The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	405725	514724	4947532	plate,transposase,holin,tail,tRNA,portal,capsid,protease,integrase,head,terminase	Enterobacteria_phage(42.55%)	129	500322:500337	519643:519658
WP_000520781.1|405725_406046_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|406076_408353_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|409037_409256_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|409540_410245_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|410286_412008_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|412008_413775_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|413897_414863_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|415406_415901_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|416035_420142_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|420300_420912_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|420922_422266_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|422356_423649_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|423954_424095_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|424286_424547_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|424587_425697_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|425854_427039_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|427038_427551_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|427606_427981_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|427989_428145_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|428131_430939_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|430951_431440_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|431468_432068_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|432286_432844_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|432846_433380_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|433382_435368_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|435370_435901_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|435893_436790_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|436793_437144_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|437140_437722_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|437718_438354_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|438346_438814_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|438837_440715_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|440853_441249_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|441245_441638_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|441634_441958_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|441960_442161_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|442160_442655_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|442756_443557_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|443602_444655_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|444678_445515_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|445669_447421_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|447420_448467_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|448481_449006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|449729_450227_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|450266_451109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|451192_451507_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|451511_452471_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000599382.1|455375_455741_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|455737_456355_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|456366_456666_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|456662_456929_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|456925_457129_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|457152_457563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|457656_457770_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|457766_458009_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|458020_458299_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|458309_458660_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|458797_458989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|458995_459418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|459422_459944_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|460048_460390_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|460459_461452_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|461751_464196_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|464206_464824_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|464825_465689_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|465724_466351_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|466664_467813_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|467909_468650_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|468841_471124_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|471178_472036_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|472441_474202_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|474331_475024_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|475222_476311_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|476381_477665_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|477920_478493_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|478552_478993_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_023142129.1|479003_479465_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|479471_480086_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_000527461.1|480085_481417_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000138756.1|481419_481998_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|481990_483094_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|483084_483432_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|483486_484083_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|484079_485234_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|485221_485437_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|485433_486318_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|486317_489269_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|489344_489503_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|489426_489762_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|489859_490141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|490143_490665_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_078214980.1|490664_492092_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.1	6.6e-213
WP_012602372.1|492081_492336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|492332_492797_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|492796_493243_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|493244_493583_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|493592_494546_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|494560_495676_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|495890_496349_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|496351_497173_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|497153_498650_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|498649_500182_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|500241_500787_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
500322:500337	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|500786_501098_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|501097_501424_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|501420_502071_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|502054_502795_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|502797_503148_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|503278_504007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|503982_504387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|504385_504601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|504791_505556_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|505672_506029_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|506122_506311_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|506363_506672_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|506682_507603_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|507602_507920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078214981.1|507935_509705_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.2	2.6e-227
WP_000960679.1|509715_510882_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|510884_511154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|511181_511712_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|512000_512273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|512282_512579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|512593_512809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|512805_513489_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|513485_513716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|513705_513912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|513913_514363_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|514334_514724_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
519643:519658	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	726050	772922	4947532	transposase,holin,tail,tRNA,portal,capsid,integrase,head,terminase,lysis	Enterobacteria_phage(54.9%)	59	724368:724382	752962:752976
724368:724382	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|726050_727157_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|727210_727672_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|727681_728335_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|728506_729757_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|729870_731013_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|731002_731239_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|731378_731618_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|731601_731928_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|731927_732149_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|732247_732529_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|732539_732731_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|732703_732886_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|732882_733563_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|733559_734345_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|734350_734647_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|734722_734929_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|735524_736280_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|736318_736549_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|736618_737158_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|737244_738174_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|738170_738872_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_078214982.1|739121_743387_+	adhesin	NA	NA	NA	NA	NA
WP_000700202.1|743423_744467_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|744816_744918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|744914_745370_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|745369_745540_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|745532_745823_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|745819_746182_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|746178_746319_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|746315_747005_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|747326_747632_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|747618_748095_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|748311_748494_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|748584_748878_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|749358_749685_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|749891_750074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|750637_751183_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|751157_753083_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
