The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	0	45943	5262974	terminase,coat,transposase,lysis,portal,holin	Enterobacteria_phage(29.73%)	54	NA	NA
WP_078207971.1|938_1361_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	82.1	4.4e-64
WP_078207911.1|1357_1885_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	2.1e-100
WP_024176095.1|1881_2064_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_039720094.1|2060_2231_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	5.5e-26
WP_078207912.1|2223_2949_+	phage antirepressor KilAC domain-containing protein	NA	A0A2I6PIF5	Escherichia_phage	99.6	4.2e-131
WP_052920503.1|2948_3239_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	2.2e-51
WP_078207913.1|3235_3598_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	99.2	3.5e-62
WP_057696222.1|3594_3783_+	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
WP_078207914.1|3779_4268_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	96.9	8.5e-88
WP_000783734.1|5185_5509_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_033552118.1|5492_5969_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	8.3e-88
WP_089624613.1|5965_6403_+|lysis	lysis protein	lysis	B9UDJ2	Salmonella_phage	98.6	6.5e-71
WP_015953503.1|6390_6543_+	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	100.0	1.2e-21
WP_000999674.1|7491_7872_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_000807785.1|7975_8218_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000729922.1|8253_8742_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_000417851.1|8719_10219_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_078207916.1|10219_12385_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_000373010.1|12398_13310_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	4.9e-161
WP_078207917.1|13309_14605_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	7.5e-240
WP_078207918.1|14649_14928_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	90.2	1.1e-23
WP_032153671.1|14905_15406_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	1.9e-90
WP_032333370.1|15405_16824_+	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	98.9	8.7e-274
WP_032333369.1|16823_17777_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	85.2	3.1e-94
WP_032333368.1|17776_18232_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	97.4	9.7e-86
WP_078207919.1|18234_18930_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.9	7.6e-90
WP_063612134.1|18939_20346_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_039052553.1|20345_22190_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.6	2.1e-240
WP_016231948.1|22203_22689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757525.1|22723_23089_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
WP_001085430.1|23102_23282_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_078207920.1|23381_23633_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	90.4	5.6e-35
WP_052273607.1|23780_25772_+	hypothetical protein	NA	A0A2D2W320	Escherichia_phage	45.1	1.6e-124
WP_039052559.1|25851_26151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296209.1|26824_27991_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105376.1|28109_28583_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200888.1|28780_29839_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|30010_30340_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|30440_30623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|31111_31225_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|31237_31432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285585.1|31890_32259_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692359.1|32332_32554_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.6e-09
WP_012311619.1|32616_33093_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860090.1|33108_33588_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	32.8	1.7e-11
WP_001234504.1|33669_34491_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.8	2.1e-46
WP_000846713.1|34711_35122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775500.1|35137_35821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|35956_37027_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|37023_37929_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544732.1|37925_40322_-	dynamin family protein	NA	NA	NA	NA	NA
WP_001069805.1|40539_41412_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000514103.1|41495_42647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085960080.1|44574_45943_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.0	3.1e-111
>prophage 2
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	55039	56267	5262974	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|55039_56267_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 3
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	67488	68637	5262974		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705006.1|67488_68637_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
>prophage 4
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	71994	73207	5262974	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085960995.1|71994_73207_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
>prophage 5
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	78401	79115	5262974		Bacillus_virus(100.0%)	1	NA	NA
WP_001094740.1|78401_79115_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	5.2e-17
>prophage 6
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	85112	85340	5262974		Morganella_phage(100.0%)	1	NA	NA
WP_001327934.1|85112_85340_+	hypothetical protein	NA	A0A1W6JP07	Morganella_phage	81.0	5.6e-10
>prophage 7
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	102028	103890	5262974		Mycobacterium_phage(50.0%)	2	NA	NA
WP_001083460.1|102028_103261_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	8.3e-63
WP_000502866.1|103245_103890_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	3.7e-54
>prophage 8
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	130823	195268	5262974	terminase,integrase,protease,head,capsid,portal,tail,holin	Escherichia_phage(48.98%)	61	125387:125402	168663:168678
125387:125402	attL	CGCAACTGGTTGTCGC	NA	NA	NA	NA
WP_078207922.1|130823_140315_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
WP_000623070.1|140402_146510_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140405.1|146700_147660_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001327954.1|147916_149629_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.4e-31
WP_001304269.1|149615_151418_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286281.1|151410_152691_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|152718_154023_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_024165620.1|154216_155479_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
WP_001327955.1|155816_156614_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|156849_157875_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|157874_158078_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_059332707.1|158136_160578_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	2.9e-112
WP_021579309.1|160671_160863_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_059332706.1|160859_161048_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|161447_161612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|161615_161834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044502262.1|161905_162205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000362155.1|162531_162951_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|163051_163333_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|163316_163742_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262353.1|163813_164908_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	79.5	1.7e-51
WP_059332704.1|164948_165371_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403777.1|165428_165785_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001224672.1|165878_166061_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000753060.1|166053_166230_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_021526748.1|166226_166742_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.8e-36
WP_000813254.1|167033_167189_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000737636.1|167332_167725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|168021_168300_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024188120.1|168301_169357_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.9e-88
168663:168678	attR	GCGACAACCAGTTGCG	NA	NA	NA	NA
WP_000140004.1|169357_169723_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_021537289.1|169719_170409_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000839572.1|171220_171436_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193280.1|171440_171791_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992100.1|171854_172388_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228684.1|172604_172790_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_001140099.1|172894_173245_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_059328192.1|173392_173875_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	2.3e-85
WP_059328193.1|173874_175632_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|175643_175826_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_059332703.1|175825_177067_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.0e-241
WP_001193632.1|177044_177695_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000257489.1|177709_178915_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|178968_179157_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|179168_179474_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|179482_179821_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_170987963.1|179820_180267_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.7	6.6e-63
WP_001209399.1|180263_180608_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|180667_181372_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_059328226.1|181386_181758_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	1.9e-63
WP_000978931.1|181781_182060_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_059328225.1|182105_185333_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.8	0.0e+00
WP_001330090.1|185310_185667_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_021528581.1|185666_186365_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	4.7e-132
WP_072775545.1|186368_187112_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	9.8e-144
WP_059327740.1|187009_187657_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	2.5e-111
WP_072775546.1|187717_191197_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_024173375.1|191263_191863_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	3.8e-106
WP_077250922.1|191927_194276_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_000654156.1|194272_194554_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_059332724.1|194563_195268_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
>prophage 9
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	199847	212271	5262974		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|199847_200519_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826734.1|200518_201877_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	8.7e-05
WP_000218195.1|201984_202836_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824355.1|203427_204543_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
WP_001313057.1|205109_205475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365546.1|205514_206210_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157288.1|206276_207695_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000228679.1|207675_208146_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212243.1|208134_209055_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|209227_210145_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|210223_210406_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001361499.1|210576_212271_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.8	1.7e-18
>prophage 10
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	228085	228754	5262974		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334626.1|228085_228754_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	8.1e-81
>prophage 11
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	240751	241504	5262974		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|240751_241504_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 12
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	249147	250671	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000998248.1|249147_250671_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.3	3.7e-89
>prophage 13
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	254431	257716	5262974		Liberibacter_phage(100.0%)	1	NA	NA
WP_022645824.1|254431_257716_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.5	1.4e-64
>prophage 14
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	268093	269608	5262974		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|268093_269608_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 15
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	279696	285340	5262974		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_022645818.1|279696_281358_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_022645817.1|281403_283005_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.1e-14
WP_000204344.1|283023_283884_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|283886_284936_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|284950_285340_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 16
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	292212	293946	5262974	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025308.1|292212_293946_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 17
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	300432	302483	5262974		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|300432_301176_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|301216_301612_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639286.1|301664_302483_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.5e-71
>prophage 18
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	306376	313440	5262974		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|306376_306898_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_022645808.1|306899_307502_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|307572_307638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|307776_308388_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568522.1|308396_309407_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|309553_310339_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_022645806.1|310335_311091_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.0e-18
WP_001347089.1|311169_312102_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|312117_313440_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 19
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	317439	318915	5262974		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|317439_318915_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 20
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	326970	331440	5262974		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|326970_327633_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011651.1|327656_328313_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|328414_328645_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_022645803.1|328783_329158_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_022645802.1|329161_330034_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|330046_330388_+	YebY family protein	NA	NA	NA	NA	NA
WP_022645801.1|330783_331440_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	6.8e-56
>prophage 21
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	338936	340985	5262974		Moraxella_phage(100.0%)	1	NA	NA
WP_022645795.1|338936_340985_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.2e-86
>prophage 22
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	346317	346527	5262974		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|346317_346527_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 23
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	352168	353725	5262974		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|352168_353725_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 24
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	357587	365692	5262974	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_022645792.1|357587_358949_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	4.0e-42
WP_000457334.1|359022_359202_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001322969.1|359321_359681_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|360042_360387_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|360518_362429_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_022645791.1|362486_363182_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290578.1|363220_363802_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_023908848.1|364006_365692_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 25
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	380446	385023	5262974		Bacillus_phage(100.0%)	3	NA	NA
WP_000766137.1|380446_381937_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621396.1|382117_383593_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_022645786.1|383739_385023_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 26
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	388341	389196	5262974		Indivirus(100.0%)	1	NA	NA
WP_022645784.1|388341_389196_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.3	5.6e-10
>prophage 27
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	398005	402090	5262974		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723727.1|398005_398986_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.8e-07
WP_000719088.1|399122_399881_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_022645780.1|399997_401356_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135072.1|401448_402090_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	5.0e-19
>prophage 28
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	407016	408972	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_022645779.1|407016_408972_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 29
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	413362	414016	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_022645777.1|413362_414016_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-10
>prophage 30
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	420780	422001	5262974		Klosneuvirus(100.0%)	1	NA	NA
WP_000081988.1|420780_422001_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.2e-27
>prophage 31
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	429477	430305	5262974		Bacillus_virus(100.0%)	1	NA	NA
WP_022645770.1|429477_430305_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	7.0e-74
>prophage 32
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	436423	438685	5262974		Tupanvirus(100.0%)	1	NA	NA
WP_022645767.1|436423_438685_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	3.9e-143
>prophage 33
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	449974	469369	5262974	tRNA	Tupanvirus(11.11%)	19	NA	NA
WP_001144202.1|449974_451903_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|451906_452449_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|452545_452743_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|452796_453153_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|453275_453320_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_022645764.1|453458_454442_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	1.9e-33
WP_022645763.1|454456_456844_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|456848_457148_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956528.1|457248_458229_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|458291_458843_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|458842_459592_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|459669_460134_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001361438.1|460380_461094_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_022645760.1|461156_462593_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|462596_462788_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082242.1|462919_463966_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	4.7e-83
WP_000368046.1|464122_464956_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_022645759.1|465287_467666_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	2.7e-171
WP_022645758.1|467722_469369_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.3e-31
>prophage 34
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	488016	493100	5262974		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|488016_488385_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_001308677.1|488393_489881_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_022645752.1|489890_490637_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_022645751.1|490611_491883_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_022645750.1|491879_493100_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.7e-92
>prophage 35
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	501390	503657	5262974		Escherichia_phage(50.0%)	3	NA	NA
WP_022645747.1|501390_502059_+	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
WP_022645746.1|502055_502841_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587589.1|502844_503657_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	34.1	6.5e-08
>prophage 36
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	509162	517966	5262974		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|509162_509804_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|509843_510992_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|511282_512494_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|512606_513539_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|513535_514561_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|514859_514949_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_022645744.1|515114_516284_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|516429_517011_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101179.1|517138_517966_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 37
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	526769	528268	5262974		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|526769_527666_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001298528.1|527746_528268_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 38
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	535179	536454	5262974	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|535179_536454_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 39
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	563894	565196	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_022645729.1|563894_565196_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	2.1e-16
>prophage 40
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	582957	682861	5262974	terminase,protease,transposase,lysis,portal,tail	Enterobacteria_phage(37.29%)	106	NA	NA
WP_021516105.1|582957_583572_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526500.1|583614_584469_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|584470_585088_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072146081.1|585098_587522_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.2e-208
