The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	364965	409201	4889706	integrase,protease,holin,terminase,portal,coat	Salmonella_phage(69.57%)	69	355735:355751	417792:417808
355735:355751	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364965_366018_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366300_367404_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367415_368666_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_006816417.1|368871_370035_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	100.0	1.4e-229
WP_078086203.1|370264_370894_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	99.5	1.9e-119
WP_001277764.1|370994_371174_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_006816413.1|371270_371816_-	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	100.0	9.5e-104
WP_006816411.1|371812_372628_-	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	100.0	7.5e-137
WP_006816410.1|372638_372902_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	100.0	3.7e-45
WP_016049830.1|372889_373165_-	hypothetical protein	NA	I6R982	Salmonella_phage	100.0	1.9e-52
WP_016049831.1|373198_373429_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	100.0	6.9e-40
WP_006816408.1|373431_373953_-	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	100.0	2.1e-92
WP_015968590.1|373949_374327_-	hypothetical protein	NA	A0A220NQV7	Salmonella_phage	100.0	2.5e-63
WP_001214771.1|374323_374494_-	DUF2737 domain-containing protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
WP_001111310.1|374504_374798_-	hypothetical protein	NA	E7C9P8	Salmonella_phage	100.0	3.2e-50
WP_001253475.1|374844_375129_-	sigma-70 family RNA polymerase sigma factor	NA	E7C9P9	Salmonella_phage	100.0	2.3e-45
WP_000365269.1|375128_375836_-	recombinase	NA	E7C9Q0	Salmonella_phage	100.0	3.7e-140
WP_001552364.1|375844_376033_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
WP_020838488.1|376135_376297_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
WP_000776962.1|376366_376681_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_078086204.1|376852_377407_-	pentapeptide repeat-containing protein	NA	Q8HAH0	Salmonella_phage	98.4	1.3e-55
WP_000213981.1|377490_377685_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_000216177.1|377763_378102_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	100.0	1.1e-57
WP_071533030.1|378324_378522_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	97.1	1.5e-11
WP_023177700.1|378659_379322_-	helix-turn-helix domain-containing protein	NA	Q37946	Enterobacteria_phage	100.0	6.3e-126
WP_000067726.1|379440_379656_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_001103492.1|379766_380048_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_006819445.1|380221_381121_+	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	100.0	2.1e-156
WP_006819447.1|381110_382547_+	hypothetical protein	NA	A0A220NQX0	Salmonella_phage	100.0	7.2e-276
WP_006819448.1|382621_382894_+	DUF4752 domain-containing protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_015968593.1|382903_383113_+	hypothetical protein	NA	Q8HAG1	Salmonella_phage	100.0	4.8e-32
WP_006819450.1|383190_383373_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	100.0	2.4e-27
WP_015968595.1|383375_383672_+	hypothetical protein	NA	A0A220NQY0	Salmonella_phage	100.0	2.8e-49
WP_023245190.1|383628_384075_+	recombination protein NinB	NA	A0A220NQX4	Salmonella_phage	100.0	8.3e-82
WP_024139963.1|384071_384245_+	hypothetical protein	NA	Q8HAF7	Salmonella_phage	100.0	8.9e-32
WP_000113765.1|384211_384388_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|384390_384732_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950971.1|384724_384898_+	protein ninF	NA	A0A220NQX7	Salmonella_phage	100.0	5.6e-26
WP_000986768.1|384887_385193_+	hypothetical protein	NA	Q8HAF3	Salmonella_phage	100.0	1.3e-54
WP_000002241.1|385185_385476_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
WP_015968599.1|385472_385868_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	100.0	9.1e-72
WP_000149925.1|385864_386068_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219143.1|386048_386228_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	100.0	9.2e-24
WP_000027541.1|386224_386743_+	DUF1133 domain-containing protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_001129219.1|387142_387460_+|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
WP_001194317.1|387446_387845_+	hypothetical protein	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
WP_000957961.1|388055_388241_+	hypothetical protein	NA	K7PJK4	Enterobacteria_phage	98.4	3.3e-24
WP_000808099.1|388589_388832_+	DUF2560 domain-containing protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|388835_389225_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|389224_389629_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|389632_390121_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_006819463.1|390098_391598_+|terminase	terminase large subunit	terminase	Q5C836	Enterobacteria_phage	100.0	1.7e-307
WP_006819465.1|391597_393775_+|portal	portal protein	portal	Q5C835	Enterobacteria_phage	100.0	0.0e+00
WP_006831698.1|393788_394700_+	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_001196937.1|394699_395992_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538674.1|396032_396593_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001166093.1|396576_397077_+	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_006819470.1|397036_398455_+	Tail accessory protein	NA	A0A220NQZ5	Salmonella_phage	100.0	4.9e-277
WP_000774919.1|398458_399097_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_000627703.1|399096_399552_+	hypothetical protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|399554_400244_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_078086275.1|400286_401588_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	99.8	4.1e-238
WP_001029860.1|401587_403564_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_015974226.1|403696_403996_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	5.1e-51
WP_000532177.1|404016_404265_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_006819477.1|404400_406404_+	protein 9	NA	A0A220NR02	Salmonella_phage	100.0	0.0e+00
WP_000671496.1|406462_407920_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_078086205.1|407909_408842_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	99.7	2.1e-175
WP_000915528.1|408838_409201_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
417792:417808	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	1017115	1024129	4889706	protease,transposase	Dickeya_phage(16.67%)	8	NA	NA
WP_001201751.1|1017115_1018234_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1018230_1020177_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_071524039.1|1020157_1020352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447499.1|1020306_1020528_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020851_1021172_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1021202_1023479_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001542475.1|1023525_1023714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|1023670_1024129_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 3
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	1076111	1174917	4889706	protease,holin,lysis,terminase,tRNA,portal,tail	Salmonella_phage(43.1%)	104	NA	NA
