The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	0	39763	4998584	holin,terminase,integrase,plate,head,portal,capsid,tail	Enterobacteria_phage(84.09%)	51	3240:3254	48858:48872
WP_000005447.1|0_1185_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|1184_1697_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|1752_2127_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|2135_2291_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|2277_5085_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
3240:3254	attL	GCTGGGCGAAACCAT	NA	NA	NA	NA
WP_000979945.1|5097_5586_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|5614_6214_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|6432_6990_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|6992_7526_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|7554_8082_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|8083_10306_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|10308_10839_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|10831_11728_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|11731_12061_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|12078_12645_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|12656_13292_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|13284_13752_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|13775_15653_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|15791_16187_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|16183_16576_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|16572_16896_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|16898_17099_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|17098_17593_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|17694_18495_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|18540_19593_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|19616_20453_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|20607_22359_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|22358_23405_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|23419_23944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|24667_25165_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|25204_26047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|26130_26445_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|26449_27409_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|27485_30308_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|30314_30680_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|30676_31294_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|31305_31605_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|31601_31868_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|31864_32068_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|32091_32502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|32595_32709_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|32705_32948_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|32959_33238_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|33248_33599_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|33736_33928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|33934_34357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|34361_34883_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|34987_35329_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|35398_36391_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|36690_39135_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|39145_39763_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
48858:48872	attR	ATGGTTTCGCCCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	50161	89663	4998584	transposase,plate,tail,capsid,integrase	Burkholderia_virus(45.0%)	57	75261:75276	94582:94597
WP_000057158.1|50161_51250_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|51320_52604_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|52859_53432_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|53491_53932_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_023142129.1|53942_54404_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|54410_55025_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_000527461.1|55024_56356_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000138756.1|56358_56937_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|56929_58033_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|58023_58371_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|58425_59022_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|59018_60173_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|60160_60373_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|60372_61257_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|61256_64208_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|64283_64442_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|64365_64701_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|64798_65080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|65082_65607_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|65603_67031_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|67020_67272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|67271_67736_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|67735_68182_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|68183_68522_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|68531_69485_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|69499_70615_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|70829_71288_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|71290_72112_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|72092_73589_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|73588_75130_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|75180_75726_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
75261:75276	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|75725_76037_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|76036_76363_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|76359_77010_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|76993_77734_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|77736_78087_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|78217_78946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|78921_79323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|79324_79540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|79730_80495_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|80611_80968_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|81061_81250_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|81302_81611_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|81621_82542_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|82541_82859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|82874_84644_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|84654_85821_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|85823_86093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|86120_86651_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|86939_87212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|87221_87518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|87532_87748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|87744_88428_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|88424_88655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|88644_88851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|88852_89302_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|89273_89663_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
94582:94597	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	300989	346698	4998584	holin,terminase,head,tRNA,lysis,tail,portal,capsid,integrase	Enterobacteria_phage(56.0%)	58	299307:299321	327901:327915
299307:299321	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|300989_302096_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|302149_302611_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|302620_303274_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|303445_304696_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|304809_305952_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|305941_306178_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|306317_306557_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|306540_306867_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|306866_307088_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|307186_307468_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|307478_307670_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|307642_307825_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|307821_308502_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|308498_309284_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|309289_309586_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|309661_309868_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|310463_311153_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|311257_311488_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|311557_312097_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|312093_313113_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|313109_313811_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|314060_318326_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|318362_319406_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|319755_319857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|319853_320309_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|320308_320479_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|320471_320762_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|320758_321121_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|321117_321258_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|321254_321944_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|322265_322571_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|322557_323034_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|323250_323433_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|323523_323817_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|324297_324624_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|324830_325013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|325576_326122_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|326096_328022_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
327901:327915	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|328018_328225_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|328221_329823_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|329803_331123_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|331132_331465_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|331520_332546_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|332587_332986_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|332997_333351_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|333362_333941_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|333937_334333_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|334340_335081_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|335096_335519_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|335500_335935_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|335927_338489_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|338485_338815_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|338814_339513_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|339517_340261_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|340197_340800_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|340860_344343_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|344401_346423_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|346419_346698_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	487199	556914	4998584	protease,transposase,holin,terminase,head,tail,portal,capsid,integrase	Stx2-converting_phage(24.56%)	79	483373:483387	489283:489297
483373:483387	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|487199_488330_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|488307_488556_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|488620_491092_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
489283:489297	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|491184_491376_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|491372_491561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|492126_492345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|492504_492660_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|492932_493649_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|493698_493914_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|493910_494336_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|494358_495321_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|495327_496074_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|496095_496866_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|496881_497307_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|497481_498147_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|498327_498540_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|498707_498980_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|498981_500037_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|500037_500418_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|500414_501236_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|501462_501660_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|501811_502861_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|503662_503794_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|504074_504410_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|504670_506524_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|506674_506890_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|506894_507239_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|507204_507477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|507582_508116_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|508670_508757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|508978_509164_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|509249_509465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|509663_509864_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|509905_510271_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|510561_511125_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|511121_512783_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|512846_514784_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|514828_515050_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|514995_517581_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|517577_517904_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|517913_518264_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_078215037.1|518260_518707_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	4.4e-75