WP_022645727.1|587582_590009_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|590207_590513_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|590620_591331_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|591333_591894_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|591928_592270_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|592404_592731_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|592936_594151_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|594162_595182_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|595239_595368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|595369_596650_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|596684_596936_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024946566.1|597008_599480_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|599572_599764_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|599760_599949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|600451_600652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241299.1|600620_600998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|600997_601150_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|601342_601750_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|601827_602055_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|602038_602560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|602540_603506_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|603546_603948_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|604147_605170_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|606032_606140_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|606184_606397_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|606613_606865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|606931_607210_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|607211_608261_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|608273_608630_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|608644_609466_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|610361_610493_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_022645723.1|610859_611288_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|611459_611834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|612085_612301_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|612305_612617_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|612613_613147_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|613143_613641_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|614004_614217_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|614227_614416_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|614563_614719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|614891_615065_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|615360_615567_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_022645722.1|616119_616614_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934104.1|616613_618716_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|618712_618925_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|618924_620433_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|620377_622405_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|622490_622814_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_022645721.1|622806_623082_+	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_000677120.1|623093_623684_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|623680_624082_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|624092_624836_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|624896_625283_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|625291_625609_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|625592_628658_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|628657_628987_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|628996_629695_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|629700_630444_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|630341_630989_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_022645716.1|631049_634529_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001228249.1|634596_635196_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_001546831.1|635260_637633_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|637629_637908_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546829.1|637918_638959_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546828.1|639001_639295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|639522_640113_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|640429_640663_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|640731_640845_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|641449_642733_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|642822_644283_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_000214712.1|644318_644522_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_022645715.1|644698_645385_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|645473_646220_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022645714.1|646356_648402_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_022645713.1|648767_649160_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592819.1|649414_650305_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_000901367.1|650523_650619_-	protein MgtS	NA	NA	NA	NA	NA
WP_022645712.1|650745_651933_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087204.1|652127_653027_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803527.1|653057_653276_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|653307_653691_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_022645711.1|653711_654146_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|654357_655023_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|655047_656238_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_022645710.1|656387_657503_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366505.1|657580_658462_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156623.1|658562_659951_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|660014_660941_+	glutaminase B	NA	NA	NA	NA	NA
WP_022645709.1|660940_661300_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_022645708.1|661438_662857_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_022645707.1|663084_664536_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_022645706.1|664732_665647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645705.1|665650_666409_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558525.1|666465_666756_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_022645704.1|666779_667655_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172485.1|667681_668704_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222725.1|668715_669708_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_022645703.1|669707_670736_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194902.1|670729_672265_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
WP_000154352.1|672513_673467_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_022645702.1|673545_675138_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_088895425.1|681633_682861_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 41
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	696414	703350	5262974		Bacillus_phage(50.0%)	3	NA	NA
WP_023909166.1|696414_698100_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	1.1e-09
WP_022645692.1|698137_700510_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_172801549.1|700566_703350_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.3	3.7e-18
>prophage 42
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	708629	712436	5262974		Bacillus_virus(50.0%)	2	NA	NA
WP_000426277.1|708629_710012_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_022645689.1|710036_712436_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
>prophage 43
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	716752	718658	5262974		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193514.1|716752_717739_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
WP_022645686.1|717731_718658_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-14
>prophage 44
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	721931	723372	5262974		Tupanvirus(50.0%)	2	NA	NA
WP_022645685.1|721931_722942_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.1e-24
WP_000781370.1|723087_723372_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 45
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	729383	730484	5262974		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768394.1|729383_730484_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.1	1.6e-137
>prophage 46
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	738761	740306	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_022645681.1|738761_740306_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 47
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	748654	750763	5262974		Ralstonia_phage(100.0%)	1	NA	NA
WP_022645675.1|748654_750763_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.8e-26
>prophage 48
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	755670	757773	5262974		Salmonella_phage(100.0%)	1	NA	NA
WP_022645671.1|755670_757773_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	5.6e-136
>prophage 49
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	764906	771956	5262974		Mycoplasma_phage(25.0%)	7	NA	NA
WP_022645666.1|764906_765920_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.9	1.7e-26
WP_000047466.1|765937_767083_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022645665.1|767327_768734_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|768812_769229_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|769274_769451_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000491567.1|769672_769903_+	DUF2554 family protein	NA	NA	NA	NA	NA
WP_023909195.1|769994_771956_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	9.2e-24
>prophage 50
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	785116	786065	5262974		Moraxella_phage(50.0%)	2	NA	NA
WP_022645655.1|785116_785290_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	69.8	7.6e-07
WP_078207972.1|785534_786065_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	1.2e-18
>prophage 51
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	790003	793906	5262974		Klosneuvirus(100.0%)	1	NA	NA
WP_023909198.1|790003_793906_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 52
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	807442	808432	5262974		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|807442_808432_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 53
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	813386	820656	5262974	tRNA	Enterobacteria_phage(20.0%)	7	NA	NA
WP_000837933.1|813386_814520_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
WP_001295593.1|814660_815095_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081418.1|815270_816206_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_022645642.1|816334_817708_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
WP_001296046.1|817737_817911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|818185_819169_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|819423_820656_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 54
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	826982	827498	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|826982_827498_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 55
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	841610	842693	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057972.1|841610_842693_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 56
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	856698	857964	5262974		Klosneuvirus(100.0%)	1	NA	NA
WP_022645626.1|856698_857964_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	1.8e-25
>prophage 57
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	870754	872773	5262974		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|870754_871561_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135018.1|871609_872773_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	1.3e-28
>prophage 58
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	881694	883629	5262974		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|881694_883629_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 59
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	891443	892034	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|891443_892034_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 60
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	896959	902251	5262974	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001295576.1|896959_899557_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|899936_900188_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422059.1|900223_901273_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559277.1|901492_902251_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 61
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	910741	913699	5262974		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763524.1|910741_912337_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001195273.1|912340_913699_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
>prophage 62
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	925364	927379	5262974		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|925364_926369_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110931.1|926365_927379_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 63
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	937227	947059	5262974		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068076.1|937227_937845_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|938448_938862_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|939006_939915_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|940116_941130_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|941221_942127_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_078207926.1|942239_942698_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|942747_943590_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|944136_944814_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571695.1|944813_945524_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702650.1|945520_947059_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 64
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	958190	964995	5262974		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
WP_001146444.1|958190_958421_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001301956.1|958690_959791_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170956.1|960196_960304_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_022645587.1|960731_960839_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|960987_961842_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_022645586.1|961877_962687_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|962690_963083_-	SirB family protein	NA	NA	NA	NA	NA
WP_022645585.1|963079_963913_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_022645584.1|963912_964995_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 65
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	968131	974675	5262974	integrase,tRNA	Tupanvirus(33.33%)	6	963091:963103	975906:975918
963091:963103	attL	AGCGGCCGAGCGT	NA	NA	NA	NA
WP_001298109.1|968131_969079_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033344.1|969203_970883_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|970937_971216_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|971493_972078_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|972194_973286_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_022645582.1|973499_974675_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.8e-73
975906:975918	attR	ACGCTCGGCCGCT	NA	NA	NA	NA
>prophage 66
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	992863	998352	5262974	integrase,transposase	Shigella_phage(25.0%)	9	986322:986335	1005426:1005439
986322:986335	attL	TGGACTGACCCCAC	NA	NA	NA	NA
WP_085949836.1|992863_994076_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_022645569.1|994046_994289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645568.1|994290_994488_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.9	1.1e-06
WP_016248782.1|994711_995326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908767.1|995312_996242_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	29.0	2.3e-09
WP_022645566.1|996288_996741_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_032140166.1|996742_997204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908768.1|997323_997716_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_022645563.1|997977_998352_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.8	6.3e-06
1005426:1005439	attR	TGGACTGACCCCAC	NA	NA	NA	NA
>prophage 67
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1023298	1024057	5262974		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173310.1|1023298_1024057_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 68
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1042143	1043831	5262974		Salmonella_phage(50.0%)	2	NA	NA
WP_022645546.1|1042143_1043412_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.9	8.7e-209
WP_000897372.1|1043411_1043831_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	5.3e-38
>prophage 69
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1052341	1054663	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_022645541.1|1052341_1054663_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.5	9.4e-92
>prophage 70
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1060531	1064267	5262974		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332300.1|1060531_1061263_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373096.1|1061483_1061888_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032140169.1|1061940_1062051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871293.1|1062590_1062914_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	4.0e-41
WP_000444487.1|1063016_1064267_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 71
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1069690	1071061	5262974		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_022645538.1|1069690_1071061_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
>prophage 72
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1076082	1078060	5262974		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|1076082_1077219_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|1077202_1078060_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 73
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1081335	1085058	5262974		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|1081335_1082157_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|1082172_1083084_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251367.1|1083112_1084357_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|1084356_1085058_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 74
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1092346	1092604	5262974		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1092346_1092604_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 75
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1104927	1106570	5262974		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267967.1|1104927_1105932_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257007.1|1105928_1106570_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
>prophage 76
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1109842	1111024	5262974		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1109842_1110079_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_022645528.1|1110289_1111024_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 77
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1124186	1125128	5262974		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001317765.1|1124186_1125128_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 78
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1140973	1141219	5262974		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1140973_1141219_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 79
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1145881	1146802	5262974		Morganella_phage(100.0%)	1	NA	NA
WP_022645512.1|1145881_1146802_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	6.6e-57
>prophage 80
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1156110	1156644	5262974		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_022645508.1|1156110_1156644_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	46.6	1.0e-25
>prophage 81
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1160780	1161614	5262974		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1160780_1161614_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 82
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1165004	1166372	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_001518481.1|1165004_1166372_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 83
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1173194	1173983	5262974		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533533.1|1173194_1173983_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.0e-90
>prophage 84
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1188561	1190661	5262974		Enterobacteria_phage(100.0%)	3	NA	NA
WP_022645497.1|1188561_1189056_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
WP_022645496.1|1189076_1190405_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.2e-234
WP_001273658.1|1190487_1190661_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 85
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1194965	1207279	5262974		Klosneuvirus(20.0%)	13	NA	NA
WP_022645492.1|1194965_1195886_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|1195885_1196191_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_022645491.1|1196342_1196942_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_022645490.1|1196938_1199485_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.6	1.7e-70
WP_001230246.1|1199484_1200657_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|1200786_1201479_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_022645489.1|1201451_1202480_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_099441952.1|1202562_1205295_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.6e-37
WP_022645487.1|1205377_1206451_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1206499_1206673_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_032140175.1|1206662_1206893_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528143.1|1206867_1207056_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|1207066_1207279_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 86
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1218272	1218932	5262974	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1218272_1218932_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 87
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1223166	1225221	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_022645482.1|1223166_1225221_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 88
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1237821	1239729	5262974		Tupanvirus(100.0%)	1	NA	NA
WP_022645480.1|1237821_1239729_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	6.4e-54
>prophage 89
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1255501	1266282	5262974	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|1255501_1256269_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193817.1|1256311_1258924_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_022645470.1|1259189_1260392_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1260559_1261960_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977905.1|1262561_1263635_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000462687.1|1263819_1265010_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109455.1|1265059_1265707_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1265733_1266282_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 90
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1280987	1285527	5262974		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|1280987_1282736_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_022645464.1|1282772_1285037_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1285242_1285527_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 91
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1290613	1291702	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_022645462.1|1290613_1291702_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.7e-81
>prophage 92
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1295800	1299015	5262974		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292820.1|1295800_1298083_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|1298274_1299015_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 93
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1305324	1399429	5262974	terminase,integrase,protease,portal,head,plate,transposase,lysis,capsid,tail,tRNA	Salmonella_phage(58.62%)	92	1365125:1365151	1399504:1399530
WP_000213098.1|1305324_1305942_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_022645456.1|1305952_1308397_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.6e-219
