_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|482939_483824_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|483820_484036_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|484023_485178_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|485174_485771_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|485825_486173_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|486163_487267_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|487259_487838_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|487840_489172_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|489171_489786_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|489792_490254_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_064767240.1|490264_490705_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|490764_491337_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|491592_492876_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|492946_494035_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|494233_494926_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|495055_496816_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|497221_498079_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|498133_500416_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|500607_501348_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|501444_502593_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|502906_503533_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|503568_504432_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|504433_505051_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|505061_507506_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_001067858.1|507720_508425_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_078177568.1|508434_508947_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.9	8.7e-83
WP_001554335.1|508975_509503_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_023363133.1|509504_510290_-	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000905061.1|510517_511117_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|511145_511634_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|511646_514454_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|514440_514596_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|514604_514979_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|515034_515547_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|515546_516731_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|516888_517998_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|518038_518299_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|518490_518631_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|518936_520229_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|520319_521663_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|521673_522285_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|522443_526550_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|526684_527179_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|527722_528688_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|528810_530577_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|530577_532299_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|532340_533045_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|533329_533548_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|534231_536508_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|536538_536859_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 4
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	1560717	1620982	4911496	transposase	Stx2-converting_phage(28.57%)	54	NA	NA
WP_000343765.1|1560717_1561938_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001295734.1|1563619_1564336_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001295733.1|1564355_1565462_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991462.1|1565525_1566506_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
WP_001363826.1|1567088_1568132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|1568257_1569404_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000504875.1|1570174_1571461_+	McrC family protein	NA	NA	NA	NA	NA
WP_000781649.1|1571570_1573310_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_001295727.1|1573322_1574513_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_001332039.1|1574505_1576146_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001467148.1|1577458_1577617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|1577716_1577893_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|1577909_1578398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|1578394_1578772_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|1578861_1579230_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|1579392_1579614_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|1579676_1580153_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|1580168_1580642_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234738.1|1580983_1581802_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001323397.1|1581956_1582115_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_021526504.1|1582185_1585032_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001553935.1|1585404_1586277_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250227.1|1586361_1587279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|1588479_1589082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|1589177_1589384_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|1590157_1590307_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001547002.1|1590639_1590837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|1591036_1591606_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|1591865_1592267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|1592254_1592689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|1593043_1593424_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1593420_1593768_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1593817_1595203_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|1595441_1596800_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|1598361_1598883_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068908.1|1598879_1599833_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|1599919_1602244_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|1602288_1603191_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1603187_1604186_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1604182_1605139_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1605139_1605907_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1606463_1606721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|1607654_1607957_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1607992_1608811_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001545177.1|1608965_1610963_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_001296707.1|1611025_1612303_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|1612550_1613207_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000527665.1|1613387_1613495_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|1614620_1614719_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|1614720_1615503_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1615808_1616729_+	ribokinase	NA	NA	NA	NA	NA
WP_000998348.1|1616756_1618073_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107487.1|1618084_1619098_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000080195.1|1619368_1620982_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 5
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	2832930	2844551	4911496	transposase	Stx2-converting_phage(28.57%)	13	NA	NA
WP_000809780.1|2832930_2835267_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_000719791.1|2835496_2836150_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047069.1|2836146_2836875_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|2836871_2837504_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000080195.1|2837576_2839190_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2839220_2839571_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2839567_2839993_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000216791.1|2840256_2840529_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|2840525_2841380_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183674.1|2841425_2841917_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|2842034_2842322_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|2842344_2843778_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|2843825_2844551_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
>prophage 6
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	3129437	3162572	4911496	integrase,transposase	Stx2-converting_phage(38.46%)	27	3160558:3160572	3169150:3169164
WP_000080195.1|3129437_3131051_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3131081_3131432_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3131428_3131854_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000221563.1|3132073_3132643_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271011.1|3132809_3133193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997995.1|3133413_3134952_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|3136079_3136430_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|3136426_3136852_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|3137223_3137361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|3137512_3138430_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|3138463_3139339_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|3139387_3140860_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|3140863_3141694_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|3141739_3142450_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|3142462_3143572_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|3143633_3144557_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|3144592_3145327_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|3145426_3146413_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|3146564_3147792_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|3148292_3150383_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|3151214_3151487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|3151777_3152137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|3152140_3152356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212789.1|3156233_3157088_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|3157136_3158288_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000147017.1|3160007_3161051_-	hypothetical protein	NA	NA	NA	NA	NA
