The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	113	26392	4898796	protease,transposase,tail	Escherichia_phage(26.67%)	27	NA	NA
WP_001298859.1|113_1655_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1669_2416_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|2877_5784_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|5799_6327_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|6357_6891_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|6892_7678_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|7905_8088_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|8286_8955_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|9011_9281_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|9395_9566_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|9692_10250_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|10246_10522_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|10897_11704_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|11703_12897_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|12908_14267_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|14270_15866_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|15865_17428_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|17519_17564_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|17701_18583_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|18579_19200_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|19227_21123_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|21335_22211_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|22380_23403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|23412_23721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|23777_24368_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|24364_25123_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|25342_26392_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	522269	604779	4898796	integrase,portal,plate,terminase,tRNA,tail,holin,capsid	Escherichia_phage(24.39%)	95	562229:562288	604841:604965
WP_001258676.1|522269_524042_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|524351_524918_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|524914_525733_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|525785_526181_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|526221_526965_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|526961_527933_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|527968_530398_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|530422_531523_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|531910_532657_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|532670_533237_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|533452_535186_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|535238_535631_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|535630_537709_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|537701_538850_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|539038_539683_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|539693_540083_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|540097_541147_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|541149_542010_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|542300_543962_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|544106_544610_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|544630_546595_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|546599_547526_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|547522_548410_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|548536_549115_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|549117_549468_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|550247_550676_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|550682_552107_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|552081_552882_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|553048_554035_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|554049_555564_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|555633_556623_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|557417_557921_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|557998_558250_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|558364_558451_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|558714_559038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|559209_559707_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|559744_559984_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|560174_561386_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|561436_562102_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
562229:562288	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|562573_562993_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|564207_564432_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|564593_564983_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|565018_566659_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|566767_567049_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|567061_567574_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|567591_569094_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|569090_569480_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|569479_570664_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|570656_571283_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|571285_572206_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|572202_572544_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|572546_573449_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|573429_573966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|573962_574643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|574674_575055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|575051_575471_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|575505_576540_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|576598_576928_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|576927_578235_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|578234_579809_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|579805_580039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|580038_581901_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|581887_582454_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|582822_583068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|583127_583322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|583329_583809_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|583808_584081_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|584080_584464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|584576_585248_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|585247_585541_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|585537_586134_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|586211_586391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|586542_587184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|587427_587661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|588059_588548_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|588557_589163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|589625_590324_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|591512_592436_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|592610_593399_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|594080_594305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|594301_594613_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|594609_594846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|594847_595258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|595296_596712_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|596701_597457_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|597453_597678_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|597717_598194_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|598252_598483_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|598581_598995_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|600005_600326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|600356_602573_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|602569_603139_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|603138_603321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|603530_603794_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|603762_604779_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
604841:604965	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	746380	752832	4898796	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|746380_747922_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|747936_748683_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|749131_749542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|749762_750581_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|750580_750826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|750919_751393_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|751408_751885_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|751947_752169_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|752187_752832_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 4