WP_001154025.1|1076111_1076915_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076907_1078230_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1078210_1078915_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1078914_1083381_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1083725_1085567_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085826_1086375_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1086402_1087050_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1087111_1088302_-	aspartate aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1088486_1089578_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1090184_1091585_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091785_1092247_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1092243_1092477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1092563_1093778_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
WP_000893207.1|1094022_1095459_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1095536_1096739_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001526473.1|1096933_1098274_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.6	3.6e-261
WP_000065276.1|1098270_1098519_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098559_1098799_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1098841_1099999_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1099961_1102847_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1102973_1103273_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1103294_1103453_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1103445_1103706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1103755_1104166_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1104285_1104525_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1104490_1104865_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_031235175.1|1104949_1105933_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1105935_1106685_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1106695_1107043_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1107039_1107351_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1107428_1107719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1108010_1108244_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1108355_1108577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1108659_1109262_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1109261_1109468_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096546.1|1109470_1110082_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_001617856.1|1110078_1110225_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_023893238.1|1110214_1111012_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.0e-151
WP_010989004.1|1111078_1111396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1111569_1111695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1111830_1112280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086209.1|1112640_1113327_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	1.4e-131
WP_001574216.1|1113602_1113932_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984584.1|1113915_1114368_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_001541990.1|1114385_1114865_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1115072_1115606_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1115562_1117701_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1117697_1117904_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1117930_1119448_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1119371_1121453_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1121543_1121867_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1121859_1122159_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1122139_1122706_+|tail	tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1122702_1123104_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1123115_1123865_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1123910_1124309_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1124305_1124635_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1124714_1127702_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1127698_1128031_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1128129_1128627_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1128743_1129277_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1129366_1130062_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1130071_1130809_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1130706_1131411_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1131482_1133930_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_031615525.1|1133908_1134832_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_000178849.1|1134870_1135113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086210.1|1135166_1137605_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	3.7e-91
WP_000143167.1|1137604_1138186_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1138661_1139630_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1140277_1140904_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1140972_1141272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1142212_1142404_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1142830_1145443_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1145650_1146661_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001220671.1|1146826_1147369_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1147365_1148475_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1148573_1150682_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
WP_000053044.1|1150694_1152602_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1152616_1153870_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000433414.1|1153874_1155515_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
WP_000759136.1|1155511_1156075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537784.1|1156330_1156498_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1156597_1157116_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000156454.1|1157184_1158945_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1159130_1159583_+	macrodomain Ter protein	NA	NA	NA	NA	NA
WP_001674965.1|1159654_1160707_-	outer membrane protein A	NA	NA	NA	NA	NA
WP_000288732.1|1161062_1161572_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1161788_1162394_+	DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1162380_1164534_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1164552_1164999_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1165122_1167177_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1167212_1167671_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1167765_1168428_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_000975203.1|1168598_1169015_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1169059_1169377_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1169434_1170646_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
WP_000859419.1|1170860_1171409_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1171434_1172214_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1172262_1172544_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1172540_1172870_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1172956_1173616_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_071531552.1|1173681_1173891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938191.1|1174236_1174917_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	1959633	1968252	4889706	tail,integrase	Salmonella_phage(37.5%)	17	1956310:1956332	1966021:1966043