WP_000133388.1|518703_519048_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|519114_519831_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|519845_520220_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|520315_520525_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|520572_523815_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|523807_524149_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|524148_524847_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|524857_525601_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|525546_526179_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|526521_529995_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|530635_532177_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|532191_532938_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|533399_536225_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|536226_536760_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|536790_537318_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|537333_538302_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|538427_538610_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|538808_539477_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|539533_539803_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|539917_540088_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|540214_540772_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|540768_541044_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|541419_542226_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|542225_543419_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|543430_544789_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|544792_546388_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|546387_547950_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|548041_548086_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|548223_549105_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|549101_549722_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|549749_551645_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|551857_552733_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|552902_553925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|553934_554243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|554299_554890_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|554886_555645_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|555864_556914_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	1053806	1136316	4998584	holin,terminase,integrase,plate,tRNA,portal,capsid,tail	Escherichia_phage(24.39%)	95	1093766:1093825	1136378:1136502
WP_001258676.1|1053806_1055579_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1055888_1056455_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1056451_1057270_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1057322_1057718_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1057758_1058502_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|1058498_1059470_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1059505_1061935_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1061959_1063060_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1063447_1064194_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1064207_1064774_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1064989_1066723_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1066775_1067168_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1067167_1069246_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1069238_1070387_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|1070575_1071220_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1071230_1071620_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1071634_1072684_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1072686_1073547_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1073837_1075499_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1075643_1076147_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1076167_1078132_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1078136_1079063_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1079059_1079947_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1080073_1080652_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1080654_1081005_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1081784_1082213_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|1082219_1083644_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|1083618_1084419_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1084585_1085572_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|1085586_1087101_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|1087170_1088160_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1088954_1089458_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1089535_1089787_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1089901_1089988_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1090251_1090575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1090746_1091244_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1091281_1091521_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1091711_1092923_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1092973_1093639_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1093766:1093825	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1094110_1094530_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1095744_1095969_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|1096130_1096520_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1096555_1098196_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1098304_1098586_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1098598_1099111_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|1099128_1100631_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1100627_1101017_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1101016_1102201_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1102193_1102820_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1102822_1103743_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1103739_1104081_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1104083_1104986_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1104966_1105503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1105499_1106180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1106211_1106592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1106588_1107008_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1107042_1108077_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1108135_1108465_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1108464_1109772_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1109771_1111346_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1111342_1111576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1111575_1113438_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1113424_1113991_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1114359_1114605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1114664_1114859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1114866_1115346_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1115345_1115618_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1115617_1116001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1116113_1116785_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1116784_1117078_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1117074_1117671_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1117748_1117928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1118079_1118721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1118964_1119198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1119596_1120085_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1120094_1120700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1121162_1121861_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1123049_1123973_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1124147_1124936_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|1125617_1125842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1125838_1126150_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1126146_1126383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1126384_1126795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1126833_1128249_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1128238_1128994_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1128990_1129215_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1129254_1129731_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1129789_1130020_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1130118_1130532_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1131542_1131863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1131893_1134110_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1134106_1134676_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1134675_1134858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1135067_1135331_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1135299_1136316_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1136378:1136502	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	1280447	1286899	4998584	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|1280447_1281989_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1282003_1282750_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|1283198_1283609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1283829_1284648_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1284647_1284893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1284986_1285460_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1285475_1285952_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1286014_1286236_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1286254_1286899_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 7
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	1317702	1324005	4998584		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|1317702_1318245_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1318249_1319128_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1319185_1320085_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1320084_1321170_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1321542_1322436_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|1322610_1324005_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	1418181	1427626	4998584		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1418181_1419318_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1419314_1421318_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1421442_1421904_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1421944_1422415_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1422461_1423181_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1423177_1424863_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1425084_1425816_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1425875_1425983_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1425963_1426695_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1426699_1427626_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 9
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	2004120	2011260	4998584		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2004120_2006682_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2006787_2007444_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|2007494_2008262_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|2008457_2009366_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2009362_2010625_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2010621_2011260_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP019000	Escherichia coli strain Ecol_AZ153 chromosome, complete genome	4998584	2260529	2322619	4998584	protease,transposase,tRNA,lysis,integrase	Staphylococcus_phage(50.0%)	52	2261738:2261755	2322016:2322033
WP_001296354.1|2260529_2261288_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|2261717_2262638_-	agmatinase	NA	NA	NA	NA	NA