752962:752976	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_078214983.1|753079_753286_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.9e-29
WP_001295977.1|753282_754884_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|754864_756184_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|756193_756526_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|756581_757607_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|757648_758047_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|758058_758412_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|758423_759002_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|758998_759394_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|759401_760142_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|760157_760580_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|760561_760996_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|760988_763550_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|763546_763876_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|763875_764574_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|764578_765322_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|765258_765861_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|765921_769404_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|769462_771484_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_078214984.1|771480_771747_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	54.5	5.8e-22
WP_085949154.1|771774_772922_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 3
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	913513	983228	4947532	transposase,holin,tail,portal,capsid,integrase,protease,head,terminase	Stx2-converting_phage(25.0%)	78	909687:909701	915597:915611
909687:909701	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|913513_914644_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|914621_914870_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|914934_917406_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
915597:915611	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|917498_917690_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|917686_917875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|918440_918659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|918818_918974_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|919246_919963_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|920012_920228_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|920224_920650_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|920672_921635_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|921641_922388_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|922409_923180_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|923195_923621_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|923795_924461_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|924641_924854_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|925021_925294_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|925295_926351_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|926351_926732_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|926728_927550_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|927776_927974_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|928125_929175_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|929976_930108_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|930388_930724_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|930984_932838_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|932988_933204_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|933208_933553_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|933518_933791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|933896_934430_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|934984_935071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|935292_935478_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|935563_935779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|935977_936178_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|936219_936585_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|936875_937439_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|937435_939097_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|939160_941098_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|941142_941364_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|941309_943895_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|943891_944218_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|944227_944578_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|944574_945021_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|945017_945362_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|945428_946145_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|946159_946534_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|946629_946839_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|946886_950129_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|950121_950463_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|950462_951161_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|951171_951915_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|951860_952493_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|952835_956309_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|956949_958491_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|958505_959252_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|959713_962620_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|962635_963163_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|963193_963727_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|963728_964514_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|964741_964924_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|965122_965791_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|965847_966117_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|966528_967086_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|967082_967358_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|967733_968540_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|968539_969733_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|969744_971103_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|971106_972702_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|972701_974264_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|974355_974400_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|974537_975419_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|975415_976036_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|976063_977959_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|978171_979047_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|979252_980239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|980248_980557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|980613_981204_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|981200_981959_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|982178_983228_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	1481674	1564961	4947532	plate,holin,tail,tRNA,portal,capsid,integrase,terminase	Escherichia_phage(24.39%)	95	1522411:1522470	1565023:1565147
WP_001258676.1|1481674_1483447_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1483756_1484323_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1484319_1485138_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1485190_1485586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1485626_1486370_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|1486366_1487338_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1487373_1489803_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1489827_1490928_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1492092_1492839_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1492852_1493419_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1493634_1495368_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1495420_1495813_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1495812_1497891_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1497883_1499032_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|1499220_1499865_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1499875_1500265_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1500279_1501329_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1501331_1502192_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1502482_1504144_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1504288_1504792_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1504812_1506777_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1506781_1507708_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1507704_1508592_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1508718_1509297_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1509299_1509650_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1510429_1510858_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|1510864_1512289_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|1512263_1513064_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|1513230_1514220_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|1514231_1515746_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|1515815_1516805_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1517599_1518103_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1518180_1518432_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1518546_1518633_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1518896_1519220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1519391_1519889_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1519926_1520166_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1520356_1521568_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1521618_1522284_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1522411:1522470	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1522755_1523175_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1524389_1524614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1524775_1525165_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1525200_1526841_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1526949_1527231_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1527243_1527756_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|1527773_1529276_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1529272_1529662_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1529661_1530846_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1530838_1531465_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1531467_1532388_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1532384_1532726_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1532728_1533631_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1533611_1534148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1534144_1534825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1534856_1535237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1535233_1535653_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1535687_1536722_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1536780_1537110_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_078214990.1|1537109_1538417_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	7.6e-107