1956310:1956332	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_014344507.1|1959633_1959759_-	putative cytoplasmic protein	NA	S4TTF2	Salmonella_phage	89.5	4.3e-12
WP_000457876.1|1960454_1960580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|1960842_1960959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1961149_1961350_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|1961446_1962328_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_000348546.1|1962482_1962746_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	59.8	9.1e-20
WP_053871265.1|1962800_1962986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1963050_1963218_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1963474_1964008_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001709685.1|1964061_1964349_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	9.9e-28
WP_010989030.1|1964481_1964976_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001173880.1|1964993_1965890_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.3	6.6e-78
WP_010989031.1|1966086_1966206_-	hypothetical protein	NA	NA	NA	NA	NA
1966021:1966043	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000722368.1|1966263_1966617_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000979702.1|1966633_1967509_-	membrane protein	NA	NA	NA	NA	NA
WP_000168393.1|1967509_1967884_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1968021_1968252_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2043701	2122158	4889706	plate,integrase,protease,holin,terminase,portal,tail,head,transposase,capsid	Salmonella_phage(66.67%)	105	2050239:2050254	2123781:2123796
WP_000502119.1|2043701_2044160_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001542475.1|2044116_2044305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659236.1|2044340_2045546_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2045624_2047112_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2047368_2048772_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
WP_000287764.1|2048786_2049194_+	flagellar protein FliS	NA	NA	NA	NA	NA
WP_000204899.1|2049193_2049562_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2049633_2051118_+	alpha-amylase	NA	NA	NA	NA	NA
2050239:2050254	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2051157_2051583_-	lipoprotein	NA	NA	NA	NA	NA
WP_000580669.1|2051708_2052974_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000790504.1|2052970_2053204_+	SirA-like protein	NA	NA	NA	NA	NA
WP_000639596.1|2053468_2053855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2053974_2054289_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_023892992.1|2054505_2056188_+	flagellar M-ring protein	NA	NA	NA	NA	NA
WP_000067735.1|2056180_2057176_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2057168_2057876_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2057875_2059246_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
WP_000046981.1|2059267_2059711_+	flagellar protein FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2059707_2060925_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2061029_2061497_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2061501_2062506_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2062502_2062916_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2062915_2063293_+	flagellar protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2063292_2064030_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2064039_2064309_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2064317_2065112_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2065393_2066017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000978758.1|2066055_2066253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844798.1|2066378_2066606_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
WP_000948794.1|2066915_2067731_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_023892993.1|2067709_2069422_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2069586_2069832_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000929134.1|2069848_2070760_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2070935_2071856_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2071844_2072315_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2072295_2073726_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2073799_2074495_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2074586_2074886_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2075535_2076732_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2076992_2077181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2077191_2077404_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2077858_2079127_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2079129_2079549_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2079675_2079837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343854.1|2079814_2080057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2080467_2080689_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_078086223.1|2080901_2081909_+	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	99.7	8.8e-196
WP_000760554.1|2082193_2082763_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2082762_2084325_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001624448.1|2084311_2084899_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	98.5	3.5e-112
WP_053299737.1|2084901_2085981_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	96.9	2.2e-200
WP_001624458.1|2085973_2086387_-	Phage FluMu protein gp46	NA	A0A192Y6D0	Salmonella_phage	94.2	2.8e-71
WP_001273647.1|2086391_2086925_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	99.4	1.9e-96
WP_001624460.1|2086924_2087983_-|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	99.4	6.6e-202
WP_001624461.1|2087979_2089320_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	98.9	5.3e-249
WP_049280221.1|2089353_2091282_-	transglycosylase	NA	A0A192Y6D8	Salmonella_phage	98.3	0.0e+00
WP_000588852.1|2091366_2091693_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2091689_2092046_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000497739.1|2093531_2093696_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|2093699_2094260_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001822325.1|2094256_2094769_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	99.4	1.0e-91
WP_078086224.1|2094740_2095145_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	99.3	9.3e-72
WP_000927378.1|2095141_2095465_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2095467_2095668_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_053299738.1|2095718_2096924_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	99.3	7.7e-223
WP_001193639.1|2096938_2097589_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_001624477.1|2097566_2098808_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.5	7.6e-242
WP_000605609.1|2098807_2098990_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_053299739.1|2099001_2100735_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.7	0.0e+00
