The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	653842	721764	4794957	integrase,transposase	Stx2-converting_phage(22.22%)	60	714538:714565	721852:721879
WP_000181112.1|653842_654799_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
WP_001137002.1|655265_656498_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|656538_657819_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_032181500.1|657934_659086_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|659095_659863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|659859_660117_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|660181_661042_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141202.1|661109_662288_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151859.1|662300_662855_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
WP_001295597.1|663104_663788_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|663784_664246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568432.1|664258_665431_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340740.1|665495_666407_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986224.1|666399_666792_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|666788_666872_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_001680156.1|667464_668295_+	YjfZ/YjiC family protein	NA	NA	NA	NA	NA
WP_000833677.1|668435_669209_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|669423_670884_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|670964_672149_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000832240.1|672935_673838_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000872005.1|673857_674361_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244826.1|674373_674904_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000120930.1|674913_677550_-	fimbrial usher FimD	NA	NA	NA	NA	NA
WP_000066560.1|677616_678342_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000824105.1|678378_678918_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695546.1|678982_679531_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001282653.1|680241_680997_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|681013_682549_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_000790583.1|683730_684333_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_001341302.1|686524_687631_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991415.1|687695_688676_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	6.1e-101
WP_001037966.1|688683_689334_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001344112.1|691548_691725_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221529.1|692440_693010_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271003.1|693175_693577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|693564_693999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282144.1|694344_694734_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612591.1|694730_695078_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|695127_696513_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|696751_698110_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|698842_699100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|701627_702149_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|702145_703099_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|703185_705510_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001376066.1|705554_706457_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|706453_707452_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|707448_708405_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|708405_709173_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|709730_709988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|711039_712191_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|712110_712461_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|712561_713134_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|713182_714007_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
714538:714565	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_000749342.1|715044_715509_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145203.1|715749_716244_+	membrane protein	NA	NA	NA	NA	NA
WP_000331917.1|716304_717150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190110.1|717163_717724_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000085626.1|718053_718383_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_001261095.1|719388_719721_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_023148066.1|719853_721764_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
721852:721879	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
>prophage 2
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	2518872	2532055	4794957		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|2518872_2519634_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|2519627_2520254_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2520393_2521533_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2521595_2522588_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|2522681_2524046_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|2524134_2524911_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2524915_2525554_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2525550_2526813_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2526809_2527718_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2527913_2528681_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2528731_2529388_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2529493_2532055_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	3142418	3151860	4794957		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|3142418_3143345_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|3143349_3144081_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3144061_3144169_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3144228_3144960_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3145181_3146867_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3146863_3147583_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3147629_3148100_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3148140_3148602_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|3148726_3150727_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|3150723_3151860_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	3750549	3776743	4794957	lysis,integrase	Escherichia_phage(27.78%)	29	3751614:3751628	3775392:3775406
WP_000041556.1|3750549_3752976_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
3751614:3751628	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|3753174_3753480_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3753587_3754298_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3754300_3754861_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3754895_3755237_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3755371_3755698_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3755903_3757118_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|3757129_3758149_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|3758206_3758317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|3758336_3759617_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|3759651_3759903_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001372999.1|3759975_3762447_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|3762540_3762732_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3762728_3762917_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|3763000_3763243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|3763223_3764189_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_032181058.1|3764229_3764652_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	5.9e-61
WP_001678528.1|3764781_3765726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|3766273_3767623_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|3767940_3768543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|3768902_3769883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|3770402_3770510_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_012578894.1|3770611_3770767_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_000980999.1|3770982_3771234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|3771300_3771579_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|3771580_3772630_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|3772642_3773017_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|3773013_3773835_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_172800930.1|3774727_3776743_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	96.4	0.0e+00
3775392:3775406	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
>prophage 5
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	4181354	4192132	4794957	integrase	Enterobacteria_phage(40.0%)	11	4179327:4179350	4190835:4190858
4179327:4179350	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|4181354_4183310_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|4185674_4186214_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|4186396_4186708_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|4186704_4187385_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|4187381_4187540_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|4187536_4188601_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|4188754_4188973_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|4189020_4189260_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|4189399_4189636_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|4189625_4190768_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|4190881_4192132_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
4190835:4190858	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	4506508	4515278	4794957	integrase	Salmonella_phage(90.0%)	12	4506178:4506191	4515320:4515333
4506178:4506191	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|4506508_4506697_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|4506855_4509249_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|4509245_4510103_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|4510099_4510327_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|4510326_4510560_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|4510627_4510969_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|4511086_4511383_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|4511390_4511900_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|4511932_4512154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|4512299_4513178_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|4513189_4514134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|4514225_4515278_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
4515320:4515333	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP018965	Escherichia coli strain Ecol_517 chromosome, complete genome	4794957	4598692	4623326	4794957	lysis,integrase	Enterobacteria_phage(46.88%)	40	4598038:4598052	4623400:4623414
4598038:4598052	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|4598692_4600024_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000239881.1|4600423_4601092_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|4601982_4602543_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|4602931_4603165_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|4603221_4603632_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|4603983_4604136_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|4604123_4604591_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|4604587_4605085_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|4605084_4605300_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|4606569_4607529_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|4607721_4608246_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|4608401_4608779_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|4608864_4609005_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|4609001_4609364_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|4609360_4609651_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|4609643_4609814_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|4609813_4610269_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|4610265_4610367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|4610459_4610912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|4610908_4611469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|4611953_4612247_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|4612243_4612945_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_077249941.1|4612941_4613961_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001182899.1|4613957_4614497_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|4614566_4614797_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4614901_4615591_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|4615713_4616463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|4616459_4617287_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|4617795_4618002_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|4618077_4618374_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4618379_4619165_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|4619161_4619842_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|4619838_4620021_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|4619993_4620185_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|4620195_4620477_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|4620575_4620797_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|4621007_4621610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|4621852_4622020_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|4622059_4622278_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|4622255_4623326_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
4623400:4623414	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP018964	Escherichia coli strain Ecol_517 plasmid pEC517_1, complete sequence	118495	2395	53324	118495	integrase,protease,transposase	Escherichia_phage(40.0%)	50	NA	NA
WP_023149734.1|2395_3967_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000968309.1|4721_4904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015387399.1|5090_5297_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|5580_5838_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|6073_6148_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|7907_9128_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|9138_10050_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154545.1|10134_11139_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|11186_12590_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001067855.1|12961_13666_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|15287_15530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|15561_16212_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|16317_17517_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|17548_18433_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|18570_18978_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|19739_20345_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|20439_23337_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|23473_23875_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|23807_24065_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|24157_24811_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032152935.1|25749_26607_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|26599_26674_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083821.1|26908_27166_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000156883.1|27570_28593_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000005489.1|29064_29418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152936.1|29830_30409_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_059330006.1|31247_31610_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|31606_31957_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080227.1|31987_32209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32877_33582_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|33725_34280_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|34410_35241_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|35872_36577_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000239590.1|37185_38061_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|38107_38440_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|40761_41466_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|41587_42493_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|42489_43728_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|43727_44312_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|44804_45569_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|45795_46101_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|46111_47317_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|47472_47676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|47803_48643_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|48636_48984_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|49189_49978_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|50108_50582_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|50739_51753_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|51955_52306_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|52619_53324_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