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	783635	789938	4898796		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|783635_784178_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|784182_785061_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|785118_786018_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|786017_787103_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|787475_788369_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|788543_789938_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 5
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	886653	896098	4898796		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|886653_887790_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|887786_889790_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|889914_890376_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|890416_890887_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|890933_891653_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|891649_893335_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|893556_894288_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|894347_894455_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|894435_895167_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|895171_896098_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 6
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	1103850	1177541	4898796	integrase,lysis,portal,head,terminase,protease,tRNA,holin,coat	Enterobacteria_phage(56.06%)	96	1133698:1133718	1184456:1184476
WP_001283598.1|1103850_1104663_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|1104662_1105676_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699128.1|1105741_1106878_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
WP_000615816.1|1106976_1107972_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|1107968_1109147_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|1109411_1110632_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683761.1|1110790_1112797_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|1112917_1113196_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|1113229_1113778_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|1113777_1114587_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043795.1|1114586_1115411_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001296258.1|1115414_1116500_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001296259.1|1116534_1117467_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1117632_1118184_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001527383.1|1118243_1119068_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000054000.1|1119069_1119597_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000819140.1|1119593_1120073_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000679363.1|1120069_1120561_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000499462.1|1120577_1121330_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296260.1|1121349_1123998_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032632.1|1124078_1124645_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195810.1|1125203_1125689_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425017.1|1125891_1128036_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|1128035_1129346_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1129526_1129811_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296262.1|1130182_1131523_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|1131584_1132340_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|1132633_1133566_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1133698:1133718	attL	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
WP_023156993.1|1133877_1135035_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
WP_023156994.1|1135143_1137321_-|head	phage head-binding domain protein	head	A0A2D1GLP5	Escherichia_phage	71.7	5.6e-62
WP_001407254.1|1137423_1137711_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085227.1|1137725_1137947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021575671.1|1137946_1138675_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.4	3.4e-80
WP_044342074.1|1138762_1139485_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	91.3	2.6e-117
WP_024191015.1|1139474_1139648_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_032152582.1|1139771_1140023_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	68.6	2.1e-10
WP_001334102.1|1140090_1140459_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_078214630.1|1140483_1142322_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.7	1.2e-246
WP_078214632.1|1142321_1143737_-	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.3	6.3e-200
WP_044342079.1|1143746_1144439_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	97.4	6.4e-113
WP_000614042.1|1144441_1144897_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.2e-87
WP_044342082.1|1144896_1145850_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	80.1	5.0e-92
WP_044342083.1|1145849_1147268_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	99.2	1.7e-274
WP_032216290.1|1147277_1147739_-|head	head DNA stabilization protein	head	A0A088CQ08	Enterobacteria_phage	100.0	1.9e-84
WP_001389518.1|1147719_1147908_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_063269022.1|1147949_1149203_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.6	5.9e-234
WP_044342089.1|1149221_1150115_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	86.5	9.7e-122
WP_044342091.1|1150205_1152404_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_000200761.1|1152405_1153821_-|terminase	PBSX family phage terminase large subunit	terminase	A0A088CQ06	Enterobacteria_phage	100.0	4.0e-279
WP_000113731.1|1153817_1154258_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807785.1|1154260_1154503_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000999689.1|1154606_1154963_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
WP_000877024.1|1155150_1155681_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_001543881.1|1155886_1156039_-	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_044342105.1|1156026_1156494_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.8	9.4e-76
WP_000229389.1|1156490_1156967_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|1156950_1157274_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_044342106.1|1157811_1158300_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	98.8	1.7e-88
WP_000994516.1|1158296_1158485_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001549462.1|1158481_1158844_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_044342108.1|1158844_1159369_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	44.0	2.5e-32
WP_044342110.1|1159365_1159656_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	8.4e-51
WP_001286917.1|1159648_1159861_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_096099000.1|1159853_1160024_-	ninF	NA	NA	NA	NA	NA
WP_044342114.1|1160383_1160569_-	protein ninF	NA	Q76H71	Enterobacteria_phage	84.4	1.4e-14
WP_001544373.1|1160561_1160921_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	3.4e-41
WP_001254220.1|1160923_1161100_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_044342121.1|1161096_1161537_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.9	1.1e-78
WP_044342123.1|1161750_1162077_-	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_044342126.1|1162152_1163589_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.2	8.8e-274
WP_016042224.1|1163578_1164469_-	hypothetical protein	NA	G5DA89	Enterobacteria_phage	100.0	1.5e-159
WP_000166961.1|1164455_1164617_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001177653.1|1164651_1164930_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_001194218.1|1165049_1165265_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|1165368_1166001_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_044342143.1|1165997_1166402_+	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	4.8e-68
WP_072256486.1|1166652_1167033_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.1e-53
WP_000065354.1|1167545_1167914_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	1.0e-64
WP_042098905.1|1167948_1168917_+	cell envelope integrity/translocation protein TolA	NA	K7P7J7	Enterobacteria_phage	99.7	4.5e-56
WP_000638547.1|1168941_1169073_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243353.1|1169057_1169210_+	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|1169285_1169456_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|1169466_1170072_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951325.1|1170071_1170455_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_044342165.1|1170478_1170772_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	9.4e-50
WP_000773124.1|1170791_1171073_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214453.1|1171069_1171237_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_059339846.1|1171233_1171752_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	85.9	2.2e-33
