The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018962	Escherichia coli strain Ecol_422 chromosome, complete genome	4747607	70352	83535	4747607		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|70352_72914_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|73019_73676_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|73726_74494_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|74689_75598_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|75594_76857_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|76853_77492_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|77496_78273_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|78361_79726_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|79819_80812_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|80874_82014_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|82153_82780_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|82773_83535_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 2
NZ_CP018962	Escherichia coli strain Ecol_422 chromosome, complete genome	4747607	1131730	1139791	4747607	transposase	Stx2-converting_phage(85.71%)	9	NA	NA
WP_000019348.1|1131730_1133068_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
WP_000086486.1|1133232_1133898_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116777.1|1133964_1134432_+	protein CbrB	NA	NA	NA	NA	NA
WP_001333339.1|1134783_1136319_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|1136367_1136715_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1136711_1137116_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000381395.1|1137175_1138747_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1138766_1139114_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1139113_1139791_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 3
NZ_CP018962	Escherichia coli strain Ecol_422 chromosome, complete genome	4747607	2136625	2209468	4747607	transposase,plate,tRNA,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|2136625_2137978_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2138007_2140440_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2140561_2141047_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2141050_2142076_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2142180_2142636_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2142639_2143428_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|2143427_2144576_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2144572_2145169_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2145205_2148688_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2148700_2149660_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|2149758_2151900_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|2151956_2152346_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|2152410_2153709_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2153757_2154018_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2154004_2154205_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|2154370_2154916_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|2154912_2155335_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|2155348_2156059_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|2156258_2157083_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|2157136_2158855_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2158966_2159674_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2159670_2160075_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|2160192_2161008_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2161047_2161701_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|2161693_2162725_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|2162912_2163488_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|2169247_2170051_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|2170047_2170962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2171202_2172003_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|2172006_2172630_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|2172677_2174036_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|2174107_2174863_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|2174896_2175619_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2175615_2176083_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|2176147_2176879_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|2177415_2178201_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236645.1|2178337_2178817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|2178826_2179741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2179784_2180267_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|2180290_2181643_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|2181653_2185088_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|2185196_2186609_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|2186613_2187357_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|2187353_2190119_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|2190127_2190889_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246442.1|2190893_2192225_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2192227_2192752_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113719.1|2192748_2194029_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2194053_2195136_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|2195099_2196950_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|2196953_2197367_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|2197373_2198849_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|2198899_2199124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|2199158_2199659_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2200353_2200872_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103354.1|2201081_2203223_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_000508724.1|2203298_2207531_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|2207508_2207901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|2208331_2209468_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018962	Escherichia coli strain Ecol_422 chromosome, complete genome	4747607	4206282	4216500	4747607	transposase	Enterobacteria_phage(75.0%)	11	NA	NA
WP_001292769.1|4206282_4207419_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001446943.1|4207415_4209416_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_103758571.1|4209569_4210267_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
WP_000741419.1|4210308_4210779_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	3.6e-75
WP_000950409.1|4210818_4211289_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|4211335_4212055_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4212051_4213737_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4213958_4214690_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4214749_4214857_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4214837_4215569_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_078207824.1|4215573_4216500_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 1
NZ_CP018961	Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence	289903	20152	26449	289903	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_085955245.1|20152_21344_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_078207722.1|21849_22323_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.9	6.0e-22
WP_004026415.1|22415_22634_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_078207723.1|22799_23051_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.4e-22
WP_004026416.1|23171_23486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078207724.1|23566_23887_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.9e-28