3160558:3160572	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|3161306_3162572_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|3161306_3162572_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
3169150:3169164	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 7
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	3444541	3451681	4911496		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|3444541_3445180_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|3445176_3446439_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|3446435_3447344_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001272542.1|3447509_3448307_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141293.1|3448357_3449014_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|3449119_3451681_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 8
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	4028965	4038410	4911496		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|4028965_4029892_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|4029896_4030628_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4030608_4030716_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|4030775_4031507_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|4031728_4033414_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4033410_4034130_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4034176_4034647_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4034687_4035149_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|4035273_4037277_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|4037273_4038410_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 9
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	4132586	4138889	4911496		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|4132586_4133981_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|4134155_4135049_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|4135421_4136507_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|4136506_4137406_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|4137463_4138342_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|4138346_4138889_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 10
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	4162036	4200227	4911496	transposase	Stx2-converting_phage(23.08%)	42	NA	NA
WP_001531805.1|4162036_4162495_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|4162605_4164033_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|4164241_4165408_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000115885.1|4165605_4166124_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|4166142_4167363_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001105368.1|4167419_4167893_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|4168090_4169149_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|4169320_4169650_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|4169750_4169933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|4170421_4170535_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|4170547_4170742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|4170738_4171113_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|4171201_4171570_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|4171585_4172230_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|4172248_4172470_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|4172532_4173009_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|4173024_4173498_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|4173591_4173837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|4173836_4174655_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|4174875_4175286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|4175734_4176481_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000422741.1|4177618_4178044_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4178040_4178391_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4178421_4180035_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001542273.1|4180691_4181105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|4181240_4182311_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|4182307_4183213_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|4183209_4185594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|4185811_4186246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|4186674_4188840_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|4188850_4189840_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|4189858_4190917_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|4190913_4191681_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|4191734_4191992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|4192522_4193668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|4194867_4195047_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|4195192_4196215_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|4196214_4196907_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_001327829.1|4197243_4197459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|4197932_4198535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|4198628_4198907_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|4199030_4200227_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP019012	Escherichia coli strain Ecol_AZ161 chromosome, complete genome	4911496	4322178	4408314	4911496	capsid,portal,transposase,tRNA,integrase,holin,tail,terminase,plate	Escherichia_phage(22.73%)	99	4321993:4322052	4364605:4364729
4321993:4322052	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|4322178_4323195_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|4323163_4323427_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|4323636_4323819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|4323818_4324388_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|4324384_4326601_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|4326631_4326952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|4327962_4328376_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|4328474_4328705_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|4328763_4329240_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|4329279_4329504_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|4329500_4330256_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|4330245_4331661_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|4331699_4332110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|4332111_4332348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|4332344_4332656_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|4332652_4332877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|4333558_4334347_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|4334521_4335445_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|4336633_4337332_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|4337794_4338400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|4338409_4338898_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|4339296_4339530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|4339773_4340415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|4340566_4340746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|4340823_4341420_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|4341416_4341710_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|4341709_4342381_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|4342493_4342877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|4342876_4343149_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|4343148_4343628_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|4343635_4343830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|4343889_4344135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|4344503_4345070_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|4345056_4346919_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|4346918_4347152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|4347148_4348723_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|4348722_4350030_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|4350029_4350359_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|4350417_4351452_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|4351486_4351906_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|4351902_4352283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|4352314_4352995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|4352991_4353528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|4353508_4354411_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|4354413_4354755_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|4354751_4355672_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|4355674_4356301_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|4356293_4357478_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|4357477_4357867_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|4357863_4359366_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|4359383_4359896_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|4359908_4360190_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|4360298_4361939_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|4361974_4362364_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|4362525_4362750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|4363964_4364384_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|4364855_4365521_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4364605:4364729	