The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019915	Halomonas sp. 'Soap Lake #7' chromosome, complete genome	4803686	978057	985109	4803686		Enterobacteria_phage(28.57%)	7	NA	NA
WP_078090235.1|978057_979227_+	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	54.7	2.7e-111
WP_078087023.1|979316_980381_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	2.5e-100
WP_078087024.1|980644_981010_+	GxxExxY protein	NA	G9E611	Micromonas_pusilla_virus	39.8	3.3e-12
WP_078087025.1|981354_982251_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.1e-21
WP_078087026.1|982610_983507_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.1e-104
WP_078087027.1|983675_984224_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.2	6.3e-55
WP_078087028.1|984227_985109_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	3.5e-07
>prophage 2
NZ_CP019915	Halomonas sp. 'Soap Lake #7' chromosome, complete genome	4803686	2632157	2662117	4803686	head,transposase,integrase	Pseudomonas_phage(25.0%)	38	2622247:2622261	2643816:2643830
2622247:2622261	attL	TCGCTTAACCAGCCA	NA	NA	NA	NA
WP_078088383.1|2632157_2632862_-	helix-turn-helix domain-containing protein	NA	A0A076FRF7	Pseudomonas_phage	54.2	6.8e-70
WP_159053557.1|2633014_2633368_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078088385.1|2633370_2633808_+	hypothetical protein	NA	A0A0A1IVF5	Pseudomonas_phage	66.2	7.0e-49
WP_078088386.1|2633804_2635856_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	50.7	2.3e-182
WP_078088387.1|2635897_2636617_+	AAA family ATPase	NA	A0A2H4J809	uncultured_Caudovirales_phage	68.5	2.5e-88
WP_078088388.1|2636620_2637271_+	hypothetical protein	NA	A0A0U5KPI5	unidentified_phage	29.7	9.8e-15
WP_078088389.1|2637267_2637648_+	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	52.7	4.5e-28
WP_078088390.1|2637644_2638277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088391.1|2638273_2638690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088392.1|2638692_2639325_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	62.1	1.7e-67
WP_078088393.1|2639400_2639643_+	hypothetical protein	NA	A0A2P1A4B9	Alteromonadaceae_phage	57.7	5.4e-11
WP_078088394.1|2639651_2640062_+	hypothetical protein	NA	A0A2P9JZH3	Alteromonadaceae_phage	59.0	9.5e-40
WP_078088395.1|2640051_2640495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088396.1|2640491_2640914_+	regulatory protein GemA	NA	H1ZZD1	Pseudomonas_virus	60.0	1.4e-33
WP_078088397.1|2640900_2641329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159053558.1|2641375_2641972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088399.1|2642009_2642324_+	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	44.3	2.8e-07
WP_078088400.1|2642485_2642848_+	serine/threonine protein kinase	NA	A0A140XFU9	Salmonella_phage	59.5	3.1e-34
WP_078088401.1|2642850_2643051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088402.1|2643060_2643402_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_078088403.1|2643401_2643701_+	hypothetical protein	NA	A0A2P9JZI6	Alteromonadaceae_phage	79.8	9.0e-40
WP_078088404.1|2643714_2644266_+	DUF3486 family protein	NA	A0A2P9JZI7	Alteromonadaceae_phage	58.9	5.9e-53
2643816:2643830	attR	TGGCTGGTTAAGCGA	NA	NA	NA	NA
WP_078090317.1|2644289_2645762_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	51.2	7.9e-129
WP_078088405.1|2645755_2647366_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	43.2	1.1e-104
WP_078088406.1|2647340_2648522_+	hypothetical protein	NA	A0A1B0T6H8	Thiobacimonas_phage	46.7	8.5e-57
WP_078088407.1|2648634_2649075_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	25.7	2.8e-05
WP_078088408.1|2649243_2650224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088409.1|2650211_2650769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088410.1|2650834_2651950_+	hypothetical protein	NA	J9SH47	Pseudomonas_phage	38.7	8.6e-43
WP_078088411.1|2651986_2652415_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	49.3	3.7e-26
WP_078088412.1|2652456_2653362_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	42.1	1.0e-65
WP_078088413.1|2653386_2653794_+	DUF1320 domain-containing protein	NA	A0A1B0T6F3	Thiobacimonas_phage	38.3	1.0e-09
WP_078088414.1|2653803_2654073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078088415.1|2654072_2654474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151891996.1|2654485_2655421_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	36.6	1.1e-46
WP_078088417.1|2655491_2655827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107334180.1|2655889_2656189_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_078088419.1|2656207_2662117_+	EF-hand domain-containing protein	NA	A0A2H4JC10	uncultured_Caudovirales_phage	32.2	1.3e-17
>prophage 3
NZ_CP019915	Halomonas sp. 'Soap Lake #7' chromosome, complete genome	4803686	2816544	2827519	4803686	tRNA	Klosneuvirus(33.33%)	8	NA	NA
WP_078088552.1|2816544_2819157_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	9.9e-82
WP_078088553.1|2819296_2819776_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_078088554.1|2819817_2820882_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	1.3e-112
WP_078088555.1|2820972_2821506_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	58.8	2.4e-35
WP_078088556.1|2821667_2824241_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	1.2e-28
WP_078088557.1|2824394_2824718_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_078088559.1|2825296_2826586_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	2.8e-130
WP_078090325.1|2826655_2827519_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.6	6.9e-48
>prophage 4
NZ_CP019915	Halomonas sp. 'Soap Lake #7' chromosome, complete genome	4803686	2897152	2907851	4803686	tRNA,integrase	uncultured_Mediterranean_phage(50.0%)	9	2890823:2890882	2902069:2902128
2890823:2890882	attL	AAATATGGTGCCGGTGGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
WP_078088617.1|2897152_2898205_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	56.2	2.3e-106
WP_078088618.1|2898185_2899634_+	hypothetical protein	NA	A7BJX1	Enterobacteria_phage	43.0	7.6e-84
WP_078088619.1|2899702_2900995_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	35.0	1.0e-71
WP_078088620.1|2900994_2902056_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	42.8	1.6e-75
WP_078088621.1|2902273_2903305_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
2902069:2902128	attR	AAATATGGTGCCGGTGGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
WP_165771502.1|2903352_2904489_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	8.1e-89
WP_078088623.1|2904559_2904886_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	2.5e-11