WP_044342168.1|1171753_1172422_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	1.6e-52
WP_000022062.1|1172536_1172818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545735.1|1172906_1173074_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	1.3e-27
WP_001163428.1|1173131_1173332_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000926944.1|1173580_1174756_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|1174735_1175686_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|1175707_1176589_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000783295.1|1177268_1177541_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
1184456:1184476	attR	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 7
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	1512407	1519547	4898796		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1512407_1514969_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|1515074_1515731_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|1515781_1516549_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|1516744_1517653_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|1517649_1518912_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|1518908_1519547_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 8
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	3228559	3299941	4898796	holin,tRNA,transposase	Stx2-converting_phage(31.82%)	59	NA	NA
WP_000416407.1|3228559_3231415_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3231414_3231858_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3232213_3233725_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3233991_3235092_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001296697.1|3235091_3236174_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001296698.1|3236334_3237837_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296699.1|3237966_3238986_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001064798.1|3242279_3243044_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001545174.1|3243283_3244183_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001044501.1|3244199_3245717_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000440185.1|3245794_3246808_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_000939276.1|3247068_3248313_+	MFS transporter	NA	NA	NA	NA	NA
WP_000239754.1|3250004_3250241_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000422741.1|3250578_3251004_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3251000_3251351_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3251381_3252995_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001553935.1|3253355_3254228_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250227.1|3254312_3255230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|3256430_3257033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|3257128_3257335_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|3258108_3258258_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221530.1|3258987_3259557_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|3259816_3260218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3260205_3260640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|3260994_3261375_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3261371_3261719_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|3261768_3263154_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3263392_3264751_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|3266312_3266834_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068908.1|3266830_3267784_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|3267870_3270195_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3270239_3271142_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3271138_3272137_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3272133_3273090_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3273090_3273858_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3274414_3274672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947616.1|3275605_3276761_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001545177.1|3276916_3278914_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_001296707.1|3278976_3280254_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|3280501_3281158_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000527665.1|3281338_3281446_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001295538.1|3282671_3283454_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|3283759_3284680_+	ribokinase	NA	NA	NA	NA	NA
WP_000998348.1|3284707_3286024_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107487.1|3286035_3287049_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000080195.1|3287319_3288933_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3288963_3289314_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3289310_3289736_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_021526504.1|3289871_3292718_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|3292788_3292947_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234738.1|3293101_3293920_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001350782.1|3294261_3294735_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|3294750_3295227_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|3295289_3295511_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|3295673_3296042_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854759.1|3296131_3296509_+	toxin	NA	NA	NA	NA	NA
WP_000761690.1|3296505_3296994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839286.1|3297010_3297187_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001298859.1|3298399_3299941_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 9
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	4348145	4457937	4898796	integrase,plate,head,terminase,portal,protease,tRNA,transposase,tail,holin,capsid	Enterobacteria_phage(42.71%)	131	4443535:4443550	4462856:4462871
WP_000520781.1|4348145_4348466_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4348496_4350773_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4351457_4351676_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|4351960_4352665_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|4352706_4354428_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|4354428_4356195_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|4356317_4357283_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|4357826_4358321_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|4358455_4362562_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4362720_4363332_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4363342_4364686_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4364776_4366069_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|4366374_4366515_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|4366706_4366967_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|4367007_4368117_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|4368274_4369459_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|4369458_4369971_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|4370026_4370401_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|4370409_4370565_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|4370551_4373359_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|4373371_4373860_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|4373888_4374488_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|4374715_4375501_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|4375502_4376030_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|4376058_4376592_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|4376594_4378580_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|4378582_4379113_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|4379105_4380002_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|4380005_4380335_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|4380352_4380919_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|4380930_4381566_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|4381558_4382026_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|4382049_4383927_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|4384065_4384461_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|4384457_4384850_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|4384846_4385170_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|4385172_4385373_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|4385372_4385867_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|4385968_4386769_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|4386814_4387867_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|4387890_4388727_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|4388881_4390633_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|4390632_4391679_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|4391693_4392218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|4392941_4393439_