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|4365571_4366783_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|4366973_4367213_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|4367250_4367748_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|4367919_4368243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|4368506_4368593_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|4368707_4368959_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|4369036_4369540_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|4370334_4371324_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|4371393_4372908_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000987895.1|4372919_4373909_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|4374075_4374876_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|4374850_4376275_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|4376281_4376710_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001531763.1|4378252_4380217_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|4380237_4380741_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|4380885_4382547_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|4382837_4383698_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|4383700_4384750_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4384764_4385154_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|4385164_4385809_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|4385997_4387146_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|4387138_4389217_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|4389216_4389609_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|4389661_4391395_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|4391610_4392177_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|4392190_4392937_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|4393324_4394425_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|4394449_4396879_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|4396914_4397886_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4397882_4398626_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|4398666_4399062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|4399114_4399933_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|4399929_4400496_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|4400805_4402578_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|4402570_4403023_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|4403051_4403792_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4403826_4404348_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|4404349_4404952_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|4405022_4405088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4405226_4405838_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|4405846_4406857_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|4406966_4408314_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 1
NZ_CP019009	Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_3, complete sequence	130905	5352	46940	130905	protease,transposase	Escherichia_phage(33.33%)	39	NA	NA
WP_001067858.1|5352_6057_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014342212.1|7383_7533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|7499_8636_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|8686_8914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|8937_9129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|10067_10772_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|12655_13516_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|13684_14389_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|14687_15548_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001262765.1|15824_17135_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|17419_17821_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|17753_18011_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|18103_18757_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001617855.1|19696_20554_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|20546_20621_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|20857_21112_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|21408_21543_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000080195.1|21978_23592_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|23622_23973_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|23969_24395_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_013023861.1|24953_25166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|25256_25682_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|25678_26029_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|26059_27673_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000139341.1|27836_28397_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|28451_29198_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_001617867.1|29217_34488_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_047605472.1|34487_36713_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000199914.1|36709_37489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000850429.1|37691_38423_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000605862.1|38454_38952_-	entry exclusion protein	NA	NA	NA	NA	NA
WP_001007062.1|38970_41790_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000944328.1|41786_43160_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001348758.1|43146_43572_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071571857.1|43519_43867_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059829.1|43796_44342_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001617873.1|44328_44613_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001348757.1|44739_45060_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000019450.1|45959_46940_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 2
NZ_CP019009	Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_3, complete sequence	130905	66054	122443	130905	integrase,transposase	Escherichia_phage(33.33%)	51	105058:105072	112056:112070
WP_085947770.1|66054_67424_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|67669_68389_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|68385_68820_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|68874_70833_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|70898_71132_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290841.1|71194_71734_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|71967_72156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153960.1|72376_72613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|72638_73202_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_000170714.1|73249_74611_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|74662_74893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|75927_76119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|76115_76538_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|76584_76887_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|78253_78688_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|78701_78923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|78923_79607_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|79991_80894_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|81760_82732_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|82731_83898_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|84485_85241_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|86014_86821_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|86821_87127_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|87128_87347_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|88054_89050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|89053_89986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001617890.1|93274_94558_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|94554_96111_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|96293_96515_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|96514_96895_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|96899_97079_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|97106_97466_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|97752_98070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|98297_99314_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|99521_100925_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|100911_101844_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
105058:105072	attL	GGCTGCAGGTTTTTC	NA	NA	NA	NA
WP_000361610.1|105186_106164_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|106448_107189_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|107309_107498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|107864_109034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|109880_110153_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|111395_113366_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
112056:112070	attR	GAAAAACCTGCAGCC	NA	NA	NA	NA
WP_000977394.1|113372_114164_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|114902_115682_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|115681_116704_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_032336940.1|117783_117942_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	98.1	1.2e-22
WP_001067858.1|117994_118699_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|119664_120138_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|120268_121057_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|121262_121610_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|121603_122443_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 1
NZ_CP019010	Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_KPC, complete sequence	55746	28111	37273	55746	integrase,transposase	Enterobacteria_phage(50.0%)	9	26495:26523	30467:30495
26495:26523	attL	GTGCGTTTCAACCGGGTATAGCGCACGTT	NA	NA	NA	NA
WP_002353195.1|28111_28303_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	55.6	7.8e-05
WP_002353184.1|28553_28943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353199.1|29558_30326_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.7	2.0e-14
WP_032442017.1|30562_31006_+	antirestriction protein	NA	NA	NA	NA	NA
30467:30495	attR	AACGTGCGCTATACCCGGTTGAAACGCAC	NA	NA	NA	NA
WP_002353182.1|31168_31816_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	28.3	4.1e-05
WP_002353177.1|31906_32158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|32505_33366_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|33548_34106_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|34267_37273_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