WP_000886683.1|1308635_1309928_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|1310018_1311362_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|1311372_1311984_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_022645455.1|1312141_1316212_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1316346_1316841_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|1317384_1318350_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043590.1|1318472_1320239_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202192.1|1320239_1321961_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_022645453.1|1322002_1322707_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1322991_1323210_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1323957_1326234_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1326264_1326585_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1326907_1327132_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_022645444.1|1327204_1329151_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000746460.1|1329147_1330263_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|1330413_1331370_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|1331366_1333025_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|1333450_1334146_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000868863.1|1334378_1335404_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022645441.1|1335989_1336889_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_022645440.1|1337031_1338684_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178691.1|1338695_1339664_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815366.1|1339796_1341515_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000566375.1|1341551_1342553_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_022645439.1|1342563_1343994_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|1344092_1345106_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|1345102_1345933_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160731.1|1345929_1346253_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022645438.1|1346463_1348233_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001270657.1|1348880_1349396_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1349613_1350342_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|1350359_1351091_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001702.1|1351097_1351814_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464489.1|1351813_1352482_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1352707_1353439_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149713.1|1353467_1354595_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1354635_1355124_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|1355183_1356029_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|1356025_1356979_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|1356988_1358122_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126075.1|1358216_1359329_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1359679_1360156_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1360243_1361146_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_022645436.1|1361913_1362201_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|1362360_1362618_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|1362647_1363025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|1363294_1364980_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1365125:1365151	attL	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
WP_000972391.1|1365215_1365434_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_022645435.1|1365524_1366625_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_022645434.1|1366621_1367107_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645433.1|1367103_1370181_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000763311.1|1370173_1370293_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645432.1|1370307_1370610_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_001207660.1|1370664_1371180_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046146.1|1371189_1372362_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_022645431.1|1372495_1373098_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_022645430.1|1373097_1374639_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645429.1|1374635_1375241_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645428.1|1375233_1376142_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_000177597.1|1376128_1376488_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993764.1|1376484_1377063_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_022645427.1|1377166_1377973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522006.1|1377914_1378361_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_001595569.1|1378353_1378785_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_022645426.1|1378880_1379309_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_022645425.1|1379305_1379683_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_022645424.1|1379684_1380197_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_000171568.1|1380177_1380393_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1380396_1380600_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|1380599_1381064_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_021534472.1|1381159_1381810_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000742503.1|1381813_1382872_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_022645423.1|1382888_1383722_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_022645422.1|1383864_1385631_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645421.1|1385630_1386665_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645420.1|1386701_1388483_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645419.1|1389016_1390075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217562.1|1390249_1390483_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|1390493_1390682_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_022645418.1|1390835_1393250_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_000104157.1|1393246_1394104_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_001399246.1|1394100_1394328_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244228.1|1394327_1394561_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001311552.1|1394628_1394970_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956182.1|1394933_1395134_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_022645417.1|1395141_1395651_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|1395683_1395905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645416.1|1396000_1396597_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_022645415.1|1396617_1398294_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_001595551.1|1398376_1399429_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
1399504:1399530	attR	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 94
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1405563	1406766	5262974		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1405563_1406766_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 95
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1419054	1420926	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_015674614.1|1419054_1420926_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 96
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1424243	1428374	5262974		Synechococcus_phage(50.0%)	3	NA	NA
WP_001361717.1|1424243_1424906_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001361718.1|1425036_1425936_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209369.1|1425941_1428374_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 97
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1435973	1437569	5262974		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|1435973_1437569_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 98
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1442566	1447792	5262974		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1442566_1443082_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1443134_1443200_-	protein YliM	NA	NA	NA	NA	NA
WP_001361720.1|1443434_1444322_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1444621_1445125_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1445528_1446275_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1446413_1447073_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1447069_1447792_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 99
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1454180	1455198	5262974		Synechococcus_phage(50.0%)	2	NA	NA
WP_000990144.1|1454180_1454858_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	9.0e-19
WP_000146334.1|1454931_1455198_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
>prophage 100
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1460332	1466037	5262974		Faustovirus(33.33%)	5	NA	NA
WP_001145123.1|1460332_1460815_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_022645405.1|1461048_1462410_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001361295.1|1462638_1463310_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001361294.1|1463312_1464308_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001361293.1|1464300_1466037_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 101
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1476637	1477546	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_022645402.1|1476637_1477546_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	6.4e-28
>prophage 102
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1483873	1485163	5262974		Klosneuvirus(100.0%)	1	NA	NA
WP_022645398.1|1483873_1485163_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 103
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1495355	1501929	5262974		Planktothrix_phage(33.33%)	7	NA	NA
WP_022645396.1|1495355_1496414_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	5.7e-20
WP_000604037.1|1496416_1497106_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113014.1|1497105_1497879_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1498045_1498195_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1498323_1499112_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_022645395.1|1499179_1500652_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.2e-12
WP_001265443.1|1500912_1501929_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 104
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1506291	1509811	5262974		Serratia_phage(33.33%)	4	NA	NA
WP_001109189.1|1506291_1507344_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A1Z1LZD8	Serratia_phage	48.2	7.5e-81
WP_000784351.1|1507659_1508040_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951276.1|1508153_1509095_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_022645393.1|1509091_1509811_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	7.0e-22
>prophage 105
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1543602	1545000	5262974		Bordetella_phage(100.0%)	1	NA	NA
WP_022645376.1|1543602_1545000_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	31.8	2.4e-34
>prophage 106
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1561076	1561832	5262974		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000991075.1|1561076_1561832_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.2e-10
>prophage 107
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1565755	1566547	5262974		Kaumoebavirus(100.0%)	1	NA	NA
WP_022645370.1|1565755_1566547_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.1	9.8e-09
>prophage 108
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1569925	1581758	5262974		Hokovirus(40.0%)	10	NA	NA
WP_022645366.1|1569925_1571407_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	5.5e-45
WP_022645365.1|1571448_1572867_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	9.5e-63
WP_022645364.1|1572863_1573373_-	YbgA family protein	NA	NA	NA	NA	NA
WP_021540171.1|1573473_1573680_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1573992_1574082_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_022645363.1|1574081_1575755_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_022645362.1|1575777_1577826_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	7.1e-27
WP_012602229.1|1577834_1578407_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_022645361.1|1578399_1581084_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|1581080_1581758_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 109
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1590002	1590767	5262974		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773282.1|1590002_1590767_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 110
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1594911	1598725	5262974	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287164.1|1594911_1596576_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
WP_022645357.1|1596778_1598725_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 111
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1603350	1605015	5262974		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1603350_1605015_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 112
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1609581	1610622	5262974		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1609581_1610622_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 113
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1618575	1622108	5262974		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1618575_1619301_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_022645353.1|1619418_1620354_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_022645352.1|1620437_1622108_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	2.3e-76
>prophage 114
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1629047	1631630	5262974	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157896.1|1629047_1631630_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 115
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1638640	1641080	5262974		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1638640_1639729_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1639868_1641080_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 116
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1645898	1646545	5262974		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|1645898_1646282_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1646335_1646545_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 117
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1660635	1662750	5262974		Morganella_phage(50.0%)	2	NA	NA
WP_001308472.1|1660635_1661064_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
WP_023908820.1|1661184_1662750_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 118
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1665813	1667636	5262974		Streptococcus_phage(50.0%)	2	NA	NA
WP_001571091.1|1665813_1667034_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
WP_000502940.1|1667006_1667636_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 119
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1681958	1688000	5262974		Klosneuvirus(50.0%)	3	NA	NA
WP_000140634.1|1681958_1682774_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
WP_022645336.1|1682770_1683904_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_022645335.1|1684118_1688000_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	4.2e-60
>prophage 120
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1698936	1702080	5262974		Leptospira_phage(100.0%)	1	NA	NA
WP_022645331.1|1698936_1702080_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	5.7e-60
>prophage 121
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1705225	1771920	5262974	terminase,integrase,protease,head,transposase,capsid,portal,lysis,tail	Enterobacteria_phage(58.93%)	73	1725002:1725048	1771934:1771980
WP_000770953.1|1705225_1705909_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_022645328.1|1705898_1707347_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
WP_000103215.1|1708090_1709992_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
WP_001160804.1|1710019_1710481_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_022645327.1|1710500_1715354_+	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.8	9.9e-19
WP_022645326.1|1715350_1715740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645324.1|1716593_1717730_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_022645323.1|1717927_1720165_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_022645322.1|1720151_1723124_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645321.1|1723124_1724015_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177457.1|1724197_1724959_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1725002:1725048	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201842.1|1725471_1726425_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|1726673_1727423_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_022645319.1|1728434_1729475_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
WP_001204892.1|1729487_1729757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023909117.1|1729756_1732114_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
WP_038431964.1|1732178_1732778_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_023909233.1|1732845_1736325_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_000090891.1|1736385_1737018_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_022645314.1|1736954_1737698_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152639.1|1737703_1738402_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847321.1|1738401_1738731_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_022645313.1|1738727_1741289_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_022645312.1|1741281_1741716_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_001468358.1|1741697_1742120_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_001547245.1|1742135_1742876_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_000683105.1|1742883_1743279_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1743275_1743854_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752979.1|1743865_1744219_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|1744230_1744629_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_022645311.1|1744670_1745696_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_001297109.1|1745751_1746084_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_022645310.1|1746093_1747413_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001553867.1|1747393_1748995_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_000198149.1|1748991_1749198_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|1749194_1751120_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453580.1|1751094_1751640_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|1752028_1752262_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|1752318_1752729_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|1753080_1753233_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|1753220_1753688_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_078207934.1|1753684_1754182_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_000839582.1|1754181_1754397_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_022645309.1|1754584_1755316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|1755667_1756627_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|1756819_1757344_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_022645308.1|1757499_1757877_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
WP_000971074.1|1757962_1758103_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|1758099_1758462_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|1758458_1758749_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|1758741_1758912_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|1758911_1759367_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072130332.1|1759363_1759465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|1759554_1759911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351655.1|1760372_1760696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|1760807_1762334_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_032139864.1|1762391_1762499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|1762590_1762923_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145902.1|1762990_1763293_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_000788890.1|1763289_1763991_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000147901.1|1763987_1765007_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_001182772.1|1765003_1765543_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001067458.1|1765612_1765843_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|1765947_1766637_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233579.1|1767231_1767438_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_020241285.1|1767514_1767811_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_022645306.1|1767816_1768602_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
WP_000186848.1|1768598_1769279_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149544.1|1769275_1769458_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|1769430_1769622_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_022645305.1|1770013_1770232_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
WP_000488407.1|1770279_1770558_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|1770756_1771920_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
1771934:1771980	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 122
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1779000	1782131	5262974	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|1779000_1779867_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1779868_1780081_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143564.1|1780188_1780710_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|1780745_1782131_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 123
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1793647	1794793	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_001317663.1|1793647_1794793_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	1.6e-47
>prophage 124
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1800985	1802767	5262974		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_022645294.1|1800985_1802767_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 125
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1809566	1810253	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110563.1|1809566_1810253_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	4.5e-34
>prophage 126
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1813389	1814067	5262974		Bacillus_virus(100.0%)	1	NA	NA
WP_001157538.1|1813389_1814067_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 127
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1821165	1824407	5262974		Escherichia_phage(66.67%)	3	NA	NA
WP_022645288.1|1821165_1823670_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	5.0e-115
WP_000806442.1|1823727_1824069_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000057541.1|1824104_1824407_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 128
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1832597	1841055	5262974		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_001357009.1|1832597_1833557_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	4.2e-14
WP_001250117.1|1833553_1834516_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1834647_1835292_-	adenylate kinase	NA	NA	NA	NA	NA
WP_022645285.1|1835472_1837347_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	2.3e-117
WP_001195025.1|1837456_1838062_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1838061_1838391_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_022645284.1|1838443_1840375_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1840503_1841055_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 129
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1847893	1851043	5262974		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1847893_1851043_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 130
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1859879	1863426	5262974		Bacillus_phage(100.0%)	2	NA	NA