WP_000929191.1|2100731_2101226_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135228.1|2101349_2101700_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000127618.1|2101723_2102263_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001075993.1|2102259_2102877_-	chitinase	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000226304.1|2102876_2103158_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294874.1|2103144_2103534_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000765639.1|2103622_2104195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357930.1|2104207_2105281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047142.1|2105330_2106083_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	6.4e-135
WP_012543375.1|2106096_2107086_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_023228497.1|2107093_2107954_-	hypothetical protein	NA	A0A192Y6F8	Salmonella_phage	97.9	4.3e-159
WP_001529171.1|2107970_2108360_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	9.2e-61
WP_078086225.1|2108356_2109034_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	83.1	5.5e-109
WP_070810381.1|2109033_2109516_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	3.0e-85
WP_078086226.1|2109517_2110462_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	86.0	1.6e-127
WP_078086227.1|2110451_2110631_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.2	1.1e-13
WP_003826142.1|2110803_2111355_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.4	6.1e-66
WP_003826141.1|2111366_2111594_-	cell division protein	NA	NA	NA	NA	NA
WP_058806092.1|2111696_2112323_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	49.3	3.2e-47
WP_070794471.1|2112506_2112692_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	71.1	5.8e-13
WP_001574551.1|2112619_2112871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752499.1|2112851_2113148_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
WP_000141752.1|2113065_2113311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132397.1|2113300_2113750_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	85.2	2.1e-24
WP_000997190.1|2113847_2114219_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_058819372.1|2114276_2115104_+	DUF2303 domain-containing protein	NA	A0A192Y6E5	Salmonella_phage	98.5	1.4e-151
WP_078086228.1|2115240_2115780_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	1.0e-97
WP_078086229.1|2115850_2116390_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	71.3	3.6e-63
WP_020898896.1|2116389_2116749_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	2.1e-22
WP_024148319.1|2116753_2117455_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	59.9	3.6e-79
WP_001061334.1|2117458_2118028_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2118052_2118295_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2118296_2119286_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2119577_2120375_+	protein MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2120746_2121037_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2121684_2122158_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2123781:2123796	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2208154	2218660	4889706		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2208154_2209468_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2209494_2210574_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2210578_2211352_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2211348_2212341_-	protein RfbI	NA	NA	NA	NA	NA
WP_000973708.1|2212346_2212898_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2212898_2213777_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2213824_2214724_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2214723_2215809_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2216185_2217079_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2217256_2218660_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2286968	2296139	4889706	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2286968_2289002_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2289242_2289701_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2289872_2290403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950413.1|2290459_2290927_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2290973_2291693_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000272845.1|2291689_2293375_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2293597_2294329_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2294388_2294496_+	membrane protein	NA	NA	NA	NA	NA
WP_000824855.1|2294476_2295208_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2295191_2296139_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2368191	2381942	4889706	tail,protease,head,holin	Salmonella_phage(38.46%)	14	NA	NA
WP_000806401.1|2368191_2368695_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2368722_2369013_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2369360_2371190_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2371243_2371687_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2372064_2372592_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_078086231.1|2372594_2373836_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	96.3	1.2e-53
WP_000003792.1|2373896_2374415_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	88.0	5.2e-75
WP_001120499.1|2374428_2374758_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2375054_2376386_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2376414_2376783_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_078086277.1|2376797_2377787_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
WP_001115840.1|2378115_2380482_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2380650_2380854_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2381150_2381942_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2762867	2803803	4889706	tail,holin,lysis	Salmonella_phage(40.38%)	56	NA	NA
WP_000790154.1|2762867_2764667_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_071925522.1|2765071_2766562_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	98.4	4.7e-254
WP_072145051.1|2767323_2767617_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	80.0	9.2e-21
WP_023893019.1|2767794_2768802_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	94.9	1.1e-187
WP_023893018.1|2769085_2769655_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.8	1.6e-93
WP_023893017.1|2769654_2771106_-	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_001181747.1|2771095_2771698_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_001293657.1|2771699_2772941_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001191865.1|2772937_2773294_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_023893016.1|2773306_2773984_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	1.9e-32
WP_000122818.1|2773964_2774834_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|2774830_2775133_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_001011706.1|2775132_2775843_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.3	4.7e-26
WP_000741779.1|2775839_2778011_-	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|2777994_2778177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|2778218_2778623_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|2778622_2779069_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_023893015.1|2779069_2780554_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	2.6e-95
WP_000094504.1|2780534_2781080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048637.1|2781064_2781430_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000247613.1|2781426_2782011_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