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|4393478_4394321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|4394404_4394719_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|4394723_4395683_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|4395759_4398582_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|4398588_4398954_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|4398950_4399568_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|4399579_4399879_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|4399875_4400142_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|4400138_4400342_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|4400365_4400776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|4400869_4400983_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|4400979_4401222_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|4401233_4401512_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|4401522_4401873_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|4402010_4402202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|4402208_4402631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|4402635_4403157_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|4403261_4403603_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|4403672_4404665_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|4404964_4407409_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4407419_4408037_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|4408038_4408902_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|4408937_4409564_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|4409877_4411026_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|4411122_4411863_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4412054_4414337_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|4414391_4415249_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|4415654_4417415_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|4417544_4418237_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|4418435_4419524_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|4419594_4420878_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|4421133_4421706_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|4421765_4422206_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_001486917.1|4422246_4422729_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_000072165.1|4422728_4423343_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001554039.1|4423349_4424630_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	43.8	7.8e-40
WP_000138756.1|4424632_4425211_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|4425203_4426307_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|4426297_4426645_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|4426699_4427296_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|4427292_4428447_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|4428434_4428647_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|4428646_4429531_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|4429530_4432482_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|4432557_4432716_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|4432639_4432975_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|4433072_4433354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|4433356_4433881_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|4433877_4435305_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|4435294_4435546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|4435545_4436010_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|4436009_4436456_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|4436457_4436796_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|4436805_4437759_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|4437773_4438889_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|4439103_4439562_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|4439564_4440386_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|4440366_4441863_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|4441862_4443404_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|4443454_4444000_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
4443535:4443550	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|4443999_4444311_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|4444310_4444637_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|4444633_4445284_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|4445267_4446008_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|4446010_4446361_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|4446491_4447220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|4447195_4447597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|4447598_4447814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|4448004_4448769_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|4448885_4449242_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|4449335_4449524_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|4449576_4449885_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|4449895_4450816_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|4450815_4451133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|4451148_4452918_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|4452928_4454095_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|4454097_4454367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142412.1|4454394_4454925_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000632576.1|4455213_4455486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|4455495_4455792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|4455806_4456022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|4456018_4456702_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|4456698_4456929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|4456918_4457125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|4457126_4457576_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|4457547_4457937_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
4462856:4462871	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 10
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	4669263	4714972	4898796	integrase,lysis,portal,terminase,head,tRNA,tail,holin,capsid	Enterobacteria_phage(56.0%)	58	4667581:4667595	4696175:4696189
4667581:4667595	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|4669263_4670370_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4670423_4670885_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|4670894_4671548_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4671719_4672970_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4673083_4674226_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4674215_4674452_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4674591_4674831_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4674814_4675141_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4675140_4675362_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|4675460_4675742_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|4675752_4675944_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4675916_4676099_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4676095_4676776_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4676772_4677558_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|4677563_4677860_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|4677935_4678142_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|4678737_4679427_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4679531_4679762_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|4679831_4680371_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|4680367_4681387_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|4681383_4682085_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|4682334_4686600_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|4686636_4687680_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|4688029_4688131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|4688127_4688583_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|4688582_4688753_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|4688745_4689036_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|4689032_4689395_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|4689391_4689532_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|4689528_4690218_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|4690539_4690845_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|4690831_4691308_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|4691524_4691707_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4691797_4692091_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4692571_4692898_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4693104_4693287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|4693850_4694396_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|4694370_4696296_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