WP_000126513.1|1538416_1539991_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1539987_1540221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1540220_1542083_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1542069_1542636_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1543004_1543250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1543309_1543504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1543511_1543991_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1543990_1544263_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1544262_1544646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1544758_1545430_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1545429_1545723_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1545719_1546316_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1546393_1546573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1546724_1547366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1547609_1547843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1548241_1548730_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1548739_1549345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1549807_1550506_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1551694_1552618_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1552792_1553581_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|1554262_1554487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1554483_1554795_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1554791_1555028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1555029_1555440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1555478_1556894_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1556883_1557639_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1557635_1557860_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1557899_1558376_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1558434_1558665_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1558763_1559177_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1560187_1560508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1560538_1562755_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1562751_1563321_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1563320_1563503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1563712_1563976_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1563944_1564961_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1565023:1565147	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	1686912	1723210	4947532	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
WP_001296203.1|1686912_1688109_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|1688232_1688511_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|1688604_1689207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|1690232_1690925_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|1690924_1691947_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|1692092_1692272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001296206.1|1693471_1694617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|1695147_1695405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|1695458_1696226_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|1696222_1697281_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|1697299_1698289_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|1698299_1700465_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|1700893_1701328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|1701545_1703930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|1703926_1704832_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|1704828_1705899_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|1706034_1706448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|1706562_1708104_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1708118_1708865_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000080195.1|1709331_1710945_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1710975_1711326_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1711322_1711748_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000846703.1|1711853_1712264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1712484_1713303_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1713302_1713548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1713641_1714115_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1714130_1714607_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1714669_1714891_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1714909_1715554_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|1715569_1715938_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|1716026_1716401_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|1716397_1716592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1716604_1716718_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|1717206_1717389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|1717489_1717819_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|1717990_1719049_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|1719246_1719720_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|1719838_1721005_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|1721213_1722641_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|1722751_1723210_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 6
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	1746357	1752660	4947532		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|1746357_1746900_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1746904_1747783_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1747840_1748740_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1748739_1749825_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1750197_1751091_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|1751265_1752660_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 7
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	1846833	1856278	4947532		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1846833_1847970_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1847966_1849970_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1850094_1850556_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1850596_1851067_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1851113_1851833_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1851829_1853515_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1853736_1854468_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1854527_1854635_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1854615_1855347_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1855351_1856278_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 8
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	2433579	2440719	4947532		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2433579_2436141_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2436246_2436903_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|2436953_2437751_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|2437916_2438825_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2438821_2440084_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2440080_2440719_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	2687634	2753726	4947532	protease,tRNA,integrase,transposase	Staphylococcus_phage(20.0%)	57	2688843:2688860	2749121:2749138
WP_001296354.1|2687634_2688393_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|2688822_2689743_-	agmatinase	NA	NA	NA	NA	NA
2688843:2688860	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|2689878_2690610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2690755_2692732_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2692740_2692872_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|2693007_2693223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2693526_2694681_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2695116_2696511_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|2696587_2697085_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2697179_2697887_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2697966_2698698_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|2698710_2699661_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|2699697_2700333_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2700332_2700749_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|2700863_2701844_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2701861_2702566_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2702583_2703150_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|2703146_2703437_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|2703444_2704038_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|2704030_2705167_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|2705481_2706468_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|2706512_2707016_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|2707015_2708317_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|2708372_2709380_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|2709496_2710543_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2710718_2711438_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|2711458_2711599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|2711621_2711948_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2711947_2712667_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|2712827_2713880_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2713907_2714183_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2714247_2715327_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|2715528_2716785_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|2716833_2718969_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2719361_2720069_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2720447_2721713_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|2721968_2723012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|2724705_2725257_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|2727748_2727982_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|2728448_2728664_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|2728632_2729759_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|2729849_2729963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|2731796_2732057_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|2732098_2732659_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2732698_2733127_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|2733844_2735038_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|2735173_2736898_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|2736898_2737846_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|2737845_2739588_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2739584_2740862_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|2740943_2743145_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|2744088_2747976_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|2748572_2749724_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2749121:2749138	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_032212789.1|2749772_2750627_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_000080195.1|2751309_2752923_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2752953_2753304_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2753300_2753726_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 10