WP_016716089.1|2782004_2782451_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
WP_000829560.1|2782457_2782805_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_001031914.1|2782808_2783837_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	8.7e-82
WP_023260969.1|2783836_2784319_-	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	2.6e-20
WP_016716092.1|2784320_2785667_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_016716093.1|2785663_2786353_-	phage protein F	NA	H9C0V1	Aeromonas_phage	48.9	8.4e-57
WP_023893014.1|2786393_2787914_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	4.8e-105
WP_016716095.1|2787913_2789533_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
WP_016716096.1|2789535_2790162_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	2.0e-105
WP_016716097.1|2790266_2790473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113128.1|2790580_2790763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2790987_2791440_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984584.1|2791457_2791910_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_001574216.1|2791893_2792223_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001533567.1|2792498_2793185_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.2	1.1e-130
WP_023893238.1|2793318_2794116_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.0e-151
WP_001617856.1|2794105_2794252_-	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096546.1|2794248_2794860_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_001241019.1|2794862_2795069_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929790.1|2795068_2795671_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2795705_2795954_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2796070_2796304_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014344025.1|2796562_2796754_-	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
WP_000002116.1|2796865_2797147_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_000208067.1|2797139_2797793_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000852188.1|2797795_2798266_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000065092.1|2798267_2798933_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000788827.1|2798947_2799640_-	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000024048.1|2799636_2800542_-	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_072143007.1|2800633_2801008_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000145711.1|2800973_2801201_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_063325262.1|2801214_2801682_+	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	86.3	1.2e-67
WP_000368620.1|2801833_2802919_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000373340.1|2803026_2803233_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000551857.1|2803632_2803803_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
>prophage 10
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	2815295	2940368	4889706	plate,integrase,terminase,tRNA,portal,tail,head,capsid	Salmonella_phage(66.67%)	112	2814176:2814191	2944286:2944301
2814176:2814191	attL	TTGATTTAATTATCTC	NA	NA	NA	NA
WP_000083343.1|2815295_2816033_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000219174.1|2816163_2817498_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2817515_2818415_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2818517_2819105_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
WP_000627811.1|2819166_2819550_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2819868_2820558_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2820673_2821711_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2821914_2822334_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2822406_2823087_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2823140_2825801_+	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
WP_000949286.1|2825915_2827271_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2827315_2827639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807809.1|2827635_2828937_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2829040_2829496_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2835375_2837949_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2838078_2838810_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000079130.1|2838806_2839787_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
WP_000197660.1|2839918_2840656_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2840927_2841266_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000200080.1|2841516_2842677_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2842637_2843546_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2843603_2844725_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2844734_2845805_-	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2846244_2846763_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_001030985.1|2846755_2847976_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2848132_2848480_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2848520_2849288_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2849332_2849881_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2849899_2850148_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2850461_2851823_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2851988_2852780_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001519447.1|2852844_2854086_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001287923.1|2854206_2854812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2854846_2855437_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001607188.1|2855433_2855628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059155.1|2855559_2856438_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2856523_2858185_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2858333_2858672_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2858837_2859128_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2859117_2859594_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_001518569.1|2859743_2860226_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2860840_2872315_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533858.1|2872379_2873789_+	TolC family type I secretion outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2873785_2875966_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2875973_2877137_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_078086279.1|2877688_2877907_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	98.6	8.0e-38
WP_001749781.1|2877975_2879076_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	99.2	2.8e-195
WP_078086234.1|2879555_2882363_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.1	0.0e+00
WP_000763317.1|2882355_2882475_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|2882489_2882792_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_078086235.1|2883370_2884543_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	96.7	1.8e-216
WP_000680167.1|2884673_2885201_-|tail	tail protein	tail	NA	NA	NA	NA
WP_078086236.1|2885203_2886970_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	52.0	1.2e-136
WP_078086237.1|2886966_2887572_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	99.0	1.9e-116
WP_078086238.1|2887564_2888473_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.3	1.7e-158