WP_001256219.1|1859879_1861661_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.1e-42
WP_001235636.1|1861653_1863426_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-50
>prophage 131
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1866749	1867445	5262974		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817228.1|1866749_1867445_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 132
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1870585	1875632	5262974	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1870585_1870858_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|1871066_1873421_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1873608_1874883_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|1875008_1875632_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 133
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1897066	1905907	5262974	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|1897066_1897537_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150434.1|1897625_1898729_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_000543535.1|1898732_1899182_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001298536.1|1899332_1899872_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|1900169_1901054_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|1901091_1901439_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1901567_1902539_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1902549_1904397_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1904424_1904757_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|1904779_1905907_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 134
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1914506	1924475	5262974		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|1914506_1915802_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|1915859_1916549_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_022645272.1|1916738_1917941_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_022645271.1|1917937_1921081_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_024181803.1|1921206_1922391_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|1922530_1923439_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|1923563_1924475_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 135
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1928761	1929877	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1928761_1929877_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 136
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1937291	1938449	5262974		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1937291_1938449_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 137
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1945387	1946155	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_022645265.1|1945387_1946155_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	2.5e-25
>prophage 138
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1951451	1952561	5262974		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1951451_1952561_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 139
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1955642	1957603	5262974		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_000998299.1|1955642_1956656_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
WP_000044319.1|1956652_1957603_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
>prophage 140
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1963013	1967293	5262974		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805889.1|1963013_1964096_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.6	4.5e-190
WP_022645259.1|1964218_1967293_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.9	0.0e+00
>prophage 141
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1971819	1977414	5262974		Lactobacillus_phage(50.0%)	4	NA	NA
WP_022645256.1|1971819_1972719_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.9e-16
WP_022645255.1|1972758_1974042_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076249.1|1974031_1975291_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010240.1|1975527_1977414_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 142
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1985795	1986845	5262974		Tupanvirus(100.0%)	1	NA	NA
WP_022645251.1|1985795_1986845_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 143
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	1997907	2003845	5262974	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131040.1|1997907_1999941_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_022645246.1|2000069_2000657_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_022645245.1|2000670_2002143_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022645244.1|2002156_2003845_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.2e-59
>prophage 144
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2009233	2012538	5262974		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_022645240.1|2009233_2010559_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	2.3e-111
WP_000474002.1|2010667_2010904_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001355150.1|2010915_2011509_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_022645239.1|2011668_2012538_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
>prophage 145
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2018582	2019434	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|2018582_2019434_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 146
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2036477	2040189	5262974		Streptococcus_phage(66.67%)	3	NA	NA
WP_022645230.1|2036477_2037731_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
WP_022645229.1|2037742_2038846_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_022645228.1|2039133_2040189_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
>prophage 147
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2045687	2046839	5262974		Mycobacterium_phage(100.0%)	1	NA	NA
WP_023909049.1|2045687_2046839_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.9	3.5e-31
>prophage 148
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2051918	2055746	5262974		Clostridioides_phage(50.0%)	5	NA	NA
WP_022645219.1|2051918_2052692_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729708.1|2052877_2053138_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001225679.1|2053573_2054314_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2054284_2055052_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001570958.1|2055167_2055746_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
>prophage 149
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2060333	2127798	5262974	protease,plate,transposase,tRNA	Shigella_phage(10.0%)	58	NA	NA
WP_085949836.1|2060333_2061546_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001142958.1|2061733_2062252_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|2062948_2063449_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_022645217.1|2063483_2063708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645216.1|2063758_2065234_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645215.1|2065240_2065654_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645214.1|2065657_2067508_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645213.1|2067471_2068554_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113710.1|2068578_2069859_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2069855_2070380_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022645212.1|2070382_2071714_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022645211.1|2071718_2072480_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645210.1|2072488_2075248_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645209.1|2075244_2075988_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645208.1|2075992_2077408_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122988716.1|2077516_2080951_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645206.1|2080961_2082314_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_022645205.1|2082337_2082820_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645204.1|2082863_2083772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|2083786_2084254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645202.1|2084403_2085189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|2085723_2086455_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|2086519_2086987_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|2086983_2087706_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|2087739_2088495_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2088566_2089925_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211702.1|2089972_2090743_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2090819_2091620_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648568.1|2091860_2092775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645201.1|2092771_2093575_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_001140178.1|2099344_2099917_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593991.1|2100104_2101136_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2101128_2101782_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|2101821_2102637_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2102754_2103159_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094006.1|2103155_2103863_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_022645200.1|2103973_2105692_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_022645199.1|2105744_2106569_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239184.1|2106724_2107435_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635528.1|2107448_2107871_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|2107867_2108413_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2108578_2108779_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062318.1|2108765_2109026_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_022645198.1|2109074_2110373_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2110437_2110827_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020966.1|2110883_2113025_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|2113123_2114083_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|2114095_2117578_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_022645197.1|2117614_2118211_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_022645196.1|2118207_2119356_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2119355_2120144_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2120147_2120603_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|2120707_2121733_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2121736_2122222_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2122343_2124776_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_022645195.1|2124805_2126158_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922435.1|2126169_2127027_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|2127039_2127798_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 150
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2140095	2141520	5262974	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753942.1|2140095_2141520_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 151
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2145449	2145794	5262974		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2145449_2145794_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 152
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2151828	2152626	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2151828_2152626_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 153
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2157713	2164519	5262974	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_022645190.1|2157713_2160143_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
WP_001294704.1|2160216_2160747_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396038.1|2160761_2161466_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2161643_2162099_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_022645189.1|2162135_2163062_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|2163100_2164519_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 154
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2174699	2175632	5262974	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_016242754.1|2174699_2175632_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
>prophage 155
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2178894	2185362	5262974		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|2178894_2179821_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|2179929_2180592_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2180632_2181169_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_022645183.1|2181374_2183765_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_022645182.1|2183811_2185362_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 156
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2193108	2194533	5262974		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_078207936.1|2193108_2194533_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 157
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2203043	2203595	5262974		Sphingobium_phage(100.0%)	1	NA	NA
WP_022645179.1|2203043_2203595_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	1.1e-11
>prophage 158
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2207840	2208884	5262974		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|2207840_2208884_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 159
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2234855	2240251	5262974		Ostreococcus_lucimarinus_virus(50.0%)	5	NA	NA
WP_000425651.1|2234855_2236580_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
WP_120795371.1|2236698_2236743_+	protein YabR	NA	NA	NA	NA	NA
WP_001361829.1|2236897_2237842_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_001300467.1|2238500_2238587_+	leu operon leader peptide	NA	NA	NA	NA	NA
WP_000082807.1|2238679_2240251_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.4	4.5e-05
>prophage 160
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2249068	2249767	5262974		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916296.1|2249068_2249767_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	6.2e-23
>prophage 161
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2256098	2261520	5262974		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035635.1|2256098_2258450_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	1.3e-37
WP_022645167.1|2258613_2261520_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 162
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2270606	2272567	5262974		Microcystis_phage(50.0%)	4	NA	NA
WP_000257195.1|2270606_2271455_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160966.1|2271451_2271766_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125568.1|2271768_2272002_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|2272087_2272567_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 163
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2280460	2286120	5262974		Vibrio_phage(50.0%)	4	NA	NA
WP_000787109.1|2280460_2281975_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|2282005_2283148_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349943.1|2283276_2284494_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_022645163.1|2284566_2286120_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	4.1e-35
>prophage 164
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2291623	2292772	5262974		Halovirus(100.0%)	1	NA	NA
WP_001558523.1|2291623_2292772_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 165
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2297198	2300015	5262974	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|2297198_2300015_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 166
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2309500	2310667	5262974		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000681360.1|2309500_2310667_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 167
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2315121	2322494	5262974		Stx2-converting_phage(25.0%)	8	NA	NA
WP_001181672.1|2315121_2315331_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|2315434_2316565_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2316653_2318570_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843577.1|2318945_2319350_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102376.1|2319375_2320089_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528541.1|2320237_2320804_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|2320838_2321426_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|2321540_2322494_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 168
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2334149	2336263	5262974		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_022646481.1|2334149_2335574_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	3.2e-10
WP_001188687.1|2335573_2336263_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 169
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2339449	2343265	5262974		Bacillus_phage(50.0%)	2	NA	NA
WP_000409419.1|2339449_2341387_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2341597_2343265_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
>prophage 170
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2347541	2348774	5262974		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|2347541_2348774_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 171
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2355481	2356804	5262974		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2355481_2356804_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 172
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2362941	2365817	5262974		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|2362941_2363103_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2363229_2363835_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|2364227_2365817_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 173
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2373824	2375104	5262974		Salmonella_phage(50.0%)	2	NA	NA
WP_000098815.1|2373824_2374364_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2374366_2375104_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 174
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2378331	2383663	5262974		Tupanvirus(50.0%)	3	NA	NA
WP_000106030.1|2378331_2379354_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|2379492_2380407_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078207938.1|2382031_2383663_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	8.8e-12
>prophage 175
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2421900	2422821	5262974	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181202.1|2421900_2422821_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.6e-61
>prophage 176
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2430334	2430889	5262974		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|2430334_2430889_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 177
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2437457	2438918	5262974		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208205.1|2437457_2438918_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 178
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2449185	2517205	5262974	holin,transposase	Stx2-converting_phage(25.0%)	57	NA	NA
WP_000044711.1|2449185_2449782_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|2450259_2450862_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_001295734.1|2452317_2453034_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_088895425.1|2453648_2454877_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000991438.1|2455560_2456541_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
WP_001322394.1|2457155_2458172_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001323209.1|2458322_2459309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054376.1|2460300_2460558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309181.1|2460569_2461115_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000354251.1|2461170_2461917_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000010829.1|2462702_2463824_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_000722973.1|2463820_2464099_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000460843.1|2464110_2465424_+	PTS system EIIC permease component	NA	NA	NA	NA	NA
WP_000118626.1|2465436_2466243_+	BtpA family protein SgcQ	NA	NA	NA	NA	NA
WP_000606406.1|2466373_2466805_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000600622.1|2466816_2467449_+	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
WP_000082780.1|2467465_2468248_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000251798.1|2468550_2469339_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000714563.1|2469343_2470249_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000116326.1|2470259_2472227_+	xylonate dehydratase YjhG	NA	NA	NA	NA	NA
WP_001128363.1|2472333_2473683_+	GntP family permease	NA	NA	NA	NA	NA
WP_000373366.1|2474029_2475016_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000471147.1|2475056_2476061_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_000439687.1|2476164_2476806_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001022014.1|2476836_2477952_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000132327.1|2477961_2479221_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_001295723.1|2480148_2480517_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|2480679_2480901_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|2480963_2481440_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|2481455_2481929_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001234653.1|2482270_2483089_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_001323397.1|2483243_2483402_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820498.1|2483472_2486592_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|2486963_2487836_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|2489066_2490551_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|2490872_2491475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322501.1|2491569_2491848_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000221515.1|2493299_2493869_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|2494128_2494530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|2494517_2494952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|2495306_2495687_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2495683_2496031_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998017.1|2496080_2497466_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
WP_000823243.1|2497704_2499063_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555337.1|2499795_2500053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|2501803_2502325_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|2502321_2503275_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188283.1|2503361_2505686_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879155.1|2505730_2506633_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|2506629_2507628_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684852.1|2507624_2508581_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000175457.1|2508581_2509349_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|2509905_2510163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|2511421_2512573_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001293436.1|2513629_2515627_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|2515689_2516103_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|2516037_2517205_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
>prophage 179
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2526857	2527877	5262974		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001309160.1|2526857_2527877_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
>prophage 180
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2533003	2542181	5262974	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_001294573.1|2533003_2534506_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001295681.1|2534666_2535749_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2535748_2536849_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2537115_2538627_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2538882_2539326_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|2539325_2542181_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 181