4696175:4696189	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|4696292_4696499_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|4696495_4698097_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|4698077_4699397_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|4699406_4699739_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|4699794_4700820_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|4700861_4701260_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|4701271_4701625_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|4701636_4702215_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|4702211_4702607_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|4702614_4703355_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|4703370_4703793_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|4703774_4704209_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|4704201_4706763_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|4706759_4707089_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|4707088_4707787_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|4707791_4708535_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|4708471_4709074_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|4709134_4712617_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|4712675_4714697_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|4714693_4714972_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 11
NZ_CP018953	Escherichia coli strain Ecol_276 chromosome, complete genome	4898796	4855473	4898269	4898796	integrase,portal,terminase,head,tail,holin,capsid	Stx2-converting_phage(33.33%)	52	4851647:4851661	4857557:4857571
4851647:4851661	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|4855473_4856604_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4856581_4856830_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|4856894_4859366_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
4857557:4857571	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|4859458_4859650_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|4859646_4859835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|4860400_4860619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4860778_4860934_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|4861206_4861923_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|4861972_4862188_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|4862184_4862610_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|4862632_4863595_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|4863601_4864348_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|4864369_4865140_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|4865155_4865581_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|4865755_4866421_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|4866601_4866814_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|4866981_4867254_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|4867255_4868311_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|4868311_4868692_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|4868688_4869510_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|4869736_4869934_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|4870085_4871135_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|4871936_4872068_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|4872348_4872684_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|4872944_4874798_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|4874948_4875164_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|4875168_4875513_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|4875478_4875751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|4875856_4876390_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|4876944_4877031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|4877252_4877438_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|4877523_4877739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|4877937_4878138_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_078214659.1|4878179_4878545_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	92.6	7.3e-60
WP_000958366.1|4878835_4879399_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|4879395_4881057_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|4881120_4883058_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|4883102_4883324_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|4883269_4885855_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|4885851_4886178_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|4886187_4886538_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4886534_4886981_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4886977_4887322_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|4887388_4888105_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|4888119_4888494_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|4888589_4888799_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|4888846_4892089_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|4892081_4892423_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|4892422_4893121_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|4893131_4893875_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|4893820_4894453_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|4894795_4898269_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
>prophage 1
NZ_CP018952	Escherichia coli strain Ecol_276 plasmid pEC276_1, complete sequence	132345	2583	51598	132345	integrase,transposase	Escherichia_phage(50.0%)	39	13593:13607	55609:55623
WP_001189106.1|2583_3072_-|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_001020413.1|5337_6513_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|6581_8843_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|9011_9788_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|9795_10671_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_113525033.1|11712_11892_-	GlyGly-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_001080732.1|13120_13456_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|13584_13932_+	hypothetical protein	NA	NA	NA	NA	NA
13593:13607	attL	TGAGCAGAAAAAAGC	NA	NA	NA	NA
WP_000194542.1|13951_14461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|14457_14718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189113.1|16231_17740_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|18241_18646_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|18642_18990_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|20069_21092_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_001323403.1|21091_21871_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000977394.1|22609_23401_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|23407_25378_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|26620_26893_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001072358.1|27739_28909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|29275_29464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343765.1|29582_30803_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|30821_31340_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_001066941.1|31477_32218_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|32502_33480_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000081352.1|36822_37755_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|37741_39145_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|39352_40369_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|40596_40914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|41200_41560_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|41587_41767_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|41771_42152_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|42151_42373_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|42555_44112_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|44108_45380_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_000991832.1|47626_48559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246636.1|48562_49558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|50265_50484_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|50485_50791_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|50791_51598_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
55609:55623	attR	TGAGCAGAAAAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP018951	Escherichia coli strain Ecol_276 plasmid pEC276_2, complete sequence	43380	3561	13859	43380	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|3561_6579_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|7787_8690_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|8951_9713_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|9733_10594_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|10730_11435_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|11827_12067_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|12153_12816_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|13196_13859_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