WP_004181860.1|23940_24810_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_007901308.1|25525_26449_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
>prophage 2
NZ_CP018961	Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence	289903	105342	132222	289903	integrase,transposase	Enterobacteria_phage(20.0%)	29	97897:97910	126856:126869
97897:97910	attL	AAAAAACAACCTTC	NA	NA	NA	NA
WP_025368604.1|105342_106569_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	76.6	6.2e-143
WP_040120489.1|106605_107031_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	51.5	1.8e-33
WP_042935575.1|107316_108543_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	79.3	1.7e-156
WP_004181778.1|108772_109057_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_025368601.1|109046_109295_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_042935572.1|109585_111385_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.6	3.3e-28
WP_046654939.1|111718_112714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|112858_113212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046664185.1|113273_114095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186944.1|114122_115175_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|115268_116345_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_125482819.1|116408_118436_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004181768.1|118507_118738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|118848_120093_+	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181766.1|120161_120701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|120845_121064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026547.1|121651_121894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|121941_122406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198103.1|122415_122823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934803.1|122865_123825_+	DNA replication protein	NA	NA	NA	NA	NA
WP_001067855.1|124204_124909_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|124799_125759_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_063840321.1|126050_126605_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|126735_127566_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
126856:126869	attR	GAAGGTTGTTTTTT	NA	NA	NA	NA
WP_000186237.1|127703_128336_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|128420_128873_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|129095_129443_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|129436_130276_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|130680_132222_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018961	Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence	289903	136994	194623	289903	protease,integrase,transposase	Enterobacteria_phage(22.22%)	54	136810:136869	144561:144666
136810:136869	attL	ATGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCA	NA	NA	NA	NA
WP_001389365.1|136994_137759_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_078207745.1|137730_138108_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
WP_042881802.1|138190_138409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064145616.1|138516_139209_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
WP_001137892.1|139613_140198_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|141431_142337_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|142458_143163_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000935452.1|143209_144514_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|144552_145260_-	EAL domain-containing protein	NA	NA	NA	NA	NA
144561:144666	attR	TGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGT	NA	NA	NA	NA
WP_000993386.1|145256_145493_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|145489_145852_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|145869_147564_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|147615_148038_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|148073_148349_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|148362_148713_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|148784_149219_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|149297_150302_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001235713.1|152989_153547_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_047028173.1|153729_154590_+	class A extended-spectrum beta-lactamase TEM-26	NA	Q1MVP3	Enterobacteria_phage	99.3	6.6e-160
WP_078207728.1|154731_155592_+	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000587836.1|155604_155898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085956516.1|155929_157088_+|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
WP_004197549.1|157154_157340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947932.1|158231_158992_-|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_004197545.1|159116_159389_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004197551.1|159484_159913_+	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_078207729.1|159918_161220_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.0	2.1e-77
WP_078207730.1|162162_163338_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_078207746.1|163458_164103_-	quinolone resistance pentapeptide repeat protein QnrE2	NA	NA	NA	NA	NA
WP_000608644.1|164332_165595_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_153302092.1|166028_166652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153302093.1|166661_167114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|167304_168189_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_004026565.1|169446_169899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328948.1|170142_170457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046654955.1|171376_172300_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.5e-165
WP_003846919.1|173061_173232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045291378.1|173288_174542_-	lactose permease	NA	NA	NA	NA	NA
WP_045291380.1|174593_177668_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_024241646.1|177789_178872_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_153302094.1|179241_180234_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|180637_181642_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004118061.1|182535_182940_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_025999313.1|183215_183698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078207732.1|184076_185576_-	kinase	NA	NA	NA	NA	NA
WP_070083107.1|185603_187337_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|187336_188377_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|188469_189108_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|189108_189750_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026588.1|189774_190413_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_078207733.1|190892_191351_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_040209483.1|191353_192577_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_065892228.1|192587_193544_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_078207734.1|193543_194623_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.3	1.0e-40
>prophage 4
NZ_CP018961	Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence	289903	214321	266462	289903	transposase	Salmonella_phage(25.0%)	48	NA	NA