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2550458	2556555	5262974		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2550458_2551394_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2551406_2551868_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2551940_2552327_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|2552532_2555229_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2555369_2555423_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|2555607_2556555_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 182
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2560193	2562954	5262974		Vibrio_phage(100.0%)	2	NA	NA
WP_000187778.1|2560193_2562332_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106222.1|2562489_2562954_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
>prophage 183
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2567269	2573750	5262974		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2567269_2568268_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_022646475.1|2568300_2569296_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001298067.1|2569282_2570305_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022646474.1|2570318_2571821_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	8.1e-12
WP_000265933.1|2571953_2572910_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2573219_2573750_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 184
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2615317	2616481	5262974		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944003.1|2615317_2616481_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.8e-80
>prophage 185
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2620413	2633444	5262974	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|2620413_2622855_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|2622893_2623319_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2623523_2624822_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2624925_2625123_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2625204_2626209_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312479.1|2626211_2627471_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|2627556_2628837_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2628912_2629221_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|2629306_2630257_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_022646467.1|2630249_2632097_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_000990261.1|2632106_2633444_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 186
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2637359	2637905	5262974		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2637359_2637905_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 187
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2645332	2646310	5262974		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2645332_2646310_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 188
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2651230	2651764	5262974		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2651230_2651764_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 189
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2655965	2657949	5262974		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|2655965_2657612_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2657655_2657949_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 190
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2672226	2675438	5262974	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_022646457.1|2672226_2673684_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
WP_022646456.1|2673920_2675438_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	1.2e-87
>prophage 191
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2695002	2696505	5262974		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2695002_2696505_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 192
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2701345	2702134	5262974		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|2701345_2702134_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 193
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2707697	2709247	5262974		Bacillus_virus(50.0%)	2	NA	NA
WP_001075536.1|2707697_2708456_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
WP_022646447.1|2708566_2709247_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 194
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2715369	2721738	5262974		Bacillus_virus(50.0%)	5	NA	NA
WP_022646444.1|2715369_2716902_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
WP_022646443.1|2716880_2717861_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001311314.1|2717871_2718567_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_022646442.1|2718550_2719480_+	allose kinase	NA	NA	NA	NA	NA
WP_022646441.1|2719752_2721738_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	42.4	2.3e-139
>prophage 195
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2726983	2729131	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2726983_2729131_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 196
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2738528	2740487	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_022646435.1|2738528_2740487_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 197
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2744541	2745891	5262974		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|2744541_2745891_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 198
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2749708	2753322	5262974		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2749708_2750245_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|2750499_2753322_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 199
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2757529	2800680	5262974	terminase,integrase,protease,holin,head,capsid,lysis,portal,tail,tRNA	Escherichia_phage(33.33%)	57	2759223:2759238	2780476:2780491
WP_001147328.1|2757529_2758609_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|2758661_2760077_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
2759223:2759238	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
WP_022646433.1|2760159_2761143_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|2761308_2761551_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543825.1|2761684_2762722_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332260.1|2762810_2763908_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_001217539.1|2763969_2764218_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_022646432.1|2764328_2764616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595444.1|2764626_2765331_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646431.1|2765340_2765622_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_022646430.1|2765618_2767967_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_001228252.1|2768031_2768631_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_038432220.1|2768698_2772178_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_000741576.1|2772238_2772886_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_032152077.1|2772783_2773527_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_021543563.1|2773531_2774230_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
WP_023908869.1|2774229_2774571_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
WP_024946502.1|2774563_2777806_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
WP_021543566.1|2777851_2778193_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
WP_021543567.1|2778251_2778530_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
WP_021543568.1|2778553_2778925_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
WP_023908871.1|2778939_2779644_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
WP_021543570.1|2779703_2780048_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
WP_021543571.1|2780044_2780494_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
2780476:2780491	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
WP_021543572.1|2780490_2780829_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
WP_021543573.1|2780838_2781144_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_023908872.1|2781155_2781344_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
WP_023908873.1|2781393_2782599_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
WP_001193633.1|2782613_2783264_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_023908874.1|2783241_2784483_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
WP_000605605.1|2784482_2784665_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_065312442.1|2784676_2786173_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000929184.1|2786406_2786901_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_024946501.1|2787027_2787378_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_000699783.1|2787443_2787647_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_021543580.1|2787764_2788139_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
WP_023908876.1|2788177_2788621_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
WP_021543581.1|2788617_2789094_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
WP_024946499.1|2789097_2789433_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
WP_001181554.1|2789562_2789766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908878.1|2789958_2790711_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
WP_024946498.1|2790724_2791714_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_023908880.1|2791721_2792531_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
WP_000767133.1|2792550_2792940_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210154.1|2792936_2793263_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001401088.1|2793259_2793913_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_023908881.1|2793912_2794401_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
WP_023908882.1|2794397_2795339_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.2e-139
WP_071789194.1|2795328_2795508_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_024946496.1|2795683_2796241_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_021527487.1|2796284_2796485_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.3e-31
WP_021530636.1|2796575_2797250_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
WP_000135680.1|2797917_2798280_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023908886.1|2798345_2799170_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_024946495.1|2799388_2800141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093916.1|2800177_2800459_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_023908888.1|2800506_2800680_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	1.4e-21
>prophage 200
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2806029	2806638	5262974		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2806029_2806638_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 201
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2815852	2816968	5262974		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2815852_2816968_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 202
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2829925	2863163	5262974	plate,tail,transposase	Burkholderia_phage(27.27%)	35	NA	NA
WP_000619864.1|2829925_2830273_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|2830810_2831098_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|2831100_2831706_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|2831718_2832033_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|2832177_2832633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|2832629_2832827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|2832816_2834241_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|2834240_2834765_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|2834815_2835133_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|2835092_2835221_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000608644.1|2836468_2837731_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|2837986_2838862_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|2838908_2839241_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|2841562_2842267_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|2843460_2844003_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|2844015_2844876_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_001067855.1|2844982_2845687_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|2846318_2847149_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|2847279_2847834_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|2847977_2848682_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|2850303_2850546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|2850577_2851228_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|2851333_2852533_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_078207943.1|2852564_2853002_-	EamA family transporter	NA	NA	NA	NA	NA
WP_078207945.1|2854414_2855368_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.0	2.8e-34
WP_001269711.1|2855367_2855577_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|2855564_2856605_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_000679403.1|2856614_2857316_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|2857414_2857774_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|2857764_2858880_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|2858872_2859589_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|2859591_2861202_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|2861198_2861906_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|2861902_2862358_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|2862371_2863163_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 203
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2875588	2879272	5262974		Dickeya_phage(100.0%)	1	NA	NA
WP_001572176.1|2875588_2879272_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 204
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2892607	2894197	5262974		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_022646398.1|2892607_2894197_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	5.8e-69
>prophage 205
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2899565	2901329	5262974		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2899565_2899838_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2900024_2900615_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|2900657_2901329_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 206
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2909625	2917954	5262974		Vibrio_phage(50.0%)	2	NA	NA
WP_000653953.1|2909625_2913849_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.4	2.5e-66
WP_000263098.1|2913925_2917954_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 207
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2921949	2925002	5262974		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2921949_2923134_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2924051_2925002_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 208
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2933342	2935187	5262974		Acinetobacter_phage(100.0%)	1	NA	NA
WP_016235454.1|2933342_2935187_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 209
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2941661	2942876	5262974		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690928.1|2941661_2942876_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	1.7e-44
>prophage 210
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2954931	2962178	5262974		Serratia_phage(33.33%)	5	NA	NA
WP_022646386.1|2954931_2957229_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2957279_2957600_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2957614_2958694_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_022646385.1|2959002_2961504_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_022646384.1|2961515_2962178_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
>prophage 211
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2969046	2970600	5262974		Pandoravirus(100.0%)	1	NA	NA
WP_000694759.1|2969046_2970600_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	2.3e-09
>prophage 212
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2979767	2983961	5262974		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_078207946.1|2979767_2983961_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.2	2.8e-22
>prophage 213
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	2989598	2994101	5262974		Erwinia_phage(50.0%)	5	NA	NA
WP_001293344.1|2989598_2990930_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|2990996_2991923_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2992015_2992501_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2992585_2992831_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2993255_2994101_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 214
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3005675	3010535	5262974		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|3005675_3006374_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|3006370_3007744_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270277.1|3007848_3008523_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_023908897.1|3008671_3009655_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_022646375.1|3009914_3010535_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	6.4e-64
>prophage 215
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3026958	3030009	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_077248327.1|3026958_3030009_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 216
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3038306	3041086	5262974		Escherichia_phage(50.0%)	3	NA	NA
WP_000059679.1|3038306_3039092_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621622.1|3039125_3040022_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_022646365.1|3040189_3041086_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 217
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3060518	3062989	5262974		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|3060518_3061568_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_022646353.1|3061579_3062989_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 218
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3067106	3069893	5262974		uncultured_virus(100.0%)	1	NA	NA
WP_022646352.1|3067106_3069893_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 219
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3083583	3084198	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3083583_3084198_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 220
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3092987	3096274	5262974		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3092987_3093764_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|3093766_3094282_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3094285_3094555_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187543.1|3094633_3096274_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 221
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3122144	3125555	5262974	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_000133649.1|3122144_3123005_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
WP_000928837.1|3123041_3123662_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_024179510.1|3123725_3125555_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
>prophage 222
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3135307	3139166	5262974		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|3135307_3137470_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|3137553_3138270_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|3138269_3139166_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 223
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3150058	3151714	5262974		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|3150058_3151714_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 224
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3159788	3165932	5262974		Enterobacteria_phage(40.0%)	6	NA	NA
WP_022646328.1|3159788_3160919_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_022646327.1|3160923_3161598_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676059.1|3161575_3162457_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	4.3e-106
WP_023908854.1|3162475_3163543_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_022646325.1|3163542_3164805_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_022646324.1|3164801_3165932_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
>prophage 225
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3169962	3175375	5262974		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3169962_3170292_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047508.1|3170422_3171688_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_021516604.1|3171822_3173307_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238890.1|3173353_3175375_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 226
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3182971	3184618	5262974		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_022646321.1|3182971_3184618_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.6e-66
>prophage 227
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3198006	3203859	5262974		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|3198006_3198897_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_022646318.1|3198921_3199887_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|3199891_3201397_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|3201404_3201824_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102295.1|3201990_3203859_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.0e-64
>prophage 228
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3207027	3208020	5262974		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|3207027_3208020_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 229
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3219970	3223332	5262974		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933723.1|3219970_3221341_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
WP_000334081.1|3221502_3223332_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	3.3e-132
>prophage 230
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3228866	3232706	5262974		Cyanophage(50.0%)	4	NA	NA
WP_000867149.1|3228866_3229907_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.1	8.0e-51
WP_000741620.1|3229992_3230952_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_022646313.1|3230951_3231842_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3231932_3232706_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 231
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3241695	3243033	5262974		Moraxella_phage(100.0%)	1	NA	NA
WP_001312207.1|3241695_3243033_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	4.5e-62
>prophage 232
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3253234	3260603	5262974		Staphylococcus_phage(33.33%)	7	NA	NA
WP_001307474.1|3253234_3253492_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3253455_3253815_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3253831_3253972_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000059111.1|3254578_3255982_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|3255986_3257087_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|3257086_3258160_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072061.1|3258188_3260603_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	8.2e-115
>prophage 233
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3265211	3266360	5262974		Oenococcus_phage(100.0%)	1	NA	NA
WP_022646304.1|3265211_3266360_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.6	1.0e-51
>prophage 234
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3270787	3271741	5262974		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3270787_3271201_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3271312_3271741_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 235