WP_000177408.1|2888459_2888819_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_001672413.1|2888815_2889394_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_078086239.1|2889577_2890324_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	99.6	9.2e-142
WP_078086240.1|2890325_2890772_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	98.6	8.7e-71
WP_001039958.1|2890764_2891196_-|tail	tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_078086241.1|2891158_2891362_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
WP_078086242.1|2891291_2891720_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	94.3	7.5e-64
WP_078086243.1|2891716_2892091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069920.1|2892095_2892605_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	6.4e-94
WP_000171565.1|2892585_2892801_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2892804_2893008_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673535.1|2893007_2893472_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_000059172.1|2893565_2894216_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_000730757.1|2894219_2895284_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.7	1.9e-196
WP_000216276.1|2895300_2896134_-|capsid	phage capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_078086244.1|2896276_2898043_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_078086245.1|2898042_2898768_+|terminase	terminase-like family protein	terminase	Q9ZXM5	Pseudomonas_virus	40.3	5.4e-22
WP_045307532.1|2898764_2899820_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.8e-175
WP_078086246.1|2900282_2902175_-	NTPase KAP	NA	NA	NA	NA	NA
WP_058144949.1|2902494_2902728_-	DinI family protein	NA	E5G6M1	Salmonella_phage	96.1	2.0e-34
WP_001154444.1|2902739_2902928_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_078086247.1|2903083_2905495_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.9	0.0e+00
WP_078086248.1|2905488_2906343_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	81.0	7.1e-130
WP_078086249.1|2906339_2906567_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	89.3	3.6e-33
WP_078086250.1|2906566_2906800_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
WP_000963480.1|2906867_2907209_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_000956168.1|2907172_2907373_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_078086251.1|2907380_2907890_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	99.4	4.7e-89
WP_000102106.1|2907922_2908165_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_078086252.1|2908288_2908918_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	56.0	2.7e-62
WP_078086253.1|2908921_2909938_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.8	1.2e-192
WP_078086254.1|2910322_2912056_-	deoxycytidylate deaminase	NA	NA	NA	NA	NA
WP_001542208.1|2912462_2913527_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2913540_2913708_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2913754_2914348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2914737_2915931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2917545_2917761_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2917796_2919866_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2920368_2921652_+	ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2921696_2922515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989065.1|2922667_2923024_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2923118_2923403_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2923515_2924037_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2924033_2924408_+	PTS sorbitol transporter	NA	NA	NA	NA	NA
WP_001098984.1|2924404_2925385_+	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2925395_2926409_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023893156.1|2926703_2927906_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2927979_2928615_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|2928638_2929202_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2929201_2930044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2930173_2931715_-	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_000021514.1|2931939_2933619_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000945857.1|2933618_2933801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088556.1|2934735_2935611_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|2935776_2937651_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|2937910_2939194_-	membrane protein	NA	NA	NA	NA	NA
WP_001682341.1|2939771_2940368_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
2944286:2944301	attR	GAGATAATTAAATCAA	NA	NA	NA	NA
>prophage 11
NZ_CP013720	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607, complete genome	4889706	4451625	4472045	4889706	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4451625_4452354_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4452550_4452841_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4453089_4453545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4453541_4454147_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4454151_4455897_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4455899_4456532_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4456524_4457640_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4457630_4457990_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4458153_4459701_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4459700_4460630_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4460626_4460989_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4461316_4462039_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4462048_4463092_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4463079_4463289_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4463288_4464242_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4464241_4466596_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4466692_4466821_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023893164.1|4466780_4467098_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4467149_4467674_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4467673_4469101_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4469090_4469288_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4469284_4469740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023893165.1|4469899_4470214_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.4e-19
WP_001270441.1|4470226_4470832_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4470834_4471122_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4471697_4472045_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP013721	Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence	93925	40859	50155	93925		Escherichia_phage(28.57%)	10	NA	NA
WP_001541564.1|40859_41276_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41459_41795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728917.1|42449_43391_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43805_45011_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|45007_45985_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000457541.1|46066_47341_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|47340_47763_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48273_48744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48736_49093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49474_50155_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