2261738:2261755	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|2262773_2263505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2263650_2265627_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2265635_2265767_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|2265902_2266118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2266421_2267576_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2268011_2269406_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|2269482_2269980_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2270074_2270782_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2270861_2271593_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|2271605_2272556_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2272664_2273228_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2273227_2273644_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|2273758_2274739_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2274756_2275461_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2275478_2276045_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|2276041_2276332_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|2276339_2276933_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|2276925_2278062_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|2278376_2279363_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|2279407_2279911_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|2279910_2281212_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|2281267_2282275_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|2282391_2283438_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2283613_2284333_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|2284353_2284494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|2284516_2284843_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2284842_2285562_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|2285722_2286775_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2286802_2287078_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2287142_2288222_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|2288423_2289680_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|2289728_2291864_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2292256_2292964_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2293342_2294608_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|2294863_2295907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|2297600_2298152_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|2300655_2300877_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|2302744_2302858_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|2304691_2304952_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|2304993_2305554_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2305593_2306022_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|2306739_2307933_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|2308068_2309793_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|2309793_2310741_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|2310740_2312483_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2312479_2313757_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|2313838_2316040_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|2316590_2316734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|2316983_2320871_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|2321467_2322619_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2322016:2322033	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 1
NZ_CP018998	Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_2, complete sequence	99006	35836	85192	99006	transposase,integrase	Escherichia_phage(38.1%)	46	71196:71210	78194:78208
WP_085947770.1|35836_37206_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|37451_38171_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|38167_38602_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|38656_40615_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|40680_40914_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290841.1|40976_41516_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|41749_41938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526513.1|42158_42389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|42414_42978_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_000170714.1|43025_44387_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|44438_44669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|45703_45895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|45891_46314_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001671341.1|46360_46663_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|48029_48464_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|48477_48699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|48699_49383_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|49767_50670_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|51536_52508_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|52507_53674_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|54261_55017_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|55790_56597_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|56597_56903_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|56904_57123_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|57830_58826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|58829_59762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001617892.1|60692_62249_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|62431_62653_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|62652_63033_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|63037_63217_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|63244_63604_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|63890_64208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|64435_65452_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|65659_67063_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|67049_67982_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
71196:71210	attL	GGCTGCAGGTTTTTC	NA	NA	NA	NA
WP_000361610.1|71324_72302_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|72586_73327_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|73447_73636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|74002_75172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|76018_76291_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001298664.1|77533_79504_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
78194:78208	attR	GAAAAACCTGCAGCC	NA	NA	NA	NA
WP_000977394.1|79510_80302_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|81040_81820_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|81819_82842_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|83921_84269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001067858.1|84487_85192_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP018999	Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence	146162	2371	35587	146162	transposase,integrase	Escherichia_phage(50.0%)	38	NA	NA
WP_001067855.1|2371_3076_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|3197_4103_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|4099_5338_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|5337_5922_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|6414_7179_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|7685_8186_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|8313_9153_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|9146_9494_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_029391998.1|9677_10151_-	trimethoprim-resistant dihydrofolate reductase DfrA25	NA	A0A1B2IFI7	Erwinia_phage	34.3	1.3e-19
WP_000845048.1|10306_11320_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|11794_12499_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|12803_13808_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|13886_14321_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|14392_14743_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|14756_15032_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|15067_15490_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|15541_17236_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|17253_17616_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|17612_17849_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|17884_18553_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|19942_20647_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000361404.1|21999_23022_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|23006_24569_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|24642_25059_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|25055_25286_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160866775.1|25242_25704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|25873_26092_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_013023785.1|26093_26399_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_017899885.1|26567_26963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|26989_27304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017899884.1|27314_28331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|28528_29323_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|29802_29982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|30101_30728_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|31392_32268_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197646.1|32679_33951_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|33950_34382_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|34615_35587_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 2
NZ_CP018999	Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence	146162	91951	128601	146162	transposase	Enterobacteria_phage(21.74%)	44	NA	NA
WP_001298859.1|91951_93493_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|93507_94254_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_013609537.1|94619_95213_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023836.1|95373_95976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343481.1|96025_96670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343480.1|96725_97376_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|97372_97681_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_000027057.1|97913_98774_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|98956_99514_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_162781868.1|99677_99830_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	78.0	2.9e-10
WP_001067855.1|100160_100865_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934582.1|101333_101891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|102542_103523_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_015493087.1|104036_104432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493086.1|104428_105040_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493085.1|105036_105987_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_040219232.1|106133_106334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|106387_107020_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_015493083.1|107382_108588_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479949.1|108584_109556_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493081.1|109691_110963_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_015493080.1|110962_111385_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493079.1|111564_112236_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_002211749.1|112594_113272_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493077.1|113271_113493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|113503_113923_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493075.1|113976_114756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|115160_115667_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493073.1|115709_115901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|116093_116348_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
WP_042934573.1|116875_117088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162781867.1|117105_117255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493071.1|117325_117556_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_008324186.1|119678_120110_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_008324185.1|120106_120835_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_008324183.1|120831_121155_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
WP_015493069.1|121216_121576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324180.1|122201_122576_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_001067855.1|122701_123406_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|123466_124303_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|124302_125106_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|125166_125982_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|126289_127141_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|127896_128601_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP018999	Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence	146162	136799	144303	146162	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_001067855.1|136799_137504_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|137872_138733_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|138965_139670_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|139859_140675_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|140825_141530_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|141569_142043_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|142165_143146_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|143421_144303_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