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3278601	3287078	5262974		Aeromonas_phage(25.0%)	9	NA	NA
WP_001087115.1|3278601_3280317_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
WP_022646299.1|3280313_3281807_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.3	3.3e-29
WP_000703959.1|3281866_3282214_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3282203_3282566_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148045.1|3282562_3283060_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001306726.1|3283067_3284252_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_022646298.1|3284531_3284621_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|3285185_3285284_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_022646297.1|3285389_3287078_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.9	3.2e-57
>prophage 236
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3297734	3299069	5262974		Moraxella_phage(100.0%)	1	NA	NA
WP_001525914.1|3297734_3299069_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 237
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3337243	3338635	5262974		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3337243_3338635_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 238
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3342936	3358888	5262974		Bordetella_phage(11.11%)	18	NA	NA
WP_000280473.1|3342936_3345045_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3345063_3345339_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3345393_3346017_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_022646279.1|3346274_3347957_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	7.4e-22
WP_000924289.1|3347953_3348571_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001445348.1|3348861_3349686_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
WP_022646278.1|3349906_3350770_-	YicC family protein	NA	NA	NA	NA	NA
WP_001247093.1|3350896_3351613_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_000806177.1|3351678_3352320_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022646277.1|3352617_3353577_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	28.0	2.2e-10
WP_000818603.1|3353622_3354219_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_000976070.1|3354325_3354784_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050149.1|3354761_3355982_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_001297375.1|3356153_3356822_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|3357038_3357275_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3357295_3357463_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3357560_3358370_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3358408_3358888_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 239
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3366326	3367355	5262974		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_022646274.1|3366326_3367355_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 240
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3371514	3381021	5262974		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|3371514_3372447_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|3372660_3373857_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_022646271.1|3373866_3374892_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982122.1|3375130_3376165_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_022646270.1|3376151_3377111_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214150.1|3377114_3378398_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_022646269.1|3378407_3379952_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156174.1|3380196_3380628_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|3380769_3381021_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 241
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3407044	3422065	5262974	tRNA	Acinetobacter_phage(33.33%)	10	NA	NA
WP_022646258.1|3407044_3411280_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.0	1.3e-22
WP_000779783.1|3411508_3412117_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_022646257.1|3412214_3413606_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_022646256.1|3413602_3415447_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.9	1.5e-15
WP_000741500.1|3415637_3416789_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985736.1|3416918_3418214_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
WP_000183976.1|3418321_3419860_+	aldehyde dehydrogenase AldB	NA	NA	NA	NA	NA
WP_000061477.1|3419900_3420980_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	40.7	2.1e-62
WP_000833473.1|3421452_3421638_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
WP_022646255.1|3421654_3422065_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	4.9e-20
>prophage 242
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3443478	3445020	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_022646249.1|3443478_3445020_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.9e-16
>prophage 243
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3450338	3451334	5262974		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_022646246.1|3450338_3451334_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.2	7.0e-12
>prophage 244
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3455200	3457225	5262974	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_089560522.1|3455200_3456569_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001135731.1|3456671_3456824_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|3457012_3457225_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 245
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3460879	3463213	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_022646244.1|3460879_3463213_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.6	1.4e-71
>prophage 246
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3468821	3470169	5262974	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_101687376.1|3468821_3470169_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.0	3.0e-74
>prophage 247
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3474537	3476522	5262974		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196481.1|3474537_3475521_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107033.1|3475517_3476522_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	1.5e-17
>prophage 248
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3525541	3527011	5262974		Bacillus_virus(50.0%)	2	NA	NA
WP_001696281.1|3525541_3526189_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	1.0e-16
WP_000622315.1|3526240_3527011_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
>prophage 249
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3540000	3542136	5262974		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065801.1|3540000_3540426_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	2.8e-50
WP_023909162.1|3540438_3541728_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	4.6e-173
WP_000008961.1|3541782_3542136_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.7e-24
>prophage 250
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3545480	3547523	5262974		Indivirus(100.0%)	1	NA	NA
WP_022646231.1|3545480_3547523_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.2e-45
>prophage 251
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3560933	3566829	5262974		Staphylococcus_phage(50.0%)	5	NA	NA
WP_022646228.1|3560933_3563669_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|3563668_3564793_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|3565137_3565497_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3565616_3566018_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173690.1|3566022_3566829_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
>prophage 252
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3574722	3584670	5262974		Dickeya_phage(33.33%)	11	NA	NA
WP_001100467.1|3574722_3575388_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|3575608_3575854_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_022646226.1|3575955_3578154_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	5.0e-119
WP_000964718.1|3578227_3578854_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000042886.1|3578994_3579354_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001295207.1|3579356_3579626_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000743195.1|3579615_3580212_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_022646225.1|3580361_3581849_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617723.1|3581851_3582520_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|3582512_3583571_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3583815_3584670_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 253
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3590393	3591876	5262974		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|3590393_3591161_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|3591162_3591876_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 254
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3595418	3597229	5262974		Planktothrix_phage(50.0%)	2	NA	NA
WP_001572020.1|3595418_3596489_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073570.1|3596485_3597229_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	2.2e-10
>prophage 255
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3605627	3607724	5262974		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_022646221.1|3605627_3607724_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 256
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3618053	3620501	5262974		Dickeya_phage(100.0%)	1	NA	NA
WP_000993450.1|3618053_3620501_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 257
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3629408	3630647	5262974		Ralstonia_phage(100.0%)	1	NA	NA
WP_078207950.1|3629408_3630647_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.1	1.3e-124
>prophage 258
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3635802	3638196	5262974		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_022646213.1|3635802_3638196_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 259
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3644165	3645044	5262974		Sodalis_phage(100.0%)	1	NA	NA
WP_001603941.1|3644165_3645044_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 260
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3651607	3656117	5262974		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|3651607_3652327_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253708.1|3652323_3653676_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|3653707_3654004_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|3654062_3654380_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001309803.1|3654494_3656117_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
>prophage 261
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3673095	3673932	5262974		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3673095_3673932_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 262
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3692839	3702379	5262974		Acinetobacter_phage(25.0%)	9	NA	NA
WP_022646193.1|3692839_3693403_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.9e-61
WP_016233602.1|3693488_3694712_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_022646192.1|3694774_3696865_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000242755.1|3696915_3697548_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3697849_3698254_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3698308_3699178_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3699231_3699450_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_022646191.1|3699443_3700466_-	hydrolase	NA	NA	NA	NA	NA
WP_000634789.1|3700465_3702379_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 263
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3707950	3713524	5262974		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209685.1|3707950_3708337_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
WP_000820714.1|3708336_3708696_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903385.1|3708703_3708991_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3709116_3709491_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3709587_3710058_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3710154_3712269_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3712339_3713524_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 264
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3733401	3734873	5262974	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_022646187.1|3733401_3734349_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.9e-06
WP_000114986.1|3734363_3734873_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 265
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3745208	3749362	5262974		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|3745208_3745967_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001298587.1|3745974_3747078_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_022646185.1|3747087_3748269_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3748336_3749362_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 266
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3762088	3766601	5262974		Escherichia_phage(50.0%)	4	NA	NA
WP_000843961.1|3762088_3762919_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275531.1|3763260_3764115_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001361192.1|3764150_3765041_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_022646174.1|3765101_3766601_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.3	4.7e-12
>prophage 267
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3776643	3777687	5262974		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3776643_3777687_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 268
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3795622	3798147	5262974	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3795622_3796690_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3796779_3798147_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 269
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3802112	3802610	5262974	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|3802112_3802610_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 270
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3806315	3811048	5262974		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108473.1|3806315_3807806_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000054239.1|3807853_3808543_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_022646170.1|3808539_3809415_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979880.1|3809411_3809876_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_022646169.1|3809935_3811048_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	3.9e-72
>prophage 271
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3817796	3832590	5262974		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001296449.1|3817796_3818726_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3818821_3821158_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001302019.1|3821387_3822041_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047098.1|3822037_3822766_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620399.1|3822762_3823395_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3823607_3823880_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3823876_3824731_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|3824776_3825268_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3825385_3825673_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3825695_3827129_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3827176_3827902_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3827908_3828466_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3828434_3829010_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|3829006_3829573_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|3829593_3830580_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_022646167.1|3830593_3831571_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|3831780_3832590_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 272
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3836658	3838137	5262974		Vibrio_phage(50.0%)	2	NA	NA
WP_000445407.1|3836658_3836937_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
WP_001047336.1|3837165_3838137_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 273
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3844766	3847639	5262974	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3844766_3846701_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3846790_3847639_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 274
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3851719	3858358	5262974		Dickeya_phage(50.0%)	4	NA	NA
WP_001603852.1|3851719_3853063_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3853693_3854146_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|3854173_3855661_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3855685_3858358_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 275
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3863839	3865729	5262974		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3863839_3865729_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 276
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3871432	3879237	5262974		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189325.1|3871432_3871735_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449464.1|3871785_3872229_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037592.1|3872208_3872727_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_022646164.1|3872854_3873490_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147632.1|3873562_3874603_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|3874724_3875300_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|3875309_3875900_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246844.1|3875919_3876315_-	YraN family protein	NA	NA	NA	NA	NA
WP_022646163.1|3876272_3878309_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809263.1|3878373_3879237_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 277
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3897635	3898781	5262974		Streptococcus_phage(100.0%)	1	NA	NA
WP_001330125.1|3897635_3898781_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 278
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3906480	3908775	5262974		Tetraselmis_virus(100.0%)	1	NA	NA
WP_022646155.1|3906480_3908775_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.6e-158
>prophage 279
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3934615	3935581	5262974		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|3934615_3935581_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 280
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3948235	3964373	5262974	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_022646146.1|3948235_3951328_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
WP_000212433.1|3951511_3952495_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|3952713_3953046_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_032140334.1|3953087_3954467_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.0e-32
WP_000094726.1|3954884_3956405_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_021581059.1|3956500_3957124_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_022646145.1|3957411_3958176_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|3958429_3958936_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3959014_3960856_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|3961050_3962796_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|3962906_3963122_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264377.1|3963359_3964373_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 281
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3970674	3971913	5262974	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708482.1|3970674_3971913_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 282
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3977050	3978484	5262974		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_022646141.1|3977050_3978484_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	3.6e-41
>prophage 283
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3982396	3983050	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076993.1|3982396_3983050_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 284
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	3988935	4001381	5262974		Ralstonia_phage(16.67%)	11	NA	NA
WP_000442860.1|3988935_3990096_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3990101_3990773_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|3990920_3992402_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|3992606_3993236_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|3993236_3993659_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3993683_3994511_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|3994510_3995092_+	esterase YqiA	NA	NA	NA	NA	NA
WP_022646138.1|3995120_3997013_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	5.8e-92
WP_001051711.1|3997076_3999218_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_078207952.1|3999591_4000401_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	7.9e-14
WP_000986427.1|4000397_4001381_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
>prophage 285
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4008132	4013172	5262974		Stx_converting_phage(50.0%)	4	NA	NA
WP_000712658.1|4008132_4008525_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183492.1|4008577_4009060_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_022646134.1|4009168_4010776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022646133.1|4010913_4013172_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	7.0e-84
>prophage 286
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4020629	4025645	5262974		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_022646128.1|4020629_4022102_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.3	3.1e-48
WP_000438653.1|4022424_4023174_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001559954.1|4023425_4025645_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
>prophage 287
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4028685	4029513	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_022646124.1|4028685_4029513_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.5	1.4e-61
>prophage 288
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4035356	4036241	5262974		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|4035356_4036241_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 289
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4046267	4047615	5262974	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_101687376.1|4046267_4047615_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.0	3.0e-74
>prophage 290
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4095901	4102226	5262974		Catovirus(50.0%)	4	NA	NA
WP_021513235.1|4095901_4096891_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	32.3	5.5e-33
WP_032141272.1|4096930_4098076_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.2	1.9e-29
WP_019842680.1|4098158_4099412_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	27.4	6.5e-31
WP_032221635.1|4099463_4102226_+	glycosyltransferase	NA	A0A0N9QZQ5	Chrysochromulina_ericina_virus	31.6	4.9e-79
>prophage 291
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4111325	4112309	5262974		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001361242.1|4111325_4112309_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	2.4e-36
>prophage 292
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4115975	4118317	5262974		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|4115975_4116197_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_021553055.1|4116261_4116738_-	RadC family protein	NA	NA	NA	NA	NA
WP_001564060.1|4116753_4117233_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	8.9e-13
WP_001175165.1|4117498_4118317_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
>prophage 293
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4138326	4141908	5262974		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001001003.1|4138326_4139478_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