WP_078088624.1|2905020_2906874_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	22.3	2.3e-08
WP_078088625.1|2906924_2907851_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.5	9.6e-40
>prophage 5
NZ_CP019915	Halomonas sp. 'Soap Lake #7' chromosome, complete genome	4803686	4677110	4735531	4803686	terminase,tRNA,integrase,tail,head,capsid,plate,portal	uncultured_Caudovirales_phage(27.27%)	66	4676965:4677024	4715828:4715904
4676965:4677024	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGTCGGCACCACTAAAAGTGGTTATA	NA	NA	NA	NA
WP_078090056.1|4677110_4678259_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	44.6	1.4e-80
WP_078090057.1|4678255_4678465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090058.1|4678461_4678752_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	46.5	4.8e-14
WP_078090059.1|4678748_4678985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151892000.1|4678998_4679439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090061.1|4679443_4679659_-	TraR/DksA C4-type zinc finger protein	NA	Q9ZXI6	Pseudomonas_virus	41.9	2.3e-05
WP_078090062.1|4679673_4681980_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	35.3	1.0e-69
WP_078090063.1|4681976_4682387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090064.1|4682411_4682789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090065.1|4682769_4683165_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_041158940.1|4683157_4683349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041158941.1|4683386_4683590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090066.1|4683625_4683832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090067.1|4683892_4684423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090068.1|4684578_4685244_+	LexA family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	27.6	3.1e-16
WP_078090425.1|4685312_4685876_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	41.8	5.9e-24
WP_078090069.1|4685904_4687197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090070.1|4687264_4687564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090071.1|4687553_4687787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090072.1|4688048_4688399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090073.1|4688793_4690074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090074.1|4690453_4690876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090075.1|4690859_4691540_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078090076.1|4691771_4692191_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	54.8	2.5e-35
WP_078090426.1|4692229_4692412_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	64.4	1.6e-15
WP_078090077.1|4692496_4693483_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	47.4	1.2e-80
WP_078090078.1|4693479_4693923_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	59.1	6.6e-39
WP_078090079.1|4693937_4697252_-|tail	phage tail tape measure protein	tail	D4HTW4	Vibrio_phage	30.7	6.3e-57
WP_078090080.1|4697261_4697399_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	68.6	1.0e-06
WP_078090081.1|4697440_4697842_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	51.8	1.9e-16
WP_078090082.1|4697904_4698414_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	48.0	7.4e-42
WP_078090083.1|4698448_4699618_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	66.1	2.4e-152
WP_078090084.1|4699774_4700581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078090085.1|4700611_4700800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090086.1|4700815_4701619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090087.1|4701633_4703775_-	DUF2817 domain-containing protein	NA	A0A0C5AEQ0	Bacteriophage	46.8	7.2e-30
WP_078090088.1|4703779_4704466_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	42.6	2.5e-32
WP_078090089.1|4704458_4705352_-|plate	baseplate J/gp47 family protein	plate	V5YTH6	Pseudomonas_phage	52.1	2.9e-73
WP_078090090.1|4705348_4705687_-	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	53.2	2.7e-24
WP_078090091.1|4705686_4706256_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	50.4	1.6e-29
WP_078090092.1|4706332_4706788_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	53.0	2.1e-35
WP_078090093.1|4706784_4707270_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	40.4	9.9e-20
WP_078090094.1|4707381_4707804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078090095.1|4707800_4708286_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	60.5	1.6e-41
WP_078090096.1|4708275_4708479_-	hypothetical protein	NA	A0A2H4J9Q9	uncultured_Caudovirales_phage	58.1	4.6e-11
WP_078090097.1|4708487_4708703_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	47.0	1.6e-09
WP_078090098.1|4708699_4709167_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	38.8	2.6e-17
WP_078090099.1|4709268_4709949_-	hypothetical protein	NA	E5FFI5	Burkholderia_phage	45.8	1.6e-44
WP_078090100.1|4709958_4710975_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	60.5	4.5e-115
WP_078090101.1|4711029_4711851_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	48.7	1.3e-56
WP_078090427.1|4711996_4713787_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	59.6	2.0e-206
WP_078090102.1|4713776_4714835_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	57.5	1.2e-107
WP_078090428.1|4716193_4717141_-	OmpA family protein	NA	NA	NA	NA	NA
4715828:4715904	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGTCGGCACCACTAAAAGTGGTTATAAAGCAAAGCGTTAGAGA	NA	NA	NA	NA
WP_159053574.1|4717254_4717707_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_078090105.1|4717900_4718869_+	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_078090106.1|4718991_4719657_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_078090107.1|4719892_4721809_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_078090108.1|4721808_4722765_-	homoserine kinase	NA	NA	NA	NA	NA
WP_078090109.1|4722939_4725729_+	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	26.2	1.5e-43
WP_078090110.1|4725828_4726854_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_078090429.1|4727092_4728184_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	9.0e-29
WP_078090430.1|4728180_4729905_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_078090111.1|4730077_4731409_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_078090112.1|4731405_4731909_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_078090113.1|4731972_4733076_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_078090114.1|4733392_4735531_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