NZ_CP018983	Escherichia coli strain Ecol_867 chromosome, complete genome	4947532	3800989	3877127	4947532	plate,holin,tail,tRNA,portal,capsid,integrase,protease,head,terminase,lysis	Escherichia_phage(36.36%)	85	3830049:3830095	3861150:3861196
WP_000560981.1|3800989_3801427_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3801471_3802413_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|3802476_3803385_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|3803613_3803925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|3803925_3804216_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|3804574_3804853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|3805249_3805468_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|3805652_3806102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|3806417_3807266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|3807555_3807798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|3807979_3808909_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3808905_3809541_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|3809537_3810440_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|3810452_3813503_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|3813696_3814530_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|3815525_3816920_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|3816960_3817275_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|3817284_3818109_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|3818375_3819635_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|3819631_3821101_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|3821388_3822225_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|3822208_3823147_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|3823143_3824178_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|3824462_3825083_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|3825342_3826326_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|3826474_3827149_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3827319_3828693_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3828689_3829388_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
3830049:3830095	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985243.1|3830211_3831192_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
WP_000777028.1|3831261_3831555_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	99.0	4.7e-49
WP_001308179.1|3831691_3831964_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3832133_3832634_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3832697_3832922_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277891.1|3832921_3833221_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001554298.1|3833223_3833448_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	95.9	2.5e-34
WP_001554299.1|3833444_3833720_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001554300.1|3833709_3835992_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.5	0.0e+00
WP_021535452.1|3836108_3837941_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.1	5.3e-90
WP_000038161.1|3838280_3839315_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_021535453.1|3839314_3841087_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_021535454.1|3841260_3842115_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	99.3	1.5e-135
WP_021535455.1|3842173_3843247_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI8	Enterobacteria_phage	99.4	1.3e-200
WP_000203428.1|3843250_3843994_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_021535456.1|3844093_3844603_+|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	98.8	7.3e-90
WP_000846399.1|3844602_3844806_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|3844809_3845091_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3845090_3845588_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021535457.1|3845602_3846028_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	8.6e-60
WP_000040652.1|3846015_3846441_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
WP_001440152.1|3846412_3846586_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917182.1|3846548_3847016_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001781.1|3847008_3847461_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_021535458.1|3847527_3848163_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.0e-113
WP_001554305.1|3848159_3848507_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	3.8e-58
WP_001554306.1|3848511_3849420_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	2.6e-162
WP_001285323.1|3849412_3849943_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001554307.1|3849953_3852689_+|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	81.9	0.0e+00
WP_001554308.1|3852692_3853220_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	99.4	1.7e-94
WP_001554309.1|3853609_3854137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078215001.1|3854435_3855626_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001554312.1|3855638_3856157_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001031312.1|3856213_3856489_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|3856521_3856641_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_059333313.1|3856633_3859081_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.9	0.0e+00
WP_000978879.1|3859095_3859575_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	99.4	5.6e-84
WP_021535459.1|3859574_3860738_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	2.8e-206
WP_000468308.1|3860819_3861038_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|3861274_3862177_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3861150:3861196	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|3862357_3863320_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|3863639_3864629_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|3864735_3865491_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3865545_3866313_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|3866420_3867020_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|3867120_3867561_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|3867772_3868072_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|3868098_3868527_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|3868531_3869278_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3869374_3870385_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_078215002.1|3870555_3872058_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3872084_3872930_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3873354_3873600_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3873684_3874170_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3874262_3875189_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3875255_3876587_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3876596_3877127_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP018982	Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence	100168	1611	10877	100168	transposase	Escherichia_phage(62.5%)	9	NA	NA
WP_012372828.1|1611_2628_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|2855_3173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|3459_3819_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|3846_4026_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|4030_4411_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|4410_4632_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|4814_6371_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|6367_7639_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001553854.1|7760_10877_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
>prophage 2
NZ_CP018982	Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence	100168	21055	72275	100168	integrase,protease,transposase	Macacine_betaherpesvirus(29.41%)	51	18215:18231	34743:34759
18215:18231	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000016982.1|21055_21862_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|22635_23391_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|23978_25145_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|25144_26116_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|26982_27885_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|28269_28953_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|28953_29175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|29188_29623_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|30989_31292_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|31338_31761_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|31757_31949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|32983_33214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170714.1|33265_34627_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001348621.1|34674_35238_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
34743:34759	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
WP_016238251.1|35263_35488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|35708_35897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290841.1|36130_36670_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_000005990.1|36732_36966_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117179.1|37031_38990_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000845940.1|39044_39479_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276232.1|39475_40195_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_085947770.1|40440_41809_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001312861.1|41920_42079_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032143370.1|42579_42768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|43000_43288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|43406_44228_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000243712.1|44524_45127_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151566.1|45457_45841_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_078214978.1|45974_46406_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000850429.1|47482_48214_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199914.1|48416_49196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946705.1|49192_51382_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001617867.1|51381_56652_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205718.1|56671_57418_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|57472_58033_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|58163_58376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|58934_59360_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|59356_59707_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|59737_61351_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_023144756.1|61786_61921_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083850.1|62217_62472_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_031943482.1|62708_62783_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001617855.1|62775_63633_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|64572_65226_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|65318_65576_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|65508_65910_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|66194_67505_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|67781_68642_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|68940_69645_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|69813_70674_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_078214979.1|71570_72275_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.9e-138