WP_001564046.1|4139606_4140662_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000792585.1|4140678_4141908_-	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
>prophage 294
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4148766	4149342	5262974		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|4148766_4149342_-	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 295
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4162191	4165684	5262974	transposase	Shigella_phage(100.0%)	3	NA	NA
WP_085949836.1|4162191_4163405_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_077877385.1|4163398_4163683_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000747051.1|4165333_4165684_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
>prophage 296
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4178540	4179806	5262974	integrase	Enterobacteria_phage(100.0%)	1	4177792:4177806	4186384:4186398
4177792:4177806	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_078207956.1|4178540_4179806_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_078207956.1|4178540_4179806_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
4186384:4186398	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 297
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4205668	4206823	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4205668_4206823_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 298
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4214647	4215556	5262974		Yersinia_phage(100.0%)	1	NA	NA
WP_000646940.1|4214647_4215556_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 299
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4240451	4241684	5262974		Catovirus(100.0%)	1	NA	NA
WP_001151611.1|4240451_4241684_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	1.6e-103
>prophage 300
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4249821	4254292	5262974		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_022646091.1|4249821_4252695_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
WP_022646090.1|4252858_4254292_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
>prophage 301
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4258107	4264194	5262974	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
WP_000806638.1|4258107_4259004_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715222.1|4259028_4259739_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813233.1|4259744_4261478_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.9e-60
WP_001701073.1|4261568_4262666_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|4262676_4264194_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
>prophage 302
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4269351	4273489	5262974		Moraxella_phage(50.0%)	3	NA	NA
WP_000012163.1|4269351_4270719_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001299798.1|4270754_4272071_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001562033.1|4272088_4273489_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	45.2	3.7e-19
>prophage 303
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4297770	4298523	5262974		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|4297770_4298523_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 304
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4330347	4332842	5262974		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|4330347_4331109_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|4331423_4332842_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 305
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4342473	4349246	5262974		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4342473_4343187_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_022646063.1|4343255_4343945_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_022646062.1|4344629_4345160_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957936.1|4345172_4347419_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4347569_4348445_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4348451_4349246_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 306
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4354723	4375622	5262974	tRNA	Klosneuvirus(11.11%)	14	NA	NA
WP_022646058.1|4354723_4357612_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001571833.1|4357604_4361147_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_022646057.1|4361146_4362973_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.4	2.3e-24
WP_001765039.1|4363054_4364386_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4364617_4365871_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_022646056.1|4366129_4366954_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810565.1|4366985_4368566_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000382419.1|4368565_4369741_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066236.1|4369743_4370340_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_001361319.1|4370411_4371359_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
WP_000678646.1|4371942_4373040_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117737.1|4373116_4373923_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.3e-16
WP_000184260.1|4373973_4374417_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_022646055.1|4374416_4375622_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	3.5e-74
>prophage 307
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4387198	4387954	5262974		Bacillus_phage(100.0%)	1	NA	NA
WP_024179465.1|4387198_4387954_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 308
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4392811	4393660	5262974		Vibrio_phage(100.0%)	1	NA	NA
WP_000100410.1|4392811_4393660_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 309
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4401193	4405308	5262974		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|4401193_4403950_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046818.1|4404006_4405308_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
>prophage 310
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4409341	4414261	5262974		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|4409341_4410979_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4411065_4412364_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_022646048.1|4412423_4413296_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199973.1|4413589_4414261_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 311
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4419589	4420375	5262974		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021342.1|4419589_4420375_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 312
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4444500	4446533	5262974		Hokovirus(50.0%)	2	NA	NA
WP_022646032.1|4444500_4445928_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4445927_4446533_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 313
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4449645	4459668	5262974		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_001295182.1|4449645_4450407_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4450400_4451027_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_022646030.1|4451166_4452306_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4452368_4453361_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208067.1|4453481_4453889_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000863202.1|4454629_4456057_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562980.1|4456067_4456304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646027.1|4456344_4457001_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	4.3e-50
WP_022646026.1|4457106_4459668_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 314
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4478536	4479547	5262974		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015912547.1|4478536_4479547_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 315
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4486961	4487927	5262974		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|4486961_4487927_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 316
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4493395	4498782	5262974	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4493395_4493893_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4493972_4495034_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_022646015.1|4495102_4495603_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_023908991.1|4495731_4498362_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4498596_4498782_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 317
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4511461	4516758	5262974		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|4511461_4512664_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777955.1|4513019_4513979_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.1	3.1e-134
WP_022646011.1|4513988_4516133_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	8.4e-196
WP_000080958.1|4516105_4516516_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|4516512_4516758_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 318
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4522564	4526615	5262974		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|4522564_4523014_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|4523014_4523677_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_022646009.1|4523697_4525098_-	GABA permease	NA	NA	NA	NA	NA
WP_022646008.1|4525334_4526615_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
>prophage 319
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4536110	4536377	5262974		Salmonella_phage(100.0%)	1	NA	NA
WP_012602462.1|4536110_4536377_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	67.9	1.2e-11
>prophage 320
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4542021	4542504	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4542021_4542504_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 321
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4556137	4557208	5262974		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|4556137_4557208_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 322
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4564554	4567128	5262974		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4564554_4567128_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 323
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4572906	4574205	5262974		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4572906_4574205_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 324
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4579498	4585580	5262974	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4579498_4579918_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|4580124_4581162_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|4581209_4581899_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|4582203_4582587_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_022645996.1|4582641_4583229_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001571777.1|4583331_4584213_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4584245_4585580_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 325
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4591351	4595094	5262974		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4591351_4593151_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002529.1|4593166_4594141_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4594413_4595094_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 326
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4598554	4598815	5262974		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|4598554_4598815_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 327
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4602935	4614224	5262974		Bacillus_phage(50.0%)	7	NA	NA
WP_022645992.1|4602935_4606823_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
WP_001297612.1|4607379_4608807_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_022645991.1|4608971_4609685_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|4609674_4611009_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4611069_4611408_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883115.1|4611452_4612643_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|4612970_4614224_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 328
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4619982	4621494	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493463.1|4619982_4621494_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	9.0e-11
>prophage 329
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4636631	4642969	5262974		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4636631_4637846_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4637873_4638260_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4638276_4638600_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4638695_4639211_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196609.1|4639227_4641078_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.7	1.8e-101
WP_001124471.1|4641079_4641415_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4641426_4641627_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_022645983.1|4641685_4642969_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 330
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4653534	4653966	5262974		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|4653534_4653966_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 331
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4674459	4721558	5262974	terminase,holin,integrase,tail	Escherichia_phage(58.33%)	57	4679087:4679103	4719704:4719720
WP_000937904.1|4674459_4675827_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
WP_001299507.1|4675988_4677455_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|4677523_4679101_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4679087:4679103	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_024946512.1|4679293_4680544_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.0e-238
WP_001077944.1|4680547_4680742_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
WP_000163456.1|4680738_4681389_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
WP_001335975.1|4681381_4681633_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|4681790_4682039_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063834.1|4682088_4683030_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
WP_000802268.1|4683026_4683848_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
WP_001102254.1|4683844_4684144_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
WP_001198620.1|4684146_4684299_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_000836290.1|4684452_4685037_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|4685191_4685422_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402896.1|4685572_4685773_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_000086414.1|4685788_4686604_+	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_001066741.1|4686600_4687386_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_021558026.1|4687503_4687851_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
WP_024946514.1|4687912_4688392_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
WP_024946515.1|4688388_4688934_+	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
WP_001593200.1|4688930_4689230_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_024946516.1|4689231_4689996_+	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
WP_024946517.1|4690509_4691439_+	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
WP_024946519.1|4691931_4692606_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_024946520.1|4692602_4694072_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.4	1.2e-289
WP_024946521.1|4694076_4694682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335899.1|4695443_4695650_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_024946522.1|4695664_4697344_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
WP_000133160.1|4697340_4697637_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001048075.1|4697639_4698335_+	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_024946523.1|4698349_4699336_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
WP_024946524.1|4699387_4699825_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
WP_000012377.1|4699835_4700171_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000179260.1|4700227_4700833_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_001018550.1|4700832_4703304_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000228790.1|4703303_4703768_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
WP_000332877.1|4703767_4704343_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_024946525.1|4704342_4707090_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	1.2e-117
WP_032152018.1|4707089_4710479_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_000723561.1|4710480_4711332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|4711361_4711523_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001154803.1|4711616_4712165_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_001609225.1|4712091_4712418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152017.1|4712539_4713232_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	1.7e-97
WP_110221350.1|4713277_4713364_-	ash family protein	NA	NA	NA	NA	NA
WP_001164248.1|4713675_4714095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946528.1|4714084_4714591_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001188253.1|4714614_4714872_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
WP_024946530.1|4717276_4717573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001275999.1|4717795_4718200_+	membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
WP_001546697.1|4718186_4718495_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_024946531.1|4718484_4719114_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.8e-114
WP_032152016.1|4719110_4719593_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	90.0	3.2e-71
WP_022645975.1|4719812_4720352_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
4719704:4719720	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_001295476.1|4720367_4720886_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|4721196_4721388_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|4721405_4721558_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 332
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4727805	4731806	5262974		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_022645973.1|4727805_4728444_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
WP_001295474.1|4728443_4729481_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4729804_4730431_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|4730516_4731806_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 333
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4753073	4756768	5262974		Synechococcus_phage(50.0%)	2	NA	NA
WP_001295467.1|4753073_4753787_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001091724.1|4755100_4756768_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.1	6.2e-162
>prophage 334
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4773397	4774348	5262974		Cyanophage(100.0%)	1	NA	NA
WP_022645961.1|4773397_4774348_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 335
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4795009	4799944	5262974		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102892.1|4795009_4795879_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|4796092_4796518_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001296281.1|4796504_4796954_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838948.1|4797014_4797590_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|4797685_4798585_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_022645952.1|4798642_4799944_-	penicillin binding protein PBP4B	NA	R4JG75	Mycobacterium_phage	23.1	2.5e-09
>prophage 336
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4803422	4818792	5262974		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517443.1|4803422_4804214_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290224.1|4804371_4805388_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_022645951.1|4805387_4806221_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_022645950.1|4806220_4807096_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_022645949.1|4807085_4808183_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_022645948.1|4808316_4809228_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	5.0e-57
WP_000719965.1|4809230_4809599_-	YfeK family protein	NA	NA	NA	NA	NA
WP_022645947.1|4809703_4810555_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4810597_4811107_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4811147_4812875_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4812919_4813177_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4813560_4814532_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|4814716_4815478_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001317975.1|4815707_4816706_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443685.1|4816776_4818792_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
>prophage 337
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4844331	4845066	5262974		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4844331_4845066_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 338
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4848884	4849805	5262974		Morganella_phage(100.0%)	1	NA	NA
WP_000484411.1|4848884_4849805_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 339
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4853495	4861071	5262974		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283510.1|4853495_4855190_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|4855258_4856203_+	transporter YfdV	NA	NA	NA	NA	NA
WP_022645940.1|4856276_4857422_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_022645939.1|4857477_4861071_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 340
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4868999	4869932	5262974		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4868999_4869932_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 341
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4886752	4890966	5262974		Burkholderia_phage(50.0%)	4	NA	NA
WP_022645928.1|4886752_4888111_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	31.4	2.1e-06
WP_022645927.1|4888196_4888748_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001306448.1|4888913_4889846_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|4889880_4890966_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 342
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4899404	4900541	5262974		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_022645924.1|4899404_4900541_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	1.0e-22
>prophage 343
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4906982	4908500	5262974		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|4906982_4908500_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 344
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4912711	4914572	5262974		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|4912711_4913485_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_022645922.1|4913681_4914572_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	6.8e-67
>prophage 345
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4925132	4928360	5262974		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203399.1|4925132_4925783_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012889.1|4925869_4927702_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813851.1|4927760_4928360_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 346
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4964696	4969700	5262974		Tupanvirus(50.0%)	4	NA	NA
WP_022645909.1|4964696_4966679_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
WP_000461641.1|4966678_4967647_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	5.2e-36
WP_023908921.1|4967650_4968790_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.6	1.9e-29
WP_022645908.1|4969097_4969700_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 347