WP_001567368.1|214321_215725_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_004196316.1|215931_216246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078207738.1|216254_216764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078207739.1|216753_217194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181937.1|217223_217880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181934.1|218153_218756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196349.1|218758_219274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040168652.1|219391_220348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196319.1|220577_221534_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004181929.1|221593_221935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181928.1|221948_222260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181926.1|222276_223005_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004026303.1|223138_223753_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_085929673.1|225364_226533_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_004196338.1|228189_228546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181922.1|229434_229740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|229790_233759_-	traG-like region family protein	NA	NA	NA	NA	NA
WP_004181920.1|233760_235116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196361.1|235159_236197_-	thioredoxin	NA	NA	NA	NA	NA
WP_004196331.1|236562_237105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438005.1|237121_237646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|237838_238252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|239191_239656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196318.1|239655_240444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078207740.1|240457_243406_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_032438003.1|243395_245522_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004181912.1|245524_246622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181910.1|246634_247309_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004181908.1|247317_248454_+	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.0	4.4e-10
WP_004181907.1|248456_249230_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
WP_004181906.1|249283_249640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134999.1|249864_250506_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000608644.1|250745_252008_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_004181905.1|252741_252975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181904.1|253053_253401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181903.1|253556_254624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181901.1|255313_255691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527912.1|255888_256245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181898.1|257465_257624_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000323025.1|257695_257983_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|257982_258222_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_100280317.1|258246_258441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020277922.1|258484_259408_-	cation transporter	NA	NA	NA	NA	NA
WP_078207746.1|259859_260504_-	quinolone resistance pentapeptide repeat protein QnrE2	NA	NA	NA	NA	NA
WP_000608644.1|260733_261996_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001515348.1|262385_262958_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_003030308.1|263433_264672_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
WP_001567368.1|265058_266462_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018960	Escherichia coli strain Ecol_422 plasmid pEC422_2, complete sequence	73206	14387	55294	73206	protease,integrase,transposase	Escherichia_phage(27.78%)	46	5545:5558	42905:42918
5545:5558	attL	CGCCCGGATATCAG	NA	NA	NA	NA
WP_000016982.1|14387_15194_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|15967_16723_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|17310_18477_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|18476_19448_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|20314_21217_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|21601_22285_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|22285_22507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|22520_22955_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|24321_24624_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|24670_25093_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027516.1|25089_25281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|26315_26546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170714.1|26597_27959_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001348621.1|28006_28570_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
WP_001774176.1|28595_28802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096645216.1|29022_29238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|29291_30038_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_002431311.1|30052_31594_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_014966221.1|31955_32030_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130646.1|32022_32880_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|33818_34472_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|34564_34822_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|34754_35156_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|35451_36156_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024210412.1|36167_37649_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|38177_38627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|39141_39252_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|39256_39994_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|40119_40215_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|40349_41054_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|41175_42081_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|42077_43316_+	MFS transporter	NA	NA	NA	NA	NA
42905:42918	attR	CGCCCGGATATCAG	NA	NA	NA	NA
WP_001137892.1|43315_43900_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|44392_45157_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|45383_45689_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|45699_46905_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|47060_47264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47391_48231_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48224_48572_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|48777_49566_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|49696_50170_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|51072_51777_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|51920_52475_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|52605_53436_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|53573_54206_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001067855.1|54589_55294_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP018958	Escherichia coli strain Ecol_422 plasmid pEC422_4, complete sequence	53198	6376	12237	53198		Escherichia_phage(33.33%)	10	NA	NA
WP_000673985.1|6376_6763_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	50.4	2.5e-26
WP_000493532.1|6759_6984_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	43.2	1.1e-05
WP_001290347.1|7163_7445_-	membrane protein	NA	NA	NA	NA	NA
WP_000930236.1|7606_7891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096541.1|7926_8229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016235966.1|8318_8978_-	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	30.0	1.1e-05
WP_016235965.1|9529_9853_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	43.0	5.6e-11
WP_001146936.1|10206_10551_+	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	44.3	4.5e-11
WP_000127482.1|10537_10888_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_001025393.1|11721_12237_+	J domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	40.6	7.3e-05
