The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019866	Dehalococcoides mccartyi strain KBTCE3 chromosome, complete genome	1271604	398718	414141	1271604		Bacillus_phage(20.0%)	15	NA	NA
WP_077975133.1|398718_400011_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	25.6	2.0e-22
WP_077975134.1|400012_401215_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	31.1	4.8e-15
WP_077975135.1|401230_402412_+	NTP transferase domain-containing protein	NA	A0A1D7XFC1	Escherichia_phage	33.3	3.2e-19
WP_077975136.1|402413_404195_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-109
WP_041341495.1|404202_404655_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_077975137.1|404666_405371_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_078051059.1|405510_406815_+	diaminopimelate decarboxylase	NA	A0A0N7KVV8	Yellowstone_lake_phycodnavirus	24.6	1.1e-17
WP_077975138.1|406829_407849_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	25.8	7.7e-14
WP_077975139.1|407851_408685_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_077975140.1|408670_409204_-	HNH endonuclease	NA	H6WG01	Cyanophage	37.2	2.6e-21
WP_077975141.1|409275_410688_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	32.8	8.7e-24
WP_077975142.1|410611_411322_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_041330720.1|411318_412695_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	41.1	7.0e-87
WP_010936318.1|412695_413151_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_077975143.1|413220_414141_-	thioredoxin-disulfide reductase	NA	A0A249XZT7	Enterococcus_phage	41.0	5.6e-48
>prophage 2
NZ_CP019866	Dehalococcoides mccartyi strain KBTCE3 chromosome, complete genome	1271604	791159	904747	1271604	protease,tail,head,portal,holin,integrase,terminase,tRNA,capsid	Erysipelothrix_phage(45.83%)	113	878040:878099	879718:879787
WP_149866963.1|791159_792017_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	32.0	2.1e-33
WP_171973442.1|794670_795384_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	33.7	1.6e-26
WP_010936721.1|795413_795554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010936722.1|795575_795851_+	acylphosphatase	NA	NA	NA	NA	NA
WP_010936723.1|795876_796611_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_077975366.1|797146_798634_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.2e-47
WP_077975367.1|798633_799236_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041342418.1|799284_800139_-	DegV family protein	NA	NA	NA	NA	NA
WP_077975368.1|800214_801738_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	24.6	2.4e-27
WP_010936730.1|802308_803673_+	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041342424.1|803793_804609_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	33.1	3.0e-13
WP_077975369.1|804617_805739_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	30.4	2.2e-14
WP_077975370.1|805751_808796_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	33.4	1.3e-154
WP_041342429.1|809097_809778_-	protein jag	NA	NA	NA	NA	NA
WP_041223374.1|809689_810637_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_010936736.1|810648_811764_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077975371.1|811773_811986_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	1.3e-19
WP_171973443.1|811957_812320_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_010936738.1|812379_812520_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_058292646.1|812556_813000_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_010936740.1|813034_813442_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	43.7	3.4e-21
WP_010936741.1|813490_813820_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_077975668.1|814299_815265_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010936745.1|815569_815812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975373.1|815887_816265_-	RidA family protein	NA	NA	NA	NA	NA
WP_077975374.1|816395_817721_+	ATPase	NA	NA	NA	NA	NA
WP_077975669.1|817813_818953_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_077975375.1|819136_820903_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_077975376.1|820905_821769_+	DMT family transporter	NA	NA	NA	NA	NA
WP_077975377.1|821872_822430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975378.1|822533_823217_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	4.6e-39
WP_077975379.1|823223_824645_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.7	1.6e-30
WP_077975380.1|824852_826259_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041342460.1|826626_827325_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077975381.1|827321_830627_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_077975670.1|830761_831946_+	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	5.9e-34
WP_077975382.1|832230_832713_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_077975671.1|832853_834413_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	52.6	5.6e-149
WP_077975383.1|834427_834841_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	44.2	6.6e-25
WP_077975384.1|834841_836404_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	51.6	1.1e-152
WP_171973444.1|836454_836682_-	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	45.9	1.4e-05
WP_077975385.1|836770_837481_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	42.0	3.1e-46
WP_077975386.1|837477_837888_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	58.1	6.6e-41
WP_077975387.1|837903_839232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975388.1|839236_841525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975389.1|841537_842941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975390.1|842937_843285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975391.1|843281_845459_-|tail	phage tail protein	tail	A0A2K5B297	Erysipelothrix_phage	49.3	1.7e-26