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4973302	4977849	5262974	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001361551.1|4973302_4974508_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
WP_012311861.1|4974564_4975854_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992957.1|4975871_4976675_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150339.1|4976715_4976901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140579.1|4976913_4977849_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.5e-69
>prophage 348
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4983741	4984818	5262974		Staphylococcus_phage(100.0%)	1	NA	NA
WP_022645904.1|4983741_4984818_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 349
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	4987863	4999770	5262974		Pseudomonas_phage(40.0%)	6	NA	NA
WP_000135040.1|4987863_4988118_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4988117_4989248_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_022645903.1|4989393_4991679_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	1.3e-282
WP_022645902.1|4992374_4996133_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.6	7.2e-25
WP_000990764.1|4996273_4996996_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001773998.1|4997142_4999770_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 350
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5014693	5019536	5262974		Bacillus_phage(50.0%)	2	NA	NA
WP_001361611.1|5014693_5016520_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	7.5e-20
WP_022645896.1|5016686_5019536_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	8.4e-42
>prophage 351
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5023699	5029468	5262974		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865538.1|5023699_5024794_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	8.8e-117
WP_022645894.1|5024905_5025961_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786378.1|5026034_5027099_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_022645893.1|5027098_5027749_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000422211.1|5027824_5029468_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 352
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5038236	5038854	5262974		Bacillus_virus(100.0%)	1	NA	NA
WP_022645890.1|5038236_5038854_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	26.1	5.1e-13
>prophage 353
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5050552	5058201	5262974		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|5050552_5051560_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|5051698_5051983_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_022645888.1|5052107_5053868_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|5054017_5054713_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|5054740_5055931_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|5056263_5056608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645887.1|5056611_5058201_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	2.5e-19
>prophage 354
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5063955	5068256	5262974		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|5063955_5064522_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|5064933_5065647_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|5065685_5066672_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001091913.1|5066789_5068256_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	4.3e-42
>prophage 355
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5082751	5083609	5262974		Hokovirus(100.0%)	1	NA	NA
WP_000873886.1|5082751_5083609_-	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	34.8	6.2e-25
>prophage 356
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5087677	5091462	5262974		Acinetobacter_phage(50.0%)	3	NA	NA
WP_022645882.1|5087677_5089669_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
WP_022645881.1|5089699_5090536_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|5090793_5091462_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 357
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5095156	5096677	5262974		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|5095156_5096677_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 358
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5116937	5126379	5262974		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|5116937_5117864_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|5117868_5118600_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|5118580_5118688_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|5118747_5119479_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|5119700_5121386_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|5121382_5122102_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|5122148_5122619_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|5122659_5123121_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|5123245_5125246_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|5125242_5126379_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 359
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5138289	5140323	5262974	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001571626.1|5138289_5140323_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 360
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5150949	5154506	5262974		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001361580.1|5150949_5151768_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_000434040.1|5151819_5152566_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645859.1|5152539_5153505_-	kinase	NA	NA	NA	NA	NA
WP_022645858.1|5153501_5154506_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
>prophage 361
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5163646	5170509	5262974	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_022645854.1|5163646_5164546_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001303579.1|5164960_5165278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476012.1|5165607_5166969_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_022645853.1|5167071_5167368_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001305156.1|5167369_5167666_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|5167874_5168207_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|5168386_5169109_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675163.1|5169105_5170509_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 362
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5183624	5184977	5262974		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_022645847.1|5183624_5184977_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	2.1e-06
>prophage 363
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5189640	5202038	5262974	transposase	Catovirus(16.67%)	12	NA	NA
WP_001295424.1|5189640_5190282_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|5190373_5190955_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_022645844.1|5190976_5192830_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_022645843.1|5192882_5193173_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.4	1.2e-09
WP_022645842.1|5193162_5193384_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000868863.1|5193818_5194844_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001361575.1|5195107_5196691_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|5196891_5197041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|5197349_5198489_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|5198494_5198938_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_022645841.1|5198940_5201103_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000654503.1|5201198_5202038_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 364
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5206282	5212984	5262974		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|5206282_5207404_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043606.1|5207406_5208372_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_012602261.1|5208374_5208854_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699679.1|5208850_5210074_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|5210076_5211513_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001328288.1|5211613_5212984_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
>prophage 365
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5218493	5227209	5262974		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001116131.1|5218493_5219888_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183060.1|5220062_5220956_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|5221328_5222414_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|5222413_5223313_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|5223370_5224249_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|5224253_5224802_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_001362820.1|5224833_5226072_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000735124.1|5226081_5227209_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 366
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5231483	5234304	5262974		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043460.1|5231483_5232890_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
WP_000704862.1|5233137_5234304_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
>prophage 367
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5241659	5242559	5262974		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|5241659_5242559_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 368
NZ_CP019029	Escherichia coli strain Ecol_881	5262974	5249732	5262234	5262974	protease,integrase	Enterobacteria_phage(56.52%)	23	5249008:5249021	5255002:5255015
5249008:5249021	attL	CATCGTGGGCGTTG	NA	NA	NA	NA
WP_039052524.1|5249732_5250911_+|integrase	site-specific integrase	integrase	K7P703	Enterobacteria_phage	98.7	5.8e-231
WP_000132739.1|5250891_5251083_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_039052525.1|5251113_5251281_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	2.2e-27
WP_020231265.1|5251381_5251666_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	97.9	1.0e-48
WP_078207963.1|5251665_5252493_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	48.4	1.5e-60
WP_078207964.1|5253006_5253627_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	96.6	2.6e-105
WP_078207965.1|5253613_5253868_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	94.0	1.2e-37
WP_078207966.1|5253864_5254032_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	1.5e-23
WP_078207967.1|5254042_5254339_-	DUF2856 family protein	NA	A0A2D1GLX2	Escherichia_phage	99.0	6.6e-51
WP_078207968.1|5254846_5255320_-	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	96.8	2.7e-62
5255002:5255015	attR	CAACGCCCACGATG	NA	NA	NA	NA
WP_058115767.1|5255320_5256028_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	8.5e-137
WP_001243355.1|5256282_5256435_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|5256419_5256551_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_078207969.1|5256575_5257544_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.2	8.5e-55
WP_000065355.1|5257578_5257947_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	100.0	1.2e-65
WP_021499330.1|5258244_5258541_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	99.0	4.3e-50
WP_000394302.1|5258580_5258832_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	9.5e-43
WP_072146718.1|5258840_5259203_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.0e-53
WP_110221373.1|5259589_5260285_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	5.8e-130
WP_000067728.1|5260360_5260576_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_000251072.1|5260695_5260989_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|5261011_5261284_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_078207970.1|5261346_5262234_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	3.1e-144
>prophage 1
NZ_CP019028	Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence	147346	46666	68767	147346	transposase,protease	Escherichia_phage(42.86%)	26	NA	NA
WP_000156883.1|46666_47689_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|48093_48351_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|48586_48661_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130948.1|48653_49511_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|50449_51103_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|51195_51453_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|51385_51787_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067834.1|53097_53802_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001389366.1|54704_55178_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|55308_56097_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|56302_56650_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|56643_57483_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|57610_57814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|57969_59175_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|59185_59491_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|59717_60482_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|60974_61559_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|61558_62797_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|62793_63708_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|63829_64534_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_013362819.1|64668_64764_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_013362818.1|64889_65627_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_170852050.1|65571_65742_+	rRNA adenine methyltransferase	NA	E4ZFP9	Streptococcus_phage	92.7	3.4e-20
WP_013362817.1|66256_66706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023909256.1|66666_67008_+	chaperonin	NA	NA	NA	NA	NA
WP_013362816.1|67234_68767_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019028	Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence	147346	93585	102863	147346	transposase	Escherichia_phage(62.5%)	9	NA	NA
WP_012372828.1|93585_94602_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|94829_95147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|95433_95793_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|95820_96000_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|96004_96385_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|96384_96606_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|96788_98345_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001553855.1|98341_99625_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
WP_001553854.1|99746_102863_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
>prophage 1
NZ_CP019027	Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence	109344	0	100037	109344	portal,terminase,tRNA,tail	Salmonella_phage(84.16%)	109	NA	NA
WP_078207903.1|0_1116_-	DNA primase	NA	J9Q720	Salmonella_phage	93.0	3.2e-207
WP_049076695.1|1264_2605_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	2.6e-235
WP_061158042.1|2648_3389_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	4.9e-127
WP_078207865.1|3569_5264_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.7	1.4e-12
WP_160378290.1|5315_5669_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161229.1|5674_6343_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.9	5.8e-111
WP_001717321.1|6519_7272_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	2.7e-16
WP_000931257.1|7256_7640_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_000901561.1|8012_8264_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_000856758.1|8265_8958_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_001717323.1|8971_9295_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_032328862.1|9617_10226_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.8	4.5e-78
WP_048959172.1|10225_10480_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	69.0	7.9e-29
WP_078207866.1|10570_12736_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	52.6	4.8e-66
WP_078207867.1|14190_18915_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.8	0.0e+00
WP_001293196.1|18932_19523_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.4	8.4e-106
WP_000526939.1|19510_20308_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_000511445.1|20300_20999_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|21081_21417_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_078207868.1|21459_26013_-	tape measure protein	NA	J9Q712	Salmonella_phage	84.6	0.0e+00
WP_000952686.1|26020_26245_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163861.1|26370_26688_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_048958837.1|26743_27490_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
WP_000469440.1|27564_27948_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|27949_28423_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|28413_28758_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_061158048.1|28837_29671_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
WP_061158049.1|29670_30105_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
WP_078207869.1|30149_31070_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.6	4.8e-132
WP_061158051.1|31143_32019_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	1.5e-154
WP_078207870.1|32044_32932_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.3	3.0e-131
WP_078207871.1|32953_34528_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	8.4e-286
WP_001007299.1|34554_35811_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|35810_36443_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|36639_36906_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|36915_37806_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_000049676.1|37802_38468_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|38464_39133_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_078207872.1|39132_39831_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.1	8.7e-110
WP_078207873.1|39895_41455_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	2.2e-278
WP_021520518.1|41457_41736_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	61.5	6.4e-24
WP_052967547.1|41910_42510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048958815.1|42506_43031_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_078207874.1|43326_43977_+	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	2.9e-99
WP_000255469.1|44025_44229_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_000497809.1|44249_44480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052904755.1|45096_45579_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.9e-61
WP_172424398.1|45929_46304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047659410.1|46421_46817_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_000749407.1|46943_47255_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_078207875.1|47408_47738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512335.1|49296_49482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021520099.1|49518_49818_-	hypothetical protein	NA	J9Q750	Salmonella_phage	46.7	1.0e-22
WP_078207876.1|49979_52013_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|52170_53271_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_048959303.1|53308_53698_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	92.2	1.9e-66
WP_032203392.1|54066_54591_-	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
WP_078207901.1|54604_55456_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.5e-23
WP_078207877.1|55669_56374_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	43.7	6.8e-46
WP_078207878.1|56373_56559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078207879.1|56555_57086_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	65.8	6.5e-33
WP_078207880.1|57082_57406_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	87.3	1.2e-42
WP_078207881.1|57402_57876_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	67.8	5.3e-42
WP_078207882.1|57872_58328_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	57.1	6.6e-18
WP_022644967.1|58327_58870_-	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	1.4e-86
WP_078207883.1|58866_59508_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.8	1.3e-99
WP_078207884.1|59627_60008_-	hypothetical protein	NA	J9Q801	Salmonella_phage	68.6	6.5e-27
WP_078207885.1|60007_60712_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	8.0e-87
WP_078207886.1|60773_62459_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_047579100.1|62600_63167_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	63.6	7.7e-56
WP_000893470.1|63306_63465_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900261.1|63464_63890_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_001103988.1|63983_64172_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_078207887.1|64181_64676_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	51.8	2.4e-29
WP_001404443.1|64824_65415_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_048959260.1|66000_66231_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	86.8	5.3e-32
WP_052904282.1|66418_67012_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.8e-98
WP_052904281.1|67194_68004_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	54.3	6.2e-67
WP_021520508.1|68162_68720_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	3.3e-88
WP_052904280.1|68729_69149_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	4.2e-51
WP_052924306.1|69210_69855_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	1.3e-96
WP_078207888.1|69854_70331_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.9	1.3e-80
WP_172801548.1|70327_70729_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	85.7	1.1e-61
WP_078207889.1|70742_71846_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.7	7.6e-193
WP_001011861.1|72017_72887_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_000122502.1|72964_74107_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_078207890.1|74212_76528_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|76601_77171_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_078207891.1|77180_77924_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	48.0	9.4e-54
WP_000670361.1|77913_79830_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.4	1.5e-249
WP_078207892.1|80059_81145_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.0	3.4e-185
WP_000364573.1|81399_82044_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_024180339.1|82245_83460_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.1e-75
WP_078207893.1|84039_84252_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	7.6e-33
WP_000644408.1|84251_84587_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_001265407.1|84802_85078_-	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_032203374.1|85133_85559_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	76.1	5.9e-61
WP_053904505.1|85621_86011_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	85.7	1.1e-58
WP_052904268.1|86031_86772_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	9.8e-27
WP_052904267.1|86817_87642_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	5.4e-18
WP_000715581.1|87737_88568_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_032203369.1|88571_88772_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_048959217.1|89940_90207_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	76.1	5.8e-30
WP_001755518.1|90206_91151_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_048959213.1|91211_92234_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	83.9	2.6e-139
WP_048959212.1|92351_92783_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.0	2.6e-64
WP_078207894.1|92898_96417_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.0	0.0e+00
WP_078207895.1|96597_97833_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	80.8	4.4e-197
WP_078207896.1|97928_100037_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	65.9	4.8e-228
>prophage 2
NZ_CP019027	Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence	109344	105817	109269	109344		Salmonella_phage(100.0%)	6	NA	NA
WP_078207899.1|105817_106108_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
WP_012640723.1|106253_106469_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	2.2e-19
WP_016607331.1|106452_106632_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	8.4e-17
WP_078207900.1|106628_107951_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	5.3e-241
WP_164875020.1|107947_108424_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	69.2	8.1e-51
WP_048959189.1|108486_109269_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.5	6.9e-55