WP_077975393.1|845669_846053_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.5	2.5e-42
WP_077975394.1|846059_846662_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.8	3.0e-74
WP_077975395.1|846667_847006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975396.1|847002_847437_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	46.8	2.2e-26
WP_077975397.1|847436_847772_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	50.0	5.0e-23
WP_077975398.1|847877_848297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975399.1|848293_848611_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	69.0	2.5e-32
WP_077975400.1|848625_848997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975401.1|849012_850194_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	56.1	1.6e-116
WP_077975402.1|850213_850945_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	65.8	2.6e-80
WP_077975403.1|850941_852177_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	66.4	1.8e-158
WP_077975404.1|852173_853784_-|terminase	terminase large subunit	terminase	A0A1X9I6B3	Streptococcus_phage	56.5	5.5e-176
WP_077975405.1|853929_854364_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_077975406.1|855524_857513_-	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	35.5	1.9e-29
WP_077975407.1|857478_858762_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	49.9	7.7e-112
WP_078051068.1|858765_859404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975409.1|859406_859757_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.0	2.4e-31
WP_077975673.1|859859_860282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975410.1|860359_861718_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.9	1.1e-153
WP_077975411.1|861698_861980_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	61.1	6.5e-24
WP_171973445.1|862211_864539_-	hypothetical protein	NA	A0A1W6JQ82	Corynebacterium_phage	48.3	4.5e-219
WP_077975412.1|864526_864766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975413.1|864755_865178_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	57.6	1.5e-40
WP_077975414.1|865158_865431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975415.1|865423_866203_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	55.2	1.7e-74
WP_077975416.1|866292_868287_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	67.5	1.5e-263
WP_077975417.1|868352_868943_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	74.4	7.9e-72
WP_077975418.1|868935_870069_-	DUF2800 domain-containing protein	NA	Q6DMW2	Streptococcus_phage	56.7	2.2e-118
WP_078051069.1|870061_870409_-	DNA ligase	NA	A0A2K5B2A7	Erysipelothrix_phage	39.8	2.3e-10
WP_077975420.1|870392_870575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975421.1|870663_871125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171973446.1|871285_871444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975422.1|871661_872588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975423.1|872584_873031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975424.1|873035_874934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975675.1|875004_875241_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	62.3	1.1e-19
WP_077975425.1|875240_876752_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	30.9	3.2e-56
WP_077975426.1|876741_877245_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	36.0	1.1e-26
WP_149866965.1|877444_878089_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
878040:878099	attL	CCGAATGGCTCGAAGTCCACGAACCAAGACTTGAAAATGGCCTGTGCCATCTGCTCTAAA	NA	NA	NA	NA
WP_077975428.1|878160_879153_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.8	1.5e-35
WP_077975429.1|879166_879841_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
879718:879787	attR	TTTAGAGCAGATGGCACAGGCCATTTTCAAGTCTTGGTTCGTGGACTTCGAGCCATTCGGTGGCGTAATG	NA	NA	NA	NA
WP_077975430.1|880562_882626_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_078051070.1|882640_883090_+	hypothetical protein	NA	A0A2K5B264	Erysipelothrix_phage	47.9	1.4e-31
WP_077975431.1|884158_884833_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077975433.1|884884_885310_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_041343624.1|885378_887079_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.2	4.5e-83
WP_010936816.1|887164_888496_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_010936817.1|888617_888956_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010936818.1|888952_890179_-	ammonium transporter	NA	NA	NA	NA	NA
WP_041342471.1|890318_890990_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	1.0e-19
WP_010936820.1|891011_891782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041342474.1|891782_893285_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_077975434.1|893286_894048_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_041342480.1|894041_895172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010936824.1|895184_896492_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077975435.1|896488_897106_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010936826.1|897121_897553_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_077975436.1|897673_898255_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_077975437.1|898376_899339_+	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.5	6.2e-74
WP_077975438.1|899427_899928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975440.1|900453_901002_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_077975441.1|901001_901778_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_077975442.1|901817_903257_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041342510.1|903266_903929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975443.1|903925_904747_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
